Starting /dee2/code/volunteer_pipeline.sh SRR7171067 current disk space = 3089302487040 free memory = 1496720036 SRR7171067 SRAfilesize 5f62ef8da304e6c61e0f8cda4307c1e1 SRR7171067.sra SRR7171067.sra file validated SRR7171067 is paired end SRR7171067 is conventional basespace SRR7171067 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171067_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.83975 32.0 25.0 33.0 18.0 33.0 2 27.0915 29.0 25.0 31.0 18.0 33.0 3 29.911 31.0 29.0 33.0 25.0 33.0 4 31.595 33.0 31.0 33.0 29.0 33.0 5 32.13725 33.0 33.0 33.0 31.0 34.0 6 36.3985 38.0 36.0 38.0 34.0 38.0 7 36.57725 38.0 37.0 38.0 34.0 38.0 8 37.2435 38.0 38.0 38.0 36.0 38.0 9 35.59475 38.0 38.0 38.0 29.0 38.0 10-14 37.31320000000001 38.0 38.0 38.0 36.2 38.0 15-19 37.4935 38.0 38.0 38.0 37.4 38.0 20-24 37.5567 38.0 38.0 38.0 37.8 38.0 25-29 37.57555 38.0 38.0 38.0 38.0 38.0 30-34 37.529849999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.50285 38.0 38.0 38.0 37.6 38.0 40-44 37.48055 38.0 38.0 38.0 37.2 38.0 45-49 37.356049999999996 38.0 38.0 38.0 36.8 38.0 50-54 35.77525 38.0 35.4 38.0 30.4 38.0 55-59 37.159800000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.2433 38.0 38.0 38.0 36.2 38.0 65-69 37.22755 38.0 38.0 38.0 36.4 38.0 70-74 37.1557 38.0 38.0 38.0 36.0 38.0 75-79 37.05310000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.33375 38.0 37.6 38.0 33.0 38.0 85-89 36.6633 38.0 38.0 38.0 34.6 38.0 90-94 36.6498 38.0 38.0 38.0 34.4 38.0 95-99 36.6883 38.0 38.0 38.0 34.8 38.0 100-104 36.61899999999999 38.0 38.0 38.0 34.2 38.0 105-109 36.63334999999999 38.0 38.0 38.0 34.6 38.0 110-114 36.069050000000004 38.0 37.0 38.0 33.0 38.0 115-119 35.92285 38.0 37.0 38.0 32.2 38.0 120-124 35.825050000000005 38.0 36.6 38.0 32.0 38.0 125-129 35.559999999999995 38.0 36.0 38.0 30.6 38.0 130-134 33.6209 38.0 32.2 38.0 22.8 38.0 135-139 34.635949999999994 38.0 34.2 38.0 27.8 38.0 140-144 34.04745 38.0 33.6 38.0 24.4 38.0 145-149 33.2396 38.0 33.0 38.0 19.6 38.0 150-151 27.412125000000003 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 4.0 19 7.0 20 1.0 21 5.0 22 6.0 23 5.0 24 6.0 25 7.0 26 8.0 27 16.0 28 23.0 29 33.0 30 44.0 31 47.0 32 87.0 33 114.0 34 213.0 35 383.0 36 1180.0 37 1804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.74967234600262 11.874180865006553 10.511140235910878 40.865006553079944 2 18.179544886221557 16.579144786196547 36.83420855213804 28.40710177544386 3 16.950000000000003 22.525000000000002 29.349999999999998 31.175000000000004 4 21.05 33.300000000000004 23.5 22.15 5 20.535267633816908 35.34267133566784 26.138069034517258 17.983991995998 6 17.525 35.825 26.700000000000003 19.950000000000003 7 12.8 23.175 44.725 19.3 8 15.825 24.625 32.925 26.625 9 15.950000000000001 24.474999999999998 32.775 26.8 10-14 19.125 30.0 27.55 23.325000000000003 15-19 19.384999999999998 29.28 27.775 23.56 20-24 19.245 28.99 28.285 23.48 25-29 19.42 28.765 27.894999999999996 23.919999999999998 30-34 19.145 28.87 28.18 23.805 35-39 19.425 28.84 28.17 23.565 40-44 19.615 29.18 27.615000000000002 23.59 45-49 19.585 29.015 27.83 23.57 50-54 19.25 28.845 27.91 23.995 55-59 19.585 28.67 27.875 23.87 60-64 19.72 28.73 27.99 23.56 65-69 19.445 29.465000000000003 27.455000000000002 23.635 70-74 19.435 28.955 27.85 23.76 75-79 20.405 28.305000000000003 27.825 23.465 80-84 19.645000000000003 28.744999999999997 27.91 23.7 85-89 19.66 28.294999999999998 