Starting /dee2/code/volunteer_pipeline.sh SRR7171068 current disk space = 3089353019392 free memory = 1467021268 SRR7171068 SRAfilesize 3a00dca79981f8803c9a040b968b2e66 SRR7171068.sra SRR7171068.sra file validated SRR7171068 is paired end SRR7171068 is conventional basespace SRR7171068 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171068_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.906 18.0 18.0 18.0 18.0 28.0 2 24.6165 27.0 18.0 27.0 18.0 28.0 3 24.747 25.0 18.0 28.0 18.0 31.0 4 28.34575 29.0 27.0 31.0 25.0 33.0 5 30.2415 32.0 30.0 33.0 25.0 33.0 6 35.34525 37.0 35.0 38.0 31.0 38.0 7 36.82325 38.0 37.0 38.0 34.0 38.0 8 36.82475 38.0 37.0 38.0 34.0 38.0 9 37.19225 38.0 38.0 38.0 36.0 38.0 10-14 37.396550000000005 38.0 38.0 38.0 36.4 38.0 15-19 37.43985 38.0 38.0 38.0 37.0 38.0 20-24 37.505900000000004 38.0 38.0 38.0 37.2 38.0 25-29 37.45790000000001 38.0 38.0 38.0 37.4 38.0 30-34 37.5449 38.0 38.0 38.0 37.8 38.0 35-39 37.43215 38.0 38.0 38.0 37.2 38.0 40-44 37.460899999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.439350000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.8163 38.0 38.0 38.0 34.8 38.0 55-59 37.21795000000001 38.0 38.0 38.0 36.2 38.0 60-64 37.181650000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.144600000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.0382 38.0 38.0 38.0 35.8 38.0 75-79 36.9959 38.0 38.0 38.0 35.8 38.0 80-84 36.934450000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.71355 38.0 38.0 38.0 34.6 38.0 90-94 36.431 38.0 37.8 38.0 33.8 38.0 95-99 36.52805 38.0 38.0 38.0 34.0 38.0 100-104 36.48085 38.0 37.8 38.0 34.0 38.0 105-109 36.28315 38.0 37.0 38.0 34.0 38.0 110-114 36.12409999999999 38.0 37.0 38.0 33.0 38.0 115-119 35.6845 38.0 36.0 38.0 31.0 38.0 120-124 35.64525 38.0 36.2 38.0 31.0 38.0 125-129 35.42790000000001 38.0 36.0 38.0 30.0 38.0 130-134 32.6902 36.8 29.0 38.0 22.0 38.0 135-139 34.5515 38.0 34.4 38.0 27.0 38.0 140-144 34.0432 38.0 34.0 38.0 23.8 38.0 145-149 33.20295 38.0 33.0 38.0 20.0 38.0 150-151 29.019625 34.5 27.0 37.5 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 1.0 16 4.0 17 1.0 18 2.0 19 3.0 20 3.0 21 3.0 22 4.0 23 4.0 24 4.0 25 5.0 26 12.0 27 21.0 28 15.0 29 35.0 30 35.0 31 70.0 32 96.0 33 130.0 34 228.0 35 492.0 36 1425.0 37 1404.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.203423967774421 55.81570996978852 7.502517623363544 25.478348439073518 2 22.0 19.3 34.425 24.275 3 19.3 23.775 27.775 29.15 4 20.8 33.050000000000004 24.175 21.975 5 21.025 35.625 24.575 18.775 6 16.525000000000002 37.675 26.3 19.5 7 13.450000000000001 23.400000000000002 45.425 17.724999999999998 8 16.975 23.825 31.25 27.950000000000003 9 16.7 24.25 33.625 25.424999999999997 10-14 19.45 30.53 26.905 23.115 15-19 19.46 29.4 28.095 23.044999999999998 20-24 19.040000000000003 30.075000000000003 27.445000000000004 23.44 25-29 19.865 29.5 28.04 22.595000000000002 30-34 19.765 29.26 27.82 23.155 35-39 19.915 29.830000000000002 27.26 22.994999999999997 40-44 19.71 29.715000000000003 27.61 22.965 45-49 19.564999999999998 29.625 26.87 23.94 50-54 19.885 28.82 27.744999999999997 23.549999999999997 55-59 19.735 29.2 28.03 23.035 60-64 20.455000000000002 29.095 27.36 23.09 65-69 19.765 29.54 27.525 23.169999999999998 70-74 19.41 28.98 27.935 23.674999999999997 75-79 19.775000000000002 28.88 27.845 23.5 80-84 20.055 29.07 27.68 23.195 85-89 20.085 29.599999999999998 27.005000000000003 23.31 90-94 19.925 28.7 27.3 24.075 95-99 20.29 28.455000000000002 27.47 23.785 100-104 21.029999999999998 28.634999999999998 26.965 23.369999999999997 105-109 20.74 28.77 27.13 23.36 110-114 20.505000000000003 29.020000000000003 27.67 22.805 115-119 21.029999999999998 28.860000000000003 26.935 23.175 120-124 21.13 28.804999999999996 26.375 23.69 125-129 20.995 28.884999999999998 26.36 23.76 130-134 21.035 29.175 26.11 23.68 135-139 21.075 28.465 26.505000000000003 23.955000000000002 140-144 21.27 28.555000000000003 26.669999999999998 23.505000000000003 145-149 20.71 28.775000000000002 26.0 24.515 150-151 21.1875 27.6375 26.987499999999997 24.