Starting /dee2/code/volunteer_pipeline.sh SRR7171066 current disk space = 3089261514752 free memory = 1579742000 SRR7171066 SRAfilesize 52100f3033f29326e641264b16cd64ce SRR7171066.sra SRR7171066.sra file validated SRR7171066 is paired end SRR7171066 is conventional basespace SRR7171066 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171066_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.5385 18.0 18.0 28.0 18.0 33.0 2 28.93225 30.0 27.0 31.0 25.0 33.0 3 30.8275 31.0 29.0 33.0 27.0 33.0 4 32.158 33.0 33.0 33.0 30.0 33.0 5 32.52825 33.0 33.0 34.0 31.0 34.0 6 36.705 38.0 37.0 38.0 34.0 38.0 7 37.20575 38.0 38.0 38.0 36.0 38.0 8 37.3285 38.0 38.0 38.0 36.0 38.0 9 37.49675 38.0 38.0 38.0 37.0 38.0 10-14 37.49025 38.0 38.0 38.0 37.2 38.0 15-19 37.473299999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.52910000000001 38.0 38.0 38.0 37.6 38.0 25-29 37.10145 38.0 38.0 38.0 35.6 38.0 30-34 37.23935 38.0 38.0 38.0 36.4 38.0 35-39 36.2205 38.0 36.4 38.0 31.6 38.0 40-44 37.3235 38.0 38.0 38.0 37.0 38.0 45-49 36.847699999999996 38.0 37.8 38.0 34.8 38.0 50-54 37.16805000000001 38.0 38.0 38.0 36.6 38.0 55-59 37.2225 38.0 38.0 38.0 36.6 38.0 60-64 36.5281 38.0 37.4 38.0 33.6 38.0 65-69 35.983549999999994 38.0 36.0 38.0 30.2 38.0 70-74 36.402699999999996 38.0 37.6 38.0 32.6 38.0 75-79 36.861399999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.850750000000005 38.0 38.0 38.0 35.2 38.0 85-89 35.571299999999994 37.8 35.6 38.0 30.8 38.0 90-94 35.8194 38.0 36.2 38.0 31.4 38.0 95-99 35.40355 38.0 36.0 38.0 27.2 38.0 100-104 36.145500000000006 38.0 37.0 38.0 32.6 38.0 105-109 36.2605 38.0 37.2 38.0 33.8 38.0 110-114 35.17605 38.0 35.8 38.0 26.4 38.0 115-119 32.23965 35.0 29.4 37.8 23.4 38.0 120-124 35.58290000000001 38.0 36.2 38.0 30.6 38.0 125-129 35.392599999999995 38.0 36.0 38.0 30.6 38.0 130-134 34.28685 38.0 33.8 38.0 24.6 38.0 135-139 34.41250000000001 38.0 33.6 38.0 27.0 38.0 140-144 33.77055 38.0 33.0 38.0 23.4 38.0 145-149 30.03655 35.8 26.4 38.0 8.0 38.0 150-151 25.980874999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 0.0 18 2.0 19 3.0 20 4.0 21 5.0 22 4.0 23 5.0 24 8.0 25 15.0 26 23.0 27 29.0 28 32.0 29 49.0 30 57.0 31 73.0 32 106.0 33 173.0 34 294.0 35 639.0 36 1439.0 37 1032.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.74703869439326 17.030797578310082 7.896814951302974 36.32534877599368 2 19.975 18.099999999999998 37.625 24.3 3 16.879219804951237 25.55638909727432 27.25681420355089 30.307576894223555 4 23.0 31.900000000000002 22.575 22.525000000000002 5 21.180295073768445 36.78419604901225 23.93098274568642 18.104526131532882 6 17.474999999999998 37.4 25.974999999999998 19.15 7 13.975000000000001 22.075 44.15 19.8 8 17.575 23.375 30.75 28.299999999999997 9 18.0 23.0 33.575 25.424999999999997 10-14 20.24 29.060000000000002 26.645000000000003 24.055 15-19 20.285 28.675 27.644999999999996 23.395 20-24 19.7 29.065 27.74 23.494999999999997 25-29 19.865 28.475 28.144999999999996 23.515 30-34 20.49 28.46 27.889999999999997 23.16 35-39 19.415970798539927 28.32141607080354 28.136406820341016 24.126206310315514 40-44 20.256012800640033 28.961448072403623 27.29136456822841 23.491174558727938 45-49 20.485 29.220000000000002 27.634999999999998 22.66 50-54 20.03 29.099999999999998 27.845 23.025000000000002 55-59 20.595 28.389999999999997 27.54 23.474999999999998 60-64 20.165 28.305000000000003 