28.144999999999996 23.9 90-94 19.775000000000002 28.57 27.715 23.94 95-99 20.07 28.485 27.73 23.715 100-104 20.22 28.410000000000004 27.560000000000002 23.810000000000002 105-109 20.49 28.355000000000004 27.33 23.825 110-114 20.655 28.375 27.18 23.79 115-119 21.035 28.365000000000002 27.01 23.59 120-124 20.78 28.165000000000003 27.189999999999998 23.865 125-129 20.49 28.405 27.42 23.685000000000002 130-134 20.97 28.675 25.86 24.495 135-139 20.995 28.055000000000003 26.735 24.215 140-144 21.060000000000002 28.095 26.31 24.535 145-149 21.029999999999998 27.76 26.555 24.654999999999998 150-151 21.03482836381859 26.797795038837386 26.898020546229017 25.26935605111501 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.5 22 2.5 23 2.0 24 1.5 25 5.0 26 9.0 27 9.5 28 13.5 29 20.0 30 31.5 31 47.5 32 51.5 33 53.0 34 66.0 35 85.0 36 103.0 37 116.0 38 147.0 39 178.5 40 202.0 41 230.0 42 231.5 43 250.0 44 260.5 45 243.5 46 233.0 47 222.5 48 213.5 49 190.5 50 159.5 51 125.0 52 101.0 53 91.0 54 72.0 55 59.0 56 50.0 57 34.5 58 23.0 59 17.5 60 14.0 61 8.5 62 7.0 63 5.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.025 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6811301715438951 1.35 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 3.0999999999999996 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.475 0.0 0.0 0.0 0.0 114-115 4.8875 0.0 0.0 0.0 0.0 116-117 5.35 0.0 0.0 0.0 0.0 118-119 5.875 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.05 0.0 0.0 0.0 0.0 124-125 7.4375 0.0 0.0 0.0 0.0 126-127 8.0375 0.0 0.0 0.0 0.0 128-129 8.875 0.0 0.0 0.0 0.0 130-131 9.55 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 11.075 0.0 0.0 0.0 0.0 136-137 11.8125 0.0 0.0 0.0 0.0 138-139 12.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACTTA 10 0.0065924996 146.70886 3 TTAGTTT 10 0.0065924996 146.70886 2 GACTTAA 10 0.0065924996 146.70886 4 >>END_MODULE SRR7171067 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171067_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2215 33.0 32.0 34.0 28.0 34.0 2 29.48075 33.0 27.0 34.0 18.0 34.0 3 31.78625 33.0 32.0 34.0 27.0 34.0 4 32.41425 33.0 33.0 34.0 32.0 34.0 5 32.7185 33.0 33.0 34.0 32.0 34.0 6 37.02375 38.0 38.0 38.0 36.0 38.0 7 37.212 38.0 38.0 38.0 37.0 38.0 8 37.21025 38.0 38.0 38.0 37.0 38.0 9 37.197 38.0 38.0 38.0 37.0 38.0 10-14 37.17235 38.0 38.0 38.0 37.0 38.0 15-19 37.19185 38.0 38.0 38.0 37.0 38.0 20-24 36.18425 38.0 37.6 38.0 30.6 38.0 25-29 36.903800000000004 38.0 37.8 38.0 35.2 38.0 30-34 37.212250000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.187650000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.07875 38.0 38.0 38.0 36.8 38.0 45-49 36.6946 38.0 38.0 38.0 35.2 38.0 50-54 36.993900000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.920399999999994 38.0 38.0 38.0 36.0 38.0 60-64 35.8418 38.0 36.8 38.0 30.0 38.0 65-69 36.84385 38.0 38.0 38.0 36.0 38.0 70-74 36.751250000000006 38.0 38.0 38.0 35.6 38.0 75-79 36.817 38.0 38.0 38.0 36.0 38.0 80-84 34.676649999999995 37.6 31.4 38.0 28.4 38.0 85-89 36.4191 38.0 37.8 38.0 34.4 38.0 90-94 36.61775 38.0 38.0 38.0 35.0 38.0 95-99 36.4603 38.0 38.0 38.0 34.4 38.0 100-104 36.23115 38.0 37.6 38.0 33.6 38.0 105-109 35.25565 38.0 36.6 38.0 28.4 38.0 110-114 34.601549999999996 38.0 35.2 38.0 24.8 38.0 115-119 35.5862 38.0 37.0 38.0 31.0 38.0 120-124 35.3995 38.0 36.4 38.0 30.6 38.0 125-129 34.95235 38.0 36.0 38.0 29.0 38.0 130-134 34.45725 38.0 35.6 38.0 27.0 38.0 135-139 33.9082 38.0 33.4 38.0 24.6 38.0 140-144 32.9195 38.0 33.0 38.0 17.0 38.0 145-149 31.44845 38.0 32.2 38.0 8.0 38.0 150-151 24.773249999999997 32.0 15.