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 2.0 2 1.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 3.5 24 7.0 25 9.0 26 11.0 27 15.5 28 20.5 29 30.0 30 33.5 31 40.5 32 51.5 33 67.0 34 93.0 35 112.0 36 125.0 37 148.0 38 164.5 39 164.0 40 185.5 41 206.0 42 222.0 43 244.5 44 248.5 45 236.5 46 231.0 47 227.0 48 195.0 49 173.5 50 143.0 51 104.0 52 90.5 53 82.0 54 80.5 55 68.5 56 47.5 57 32.0 58 23.5 59 18.5 60 13.5 61 9.5 62 5.5 63 2.5 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6565656565656566 1.3 3 0.050505050505050504 0.15 4 0.050505050505050504 0.2 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.3875 0.0 0.0 0.0 0.0 108-109 3.9124999999999996 0.0 0.0 0.0 0.0 110-111 4.5875 0.0 0.0 0.0 0.0 112-113 5.1625 0.0 0.0 0.0 0.0 114-115 5.775 0.0 0.0 0.0 0.0 116-117 6.275 0.0 0.0 0.0 0.0 118-119 6.887499999999999 0.0 0.0 0.0 0.0 120-121 7.6375 0.0 0.0 0.0 0.0 122-123 8.2 0.0 0.0 0.0 0.0 124-125 8.6125 0.0 0.0 0.0 0.0 126-127 9.45 0.0 0.0 0.0 0.0 128-129 10.1375 0.0 0.0 0.0 0.0 130-131 10.7375 0.0 0.0 0.0 0.0 132-133 11.3 0.0 0.0 0.0 0.0 134-135 12.25 0.0 0.0 0.0 0.0 136-137 12.9625 0.0 0.0 0.0 0.0 138-139 13.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTATGC 10 0.006830828 145.0 145 >>END_MODULE SRR7171068 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171068_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.019 33.0 33.0 34.0 32.0 34.0 2 32.702 34.0 33.0 34.0 32.0 34.0 3 33.05325 34.0 33.0 34.0 32.0 34.0 4 33.00475 34.0 33.0 34.0 32.0 34.0 5 33.09325 34.0 33.0 34.0 33.0 34.0 6 37.23625 38.0 38.0 38.0 37.0 38.0 7 37.22 38.0 38.0 38.0 37.0 38.0 8 37.1745 38.0 38.0 38.0 37.0 38.0 9 37.17875 38.0 38.0 38.0 37.0 38.0 10-14 37.1811 38.0 38.0 38.0 37.0 38.0 15-19 37.168150000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.048500000000004 38.0 37.4 38.0 30.0 38.0 25-29 36.55765 38.0 38.0 38.0 34.6 38.0 30-34 37.03225 38.0 38.0 38.0 36.6 38.0 35-39 37.125150000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.12215 38.0 38.0 38.0 36.8 38.0 45-49 37.099250000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.08725 38.0 38.0 38.0 37.0 38.0 55-59 37.04965000000001 38.0 38.0 38.0 36.6 38.0 60-64 36.9934 38.0 38.0 38.0 36.2 38.0 65-69 36.927049999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.913399999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.5308 38.0 37.8 38.0 34.6 38.0 80-84 35.1389 38.0 35.2 38.0 28.8 38.0 85-89 36.635749999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.61445 38.0 38.0 38.0 35.2 38.0 95-99 36.449 38.0 38.0 38.0 34.2 38.0 100-104 36.3914 38.0 38.0 38.0 34.2 38.0 105-109 34.89925 38.0 35.2 38.0 28.4 38.0 110-114 35.8143 38.0 37.0 38.0 32.0 38.0 115-119 34.9423 38.0 35.6 38.0 27.2 38.0 120-124 35.3988 38.0 36.6 38.0 30.4 38.0 125-129 35.20765 38.0 36.0 38.0 29.4 38.0 130-134 35.028000000000006 38.0 36.0 38.0 28.2 38.0 135-139 34.6303 38.0 34.8 38.0 28.0 38.0 140-144 32.711 37.0 29.2 38.0 22.6 38.0 145-149 31.292849999999998 36.2 30.0 38.0 10.6 38.0 150-151 27.039375 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 1.0 5 0.0 6 2.0 7 1.0 8 2.0 9 2.0 10 1.0 11 0.0 12 2.0 13 1.0 14 4.0 15 5.0 16 4.0 17 5.0 18 6.0 19 0.0 20 6.0 21 3.0 22 6.0 23 6.0 24 12.0 25 11.0 26 12.0 27 18.0 28 27.0 29 41.0 30 54.0 31 55.0 32 87.0 33 123.0 34 201.0 35 350.0 36 1004.0 37 1934.