28.16 23.369999999999997 65-69 20.330000000000002 28.63 27.900000000000002 23.14 70-74 20.4 28.925 27.6 23.075000000000003 75-79 20.05 28.794999999999998 27.63 23.525 80-84 20.47602380119006 28.331416570828544 28.14140707035352 23.051152557627884 85-89 20.19802970445567 28.419262889433416 28.16922538380757 23.213482022303346 90-94 20.01600080004 28.31641582079104 27.771388569428474 23.896194809740486 95-99 20.4 28.585 27.05 23.965 100-104 20.217021702170218 28.497849784978495 28.137813781378142 23.14731473147315 105-109 20.78 28.32 28.050000000000004 22.85 110-114 20.575 28.134999999999998 27.52 23.77 115-119 21.099999999999998 28.549999999999997 27.36 22.99 120-124 20.921046052302618 28.111405570278514 27.081354067703383 23.886194309715485 125-129 20.97104855242762 28.086404320216012 27.11135556777839 23.83119155957798 130-134 21.135 28.205000000000002 27.325 23.335 135-139 21.04105205260263 28.181409070453523 27.28636431821591 23.491174558727938 140-144 21.071053552677636 28.146407320366016 26.95634781739087 23.826191309565477 145-149 21.61 28.465 26.515 23.41 150-151 20.530132533133283 28.432108027006752 26.79419854963741 24.243560890222557 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.5 22 1.5 23 2.0 24 3.0 25 3.5 26 6.5 27 8.0 28 9.0 29 15.0 30 24.0 31 33.5 32 46.0 33 55.5 34 58.0 35 68.0 36 93.0 37 113.5 38 131.5 39 174.0 40 204.0 41 229.0 42 266.5 43 266.0 44 242.5 45 242.5 46 243.5 47 226.0 48 209.5 49 201.5 50 176.5 51 134.5 52 117.5 53 94.5 54 70.0 55 61.0 56 45.0 57 30.5 58 20.5 59 17.5 60 13.0 61 8.0 62 7.0 63 5.0 64 3.5 65 3.0 66 2.0 67 2.0 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0125 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.037500000000000006 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.05 0.025 0.0 0.0 0.0 80-81 0.05 0.025 0.0 0.0 0.0 82-83 0.05 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.1 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.16249999999999998 0.025 0.0 0.0 0.0 92-93 0.175 0.025 0.0 0.0 0.0 94-95 0.3125 0.025 0.0 0.0 0.0 96-97 0.44999999999999996 0.025 0.0 0.0 0.0 98-99 0.525 0.025 0.0 0.0 0.0 100-101 0.5874999999999999 0.025 0.0 0.0 0.0 102-103 0.675 0.025 0.0 0.0 0.0 104-105 0.7625 0.025 0.0 0.0 0.0 106-107 0.95 0.025 0.0 0.0 0.0 108-109 1.125 0.025 0.0 0.0 0.0 110-111 1.4375 0.025 0.0 0.0 0.0 112-113 1.6375000000000002 0.025 0.0 0.0 0.0 114-115 1.8875000000000002 0.025 0.0 0.0 0.0 116-117 2.1125 0.025 0.0 0.0 0.0 118-119 2.4749999999999996 0.025 0.0 0.0 0.0 120-121 2.7249999999999996 0.025 0.0 0.0 0.0 122-123 3.0875000000000004 0.025 0.0 0.0 0.0 124-125 3.45 0.025 0.0 0.0 0.0 126-127 3.9375 0.025 0.0 0.0 0.0 128-129 4.5125 0.025 0.0 0.0 0.0 130-131 5.025 0.025 0.0 0.0 0.0 132-133 5.4875 0.025 0.0 0.0 0.0 134-135 6.050000000000001 0.025 0.0 0.0 0.0 136-137 6.5625 0.025 0.0 0.0 0.0 138-139 7.05 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATCT 10 0.0060887975 150.61038 1 GGAGGAA 10 0.0060887975 150.61038 1 CTCAAAT 15 9.780222E-5 150.61038 1 CAGCTAC 10 0.006836113 144.9625 5 AAATATA 10 0.006836113 144.9625 4 TCAAATA 10 0.006836113 144.9625 2 CAAATAT 10 0.006836113 144.9625 3 CTATCTC 10 0.006836113 144.9625 2 >>END_MODULE SRR7171066 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171066_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82725 33.0 33.0 34.0 32.0 34.0 2 32.76875 33.0 33.0 34.0 32.0 34.0 3 32.937 