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 2.0 5 2.0 6 3.0 7 0.0 8 1.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 2.0 17 2.0 18 4.0 19 6.0 20 3.0 21 7.0 22 3.0 23 9.0 24 11.0 25 15.0 26 17.0 27 25.0 28 35.0 29 36.0 30 55.0 31 73.0 32 90.0 33 128.0 34 227.0 35 407.0 36 1040.0 37 1769.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.775 19.575 12.9 26.75 2 26.775 24.075 32.75 16.400000000000002 3 21.71628721541156 27.395546659994995 32.07405554165624 18.8141105829372 4 25.45 35.5 21.975 17.075000000000003 5 24.825 37.95 21.825 15.4 6 19.7 39.775 23.05 17.474999999999998 7 20.349999999999998 19.875 39.475 20.3 8 19.900000000000002 25.724999999999998 28.7 25.674999999999997 9 23.75 25.05 26.950000000000003 24.25 10-14 24.04 28.64 26.115 21.205 15-19 23.02 28.435 27.834999999999997 20.71 20-24 22.88 28.849999999999998 27.534999999999997 20.735 25-29 23.87 27.250000000000004 28.625 20.255000000000003 30-34 22.555 28.485 28.27 20.69 35-39 23.39 27.939999999999998 28.46 20.21 40-44 23.119999999999997 28.349999999999998 27.605 20.925 45-49 23.095 27.889999999999997 28.110000000000003 20.905 50-54 23.085 28.325 27.705000000000002 20.885 55-59 23.405 27.785 28.23 20.580000000000002 60-64 23.56 28.04 28.315 20.085 65-69 23.285 27.950000000000003 28.199999999999996 20.565 70-74 23.849999999999998 27.66 28.244999999999997 20.244999999999997 75-79 23.46 28.285 28.26 19.994999999999997 80-84 24.3 28.165000000000003 27.474999999999998 20.06 85-89 24.04 28.175 27.88 19.905 90-94 23.235 28.249999999999996 27.700000000000003 20.815 95-99 23.66 28.139999999999997 27.665 20.535 100-104 24.16 27.875 27.775 20.19 105-109 24.315 27.755000000000003 27.325 20.605 110-114 24.365000000000002 28.360000000000003 27.305 19.97 115-119 25.145 27.985 26.900000000000002 19.97 120-124 24.94 28.720000000000002 27.1 19.24 125-129 25.480000000000004 28.17 26.995 19.355 130-134 25.515 28.055000000000003 27.07 19.36 135-139 25.974999999999998 28.355000000000004 26.924999999999997 18.745 140-144 26.8 28.225 26.325 18.65 145-149 26.855 28.634999999999998 26.400000000000002 18.11 150-151 28.35129040340767 27.09847156101228 27.123527937860185 17.42671009771987 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 1.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 4.0 27 6.5 28 10.5 29 13.5 30 17.5 31 22.0 32 26.0 33 35.0 34 57.5 35 79.0 36 95.0 37 118.0 38 143.0 39 165.5 40 187.5 41 212.5 42 245.0 43 273.5 44 278.5 45 263.5 46 255.5 47 247.5 48 225.5 49 197.5 50 158.5 51 126.5 52 114.0 53 96.0 54 73.5 55 66.5 56 56.5 57 38.0 58 21.5 59 14.0 60 14.5 61 12.0 62 7.5 63 4.0 64 2.0 65 2.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.45294413688978363 0.8999999999999999 3 0.050327126321087066 0.15 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.075 0.0 0.025 0.0 0.0 80-81 0.15 0.0 0.025 0.0 0.0 82-83 0.21250000000000002 0.0 0.025 0.0 0.0 84-85 0.2875 0.0 0.025 0.0 0.0 86-87 0.3125 0.0 0.025 0.0 0.0 88-89 0.475 0.0 0.025 0.0 0.0 90-91 0.5375000000000001 0.0 0.025 0.0 0.0 92-93 0.7125 0.0 0.025 0.0 0.0 94-95 1.0375 0.0 0.025 0.0 0.0 96-97 1.1875 0.0 0.025 0.0 0.0 98-99 1.425 0.0 0.025 0.0 0.0 100-101 1.8250000000000002 0.0 0.025 0.0 