34.0 33.0 34.0 32.0 34.0 4 32.97075 34.0 33.0 34.0 32.0 34.0 5 32.92825 34.0 33.0 34.0 32.0 34.0 6 37.0625 38.0 38.0 38.0 37.0 38.0 7 37.111 38.0 38.0 38.0 37.0 38.0 8 37.211 38.0 38.0 38.0 37.0 38.0 9 37.106 38.0 38.0 38.0 37.0 38.0 10-14 37.0409 38.0 38.0 38.0 36.8 38.0 15-19 37.03395 38.0 38.0 38.0 36.8 38.0 20-24 36.7889 38.0 38.0 38.0 35.8 38.0 25-29 37.03205 38.0 38.0 38.0 37.0 38.0 30-34 37.02745 38.0 38.0 38.0 37.0 38.0 35-39 37.0058 38.0 38.0 38.0 36.8 38.0 40-44 36.89635 38.0 38.0 38.0 36.2 38.0 45-49 36.70175 38.0 38.0 38.0 35.4 38.0 50-54 36.8497 38.0 38.0 38.0 36.0 38.0 55-59 36.88945 38.0 38.0 38.0 36.0 38.0 60-64 36.75105 38.0 38.0 38.0 35.4 38.0 65-69 36.71385 38.0 38.0 38.0 36.0 38.0 70-74 36.6612 38.0 38.0 38.0 35.6 38.0 75-79 36.615899999999996 38.0 38.0 38.0 35.2 38.0 80-84 36.536699999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.5273 38.0 38.0 38.0 34.8 38.0 90-94 36.3949 38.0 38.0 38.0 34.0 38.0 95-99 36.315200000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.08155000000001 38.0 37.6 38.0 33.4 38.0 105-109 35.841950000000004 38.0 37.2 38.0 32.6 38.0 110-114 35.720349999999996 38.0 37.0 38.0 31.2 38.0 115-119 35.4507 38.0 37.0 38.0 31.0 38.0 120-124 35.3456 38.0 36.4 38.0 31.0 38.0 125-129 34.7891 38.0 36.0 38.0 28.6 38.0 130-134 34.526399999999995 38.0 36.0 38.0 27.0 38.0 135-139 33.7286 38.0 33.8 38.0 22.6 38.0 140-144 32.545849999999994 38.0 32.6 38.0 14.6 38.0 145-149 31.710500000000003 38.0 32.0 38.0 8.6 38.0 150-151 25.09875 32.0 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 2.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 4.0 11 2.0 12 4.0 13 1.0 14 1.0 15 3.0 16 0.0 17 5.0 18 5.0 19 3.0 20 7.0 21 6.0 22 11.0 23 9.0 24 11.0 25 26.0 26 23.0 27 28.0 28 37.0 29 34.0 30 34.0 31 64.0 32 85.0 33 109.0 34 163.0 35 333.0 36 800.0 37 2167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.65 19.025 11.225 27.1 2 23.75 27.150000000000002 32.675 16.425 3 20.0 27.650000000000002 31.6 20.75 4 22.3 35.199999999999996 23.175 19.325 5 22.85 37.525 22.05 17.575 6 19.375 37.824999999999996 24.25 18.55 7 17.925 19.725 41.6 20.75 8 20.150000000000002 24.7 28.875 26.275 9 22.225 24.0 30.075000000000003 23.7 10-14 23.11 28.249999999999996 26.450000000000003 22.189999999999998 15-19 22.81614080704035 28.266413320666032 27.811390569528477 21.10605530276514 20-24 23.255 28.49 27.38 20.875 25-29 22.67 28.51 27.82 21.0 30-34 22.625 28.015 28.735 20.625 35-39 22.29 28.435 27.944999999999997 21.33 40-44 23.095 28.189999999999998 27.825 20.89 45-49 22.7 28.310000000000002 27.944999999999997 21.044999999999998 50-54 23.0 28.125 27.87 21.005 55-59 22.830000000000002 28.07 27.93 21.17 60-64 22.830000000000002 27.515 28.155 21.5 65-69 23.13 27.700000000000003 28.105000000000004 21.065 70-74 23.155 27.834999999999997 27.735 21.275 75-79 22.919999999999998 28.115000000000002 28.249999999999996 20.715 80-84 23.36 27.52 28.13 20.990000000000002 85-89 23.25 27.415 28.325 21.01 90-94 23.56 27.925 28.035 20.48 95-99 22.900000000000002 27.875 27.845 21.38 100-104 22.814999999999998 28.42 27.87 20.895 105-109 23.015 27.615000000000002 28.01 21.36 110-114 23.41 28.310000000000002 28.02 20.26 115-119 23.955000000000002 28.125 27.565 20.355 120-124 23.955000000000002 27.794999999999998 28.310000000000002 19.939999999999998 125-129 24.08 27.88 27.38 20.66 130-134 24.23 27.975 27.224999999999998 