0.0 102-103 2.125 0.0 0.025 0.0 0.0 104-105 2.575 0.0 0.025 0.0 0.0 106-107 3.0875 0.0 0.025 0.0 0.0 108-109 3.5625 0.0 0.025 0.0 0.0 110-111 3.95 0.0 0.025 0.0 0.0 112-113 4.525 0.0 0.025 0.0 0.0 114-115 4.9 0.0 0.025 0.0 0.0 116-117 5.362500000000001 0.0 0.025 0.0 0.0 118-119 5.9 0.0 0.025 0.0 0.0 120-121 6.6 0.0 0.025 0.0 0.0 122-123 7.15 0.0 0.025 0.0 0.0 124-125 7.575 0.0 0.025 0.0 0.0 126-127 8.225000000000001 0.0 0.025 0.0 0.0 128-129 9.2125 0.0 0.025 0.0 0.0 130-131 9.925 0.0 0.025 0.0 0.0 132-133 10.6125 0.0 0.025 0.0 0.0 134-135 11.425 0.0 0.025 0.0 0.0 136-137 12.125 0.0 0.025 0.0 0.0 138-139 12.8875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGCC 10 0.006832588 144.9875 4 GGGGGGG 20 0.0059376103 28.9975 130-134 >>END_MODULE Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991008 spots for SRR7171067.sra Written 991008 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra Read 991001 spots for SRR7171067.sra Written 991001 spots for SRR7171067.sra SRR ids: ['SRR7171067.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mguy_d6i SRR7171067.sra spots: 19820027 blocks: [[1, 991001], [991002, 1982002], [1982003, 2973003], [2973004, 3964004], [3964005, 4955005], [4955006, 5946006], [5946007, 6937007], [6937008, 7928008], [7928009, 8919009], [8919010, 9910010], [9910011, 10901011], [10901012, 11892012], [11892013, 12883013], [12883014, 13874014], [13874015, 14865015], [14865016, 15856016], [15856017, 16847017], [16847018, 17838018], [17838019, 18829019], [18829020, 19820027]] SRR7171067 file size 6694656 SRR7171067 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171067 SRR7171067_1.fastq SRR7171067_2.fastq Input file: SRR7171067_1.fastq Paired file: SRR7171067_2.fastq trimmed: SRR7171067-trimmed-pair1.fastq, SRR7171067-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:27:03 2025 >> started Thu Feb 13 23:27:26 2025 >> done (22.164s) 19820027 read pairs processed; of these: 15338 ( 0.08%) short read pairs filtered out after trimming by size control 45875 ( 0.23%) empty read pairs filtered out after trimming by size control 19758814 (99.69%) read pairs available; of these: 12071548 (61.09%) trimmed read pairs available after processing 7687266 (38.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 2 0.00% 20 13 0.00% 21 9 0.00% 22 10 0.00% 23 20 0.00% 24 19 0.00% 25 13 0.00% 26 19 0.00% 27 22 0.00% 28 16 0.00% 29 29 0.00% 30 21 0.00% 31 21 0.00% 32 39 0.00% 33 35 0.00% 34 24 0.00% 35 39 0.00% 36 42 0.00% 37 50 0.00% 38 59 0.00% 39 67 0.00% 40 83 0.00% 41 96 0.00% 42 108 0.00% 43 119 0.00% 44 93 0.00% 45 135 0.00% 46 169 0.00% 47 161 0.00% 48 216 0.00% 49 251 0.00% 50 301 0.00% 51 366 0.00% 52 351 0.00% 53 385 0.00% 54 418 0.00% 55 449 0.00% 56 494 0.00% 57 541 0.00% 58 657 0.00% 59 788 0.00% 60 919 0.00% 61 1007 0.01% 62 1190 0.01% 63 1285 0.01% 64 1410 0.01% 65 1453 0.01% 66 1558 0.01% 67 1744 0.01% 68 1993 0.01% 69 2235 0.01% 70 2598 0.01% 71 3031 0.02% 72 3502 0.02% 73 4013 0.02% 74 4302 0.02% 75 4834 0.02% 76 6316 0.03% 77 6303 0.03% 78 6268 0.03% 79 6692 0.03% 80 7495 0.04% 81 8257 0.04% 82 9489 0.05% 83 10707 0.05% 84 12670 0.06% 85 13837 0.07% 86 14578 0.07% 87 15750 0.08% 88 16971 0.09% 89 17606 0.09% 90 19052 0.10% 91 20280 0.10% 92 21646 0.11% 93 24261 0.12% 94 25859 0.13% 95 27664 0.14% 96 29003 0.15% 97 29656 0.15% 98 29952 0.15% 99 31316 0.16% 100 33156 0.17% 101 34174 0.17% 102 36295 0.18% 103 