20.57 135-139 24.09 27.839999999999996 27.82 20.25 140-144 24.455 27.87 27.08 20.595 145-149 24.990000000000002 27.74 27.075 20.195 150-151 25.259472302113295 27.42278354382894 27.31024134050269 20.007502813555085 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 3.5 25 4.5 26 6.5 27 5.5 28 5.5 29 9.0 30 17.0 31 19.5 32 28.5 33 41.0 34 55.0 35 78.5 36 88.5 37 107.0 38 146.5 39 173.5 40 195.0 41 222.0 42 245.0 43 241.5 44 264.0 45 291.0 46 269.0 47 253.5 48 234.0 49 193.5 50 158.5 51 126.0 52 102.0 53 96.0 54 82.0 55 56.5 56 37.5 57 31.5 58 23.0 59 22.5 60 21.0 61 13.5 62 10.0 63 6.5 64 3.5 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31835395102246 98.35000000000001 2 0.5049229992426155 1.0 3 0.07573844988639232 0.22499999999999998 4 0.07573844988639232 0.3 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.25 0.0 0.0 0.0 0.0 132-133 5.7375 0.0 0.0 0.0 0.0 134-135 6.300000000000001 0.0 0.0 0.0 0.0 136-137 6.8375 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 15-19 >>END_MODULE Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002048 spots for SRR7171066.sra Written 1002048 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra Read 1002035 spots for SRR7171066.sra Written 1002035 spots for SRR7171066.sra SRR ids: ['SRR7171066.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ctfm14lx SRR7171066.sra spots: 20040713 blocks: [[1, 1002035], [1002036, 2004070], [2004071, 3006105], [3006106, 4008140], [4008141, 5010175], [5010176, 6012210], [6012211, 7014245], [7014246, 8016280], [8016281, 9018315], [9018316, 10020350], [10020351, 11022385], [11022386, 12024420], [12024421, 13026455], [13026456, 14028490], [14028491, 15030525], [15030526, 16032560], [16032561, 17034595], [17034596, 18036630], [18036631, 19038665], [19038666, 20040713]] SRR7171066 file size 6769439 SRR7171066 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171066 SRR7171066_1.fastq SRR7171066_2.fastq Input file: SRR7171066_1.fastq Paired file: SRR7171066_2.fastq trimmed: SRR7171066-trimmed-pair1.fastq, SRR7171066-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:30:05 2025 >> started Thu Feb 13 23:30:28 2025 >> done (22.443s) 20040713 read pairs processed; of these: 16839 ( 0.08%) short read pairs filtered out after trimming by size control 23719 ( 0.12%) empty read pairs filtered out after trimming by size control 20000155 (99.80%) read pairs available; of these: 12048892 (60.24%) trimmed read pairs available after processing 7951263 (39.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 7 0.00% 21 8 0.00% 22 12 0.00% 23 8 0.00% 24 13 0.00% 25 6 0.00% 26 10 0.00% 27 9 0.00% 28 14 0.00% 29 12 0.00% 30 11 0.00% 31 15 0.00% 32 9 0.00% 33 22 0.00% 34 19 0.00% 35 19 0.00% 36 15 0.00% 37 19 0.00% 38 16 0.00% 39 27 0.00% 40 28 0.00% 41 38 0.00% 42 30 0.00% 43 41 0.00% 44 40 0.00% 45 39 0.00% 46 48 0.00% 47 46 0.00% 48 72 0.00% 49 94 0.00% 50 92 0.00% 51 83 0.00% 52 95 0.00% 53 122 0.00% 54 131 0.00% 55 116 0.00% 56 164 0.00% 57 183 0.00% 58 188 0.00% 59 207 0.00% 60 249 0.00% 61 309 0.00% 62 351 0.00% 63 316 0.00% 64 376 0.00% 65 440 0.00% 66 461 0.00% 67 575 0.00% 68 561 0.00% 69 667 0.00% 70 767 0.00% 71 906 0.00% 72 1023 0.01% 73 1215 0.01% 74 1298 0.01% 75 1630 0.01% 76 2160 0.01% 77 2205 0.01% 78 2048 0.01% 79 2252 0.01% 80 2413 0.01% 81 2848 0.01% 82 3269 0.02% 83 3832 0.02% 84 4805 0.02% 85 5702 0.03% 86 5953 0.03% 87 6519 0.03% 88 6993 0.03% 89 7662 0.04% 90 8221 0.04% 91 8797 0.04% 92 9607 0.05% 93 10846 0.05% 94 11526 0.06% 95 12502 0.06% 96 12955 0.06% 97 13853 0.07% 98 14789 0.07% 99 15439 0.08% 100 16779 0.08% 101 17871 0.09% 102 19220 0.10% 103 20941 0.10% 104 22036 0.11% 105 23705 0.12% 106 24914 0.12% 107 25876 0.13% 108 27377 0.14% 109 28261 0.14% 110 29895 0.15% 111 31587 0.16% 112 33185 0.17% 113 35526 0.18% 114 36900 0.18% 115 39071 0.20% 116 40814 0.20% 117 42254 0.21% 118 43673 0.22% 119 44958 0.22% 120 47170 0.24% 121 49240 0.25% 122 51112 0.26% 123 53930 0.27% 124 56583 0.28% 125 59189 0.30% 126 62674 0.31% 127 64444 0.32% 128 67452 0.34% 129 70301 0.35% 130 73213 0.37% 131 76680 0.38% 132 81329 0.41% 133 86428 0.43% 134 92205 0.46% 135 98441 0.49% 136 105674 0.53% 137 113836 0.57% 138 121874 0.61% 139 132080 0.66% 140 142806 0.71% 141 157003 0.79% 142 173962 0.87% 143 196094 0.98% 144 228779 1.14% 145 271328 1.36% 146 335115 1.68% 147 446492 2.23% 148 685972 3.43% 149 1347744 6.74% 150 5704416 28.52% 151 7951263 39.76% 20000155 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=269.38 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=20 prefix-density=0.59 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=42.90 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7171066 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:31:12 Started mapping on | Feb 13 23:31:12 Finished on | Feb 13 23:33:07 Mapping speed, Million of reads per hour | 626.09 Number of input reads | 20000155 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18933302 Uniquely mapped reads % | 94.67% Average mapped length | 292.50 Number of splices: Total | 18036815 Number of splices: Annotated (sjdb) | 17630696 Number of splices: GT/AG | 17694624 Number of splices: GC/AG | 275643 Number of splices: AT/AC | 11496 Number of splices: Non-canonical | 55052 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 506761 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 109960 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579302 579302 579302 N_multimapping 506761 506761 506761 N_noFeature 814695 18620372 935951 N_ambiguous 312679 1289 120165 UnstrandedReadsAssigned:17805928 PositiveStrandReadsAssigned:311641 NegativeStrandReadsAssigned:17877186 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171066 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171066-trimmed-pair1.fastq SRR7171066-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,000,155 reads, 17,860,892 reads pseudoaligned [quant] estimated average fragment length: 230.799 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7171066.ke.tsv 34699 SRR7171066.se.tsv 87100 total ==> SRR7171066.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.2 632 17.5374 Potri.005G024800.1.v4.1 1035 805.201 306 18.8574 Potri.004G059700.1.v4.1 961 731.22 19 1.28935 Potri.007G009000.2.v4.1 1416 1186.2 0 0 Potri.003G141000.2.v4.1 2943 2713.2 1151.34 21.0565 Potri.016G087400.1.v4.1 270 83.7525 1018 603.135 Potri.015G069301.1.v4.1 564 338.203 0 0 Potri.010G195200.1.v4.1 1773 1543.2 61 1.96142 Potri.012G127500.1.v4.1 977 747.201 273 18.1297 ==> SRR7171066.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 777 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 341 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7171066 completed mapping pipeline successfully