38084 0.19% 104 40550 0.21% 105 42184 0.21% 106 43981 0.22% 107 44545 0.23% 108 46248 0.23% 109 47402 0.24% 110 48309 0.24% 111 49229 0.25% 112 51679 0.26% 113 53601 0.27% 114 55664 0.28% 115 58015 0.29% 116 59571 0.30% 117 60585 0.31% 118 62076 0.31% 119 62924 0.32% 120 64131 0.32% 121 65455 0.33% 122 67438 0.34% 123 69478 0.35% 124 72628 0.37% 125 73267 0.37% 126 76886 0.39% 127 78525 0.40% 128 80338 0.41% 129 83604 0.42% 130 85252 0.43% 131 88100 0.45% 132 90403 0.46% 133 94856 0.48% 134 99137 0.50% 135 104396 0.53% 136 110105 0.56% 137 116868 0.59% 138 124847 0.63% 139 132929 0.67% 140 140627 0.71% 141 152946 0.77% 142 167356 0.85% 143 185018 0.94% 144 212574 1.08% 145 248719 1.26% 146 306605 1.55% 147 405671 2.05% 148 605302 3.06% 149 1191120 6.03% 150 5253231 26.59% 151 7687266 38.91% 19758814 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=14 prefix-density=0.57 prefix-fanout=2.7 sequence=ACGCTTGTAAGGA criterion=fanout-score sequence-density=0.27 sequence-density-rank=18 fanout-score=12.42 fanout-score-rank=1 prefix-density=1.28 prefix-fanout=2.7 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=21 prefix-density=0.72 prefix-fanout=2.3 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=61.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171067 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:28:09 Started mapping on | Feb 13 23:28:09 Finished on | Feb 13 23:30:50 Mapping speed, Million of reads per hour | 441.81 Number of input reads | 19758814 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18245696 Uniquely mapped reads % | 92.34% Average mapped length | 288.89 Number of splices: Total | 17780514 Number of splices: Annotated (sjdb) | 17348828 Number of splices: GT/AG | 17441378 Number of splices: GC/AG | 252589 Number of splices: AT/AC | 12712 Number of splices: Non-canonical | 73835 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 603168 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 81719 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 926686 926686 926686 N_multimapping 603168 603168 603168 N_noFeature 537875 17898589 650057 N_ambiguous 387063 1118 151861 UnstrandedReadsAssigned:17320758 PositiveStrandReadsAssigned:345989 NegativeStrandReadsAssigned:17443778 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171067 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171067-trimmed-pair1.fastq SRR7171067-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,758,814 reads, 17,358,926 reads pseudoaligned [quant] estimated average fragment length: 220.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7171067.ke.tsv 34699 SRR7171067.se.tsv 87100 total ==> SRR7171067.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.91 1368 32.8823 Potri.005G024800.1.v4.1 1035 815.913 575 30.4726 Potri.004G059700.1.v4.1 961 741.913 4 0.233127 Potri.007G009000.2.v4.1 1416 1196.91 0 0 Potri.003G141000.2.v4.1 2943 2723.91 1025.5 16.2791 Potri.016G087400.1.v4.1 270 91.5048 1980 935.636 Potri.015G069301.1.v4.1 564 347.79 0 0 Potri.010G195200.1.v4.1 1773 1553.91 492 13.6907 Potri.012G127500.1.v4.1 977 757.913 71 4.05065 ==> SRR7171067.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 181 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 345 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 334 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7171067 completed mapping pipeline successfully