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.025 19.825 12.475 26.674999999999997 2 26.200000000000003 24.725 32.35 16.725 3 21.325 26.875 32.425 19.375 4 25.5 34.449999999999996 22.475 17.575 5 23.275000000000002 37.55 21.45 17.724999999999998 6 19.55 38.574999999999996 23.35 18.525 7 18.925 19.675 41.275 20.125 8 21.125 25.650000000000002 26.424999999999997 26.8 9 21.05 25.025 29.025000000000002 24.9 10-14 23.345 29.035 26.279999999999998 21.34 15-19 23.05 27.91 28.025 21.015 20-24 23.355 27.49 28.455000000000002 20.7 25-29 22.99 28.65 27.85 20.51 30-34 22.634999999999998 28.105000000000004 28.255000000000003 21.005 35-39 23.595 28.075 27.49 20.84 40-44 23.685000000000002 28.035 28.04 20.24 45-49 23.400000000000002 28.189999999999998 28.310000000000002 20.1 50-54 23.315 27.639999999999997 28.294999999999998 20.75 55-59 23.035 27.675 28.43 20.86 60-64 23.0 26.905 29.07 21.025 65-69 23.445 27.855 28.050000000000004 20.65 70-74 23.56 27.284999999999997 28.325 20.830000000000002 75-79 23.455000000000002 27.825 27.875 20.845 80-84 23.535 27.525 28.52 20.419999999999998 85-89 23.97 27.875 27.905 20.25 90-94 23.665 27.805000000000003 28.49 20.04 95-99 23.24 28.17 28.275 20.315 100-104 24.23 27.825 27.79 20.155 105-109 24.07 27.99 28.16 19.78 110-114 23.880000000000003 28.555000000000003 27.715 19.85 115-119 25.39 28.875 26.55 19.185 120-124 24.845 28.02 27.474999999999998 19.66 125-129 24.490000000000002 27.99 27.805000000000003 19.715 130-134 26.165 27.405 27.125 19.305 135-139 25.540000000000003 27.060000000000002 27.55 19.85 140-144 25.590000000000003 26.875 28.27 19.265 145-149 26.47 27.200000000000003 27.21 19.12 150-151 26.8 26.8125 27.500000000000004 18.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.5 23 2.0 24 3.5 25 6.5 26 5.5 27 5.5 28 10.0 29 14.5 30 18.0 31 23.0 32 35.0 33 46.5 34 52.0 35 71.0 36 87.5 37 109.0 38 136.5 39 149.5 40 180.5 41 225.5 42 240.0 43 254.5 44 273.0 45 260.0 46 244.0 47 237.5 48 230.5 49 221.5 50 187.0 51 140.5 52 107.5 53 90.0 54 84.0 55 66.5 56 46.5 57 32.5 58 23.0 59 20.5 60 17.0 61 12.0 62 7.5 63 2.5 64 2.5 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98373983739837 97.39999999999999 2 0.7876016260162602 1.55 3 0.07621951219512195 0.22499999999999998 4 0.07621951219512195 0.3 5 0.025406504065040653 0.125 6 0.0 0.0 7 0.0 0.0 8 0.05081300813008131 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.5 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.5 0.0 0.0 0.0 0.0 112-113 5.0625 0.0 0.0 0.0 0.0 114-115 5.65 0.0 0.0 0.0 0.0 116-117 6.1375 0.0 0.0 0.0 0.0 118-119 6.7375 0.0 0.0 0.0 0.0 120-121 7.5375 0.0 0.0 0.0 0.0 122-123 8.2625 0.0 0.0 0.0 0.0 124-125 8.7875 0.0 0.0 0.0 0.0 126-127 9.775 0.0 0.0 0.0 0.0 128-129 10.4875 0.0 0.0 0.0 0.0 130-131 11.1625 0.0 0.0 0.0 0.0 132-133 11.7125 0.0 0.0 0.0 0.0 134-135 12.5375 0.0 0.0 0.0 0.0 136-137 13.225000000000001 0.0 0.0 0.0 0.0 138-139 13.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAGAG 10 0.006830828 145.0 5 >>END_MODULE Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611658 spots for SRR7171068.sra Written 611658 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra Read 611644 spots for SRR7171068.sra Written 611644 spots for SRR7171068.sra SRR ids: ['SRR7171068.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x_yaqnkg SRR7171068.sra spots: 12232894 blocks: [[1, 611644], [611645, 1223288], [1223289, 1834932], [1834933, 2446576], [2446577, 3058220], [3058221, 3669864], [3669865, 4281508], [4281509, 4893152], [4893153, 5504796], [5504797, 6116440], [6116441, 6728084], [6728085, 7339728], [7339729, 7951372], [7951373, 8563016], [8563017, 9174660], [9174661, 9786304], [9786305, 10397948], [10397949, 11009592], [11009593, 11621236], [11621237, 12232894]] SRR7171068 file size 4123626 SRR7171068 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171068 SRR7171068_1.fastq SRR7171068_2.fastq Input file: SRR7171068_1.fastq Paired file: SRR7171068_2.fastq trimmed: SRR7171068-trimmed-pair1.fastq, SRR7171068-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:02:03 2025 >> started Thu Feb 13 23:02:24 2025 >> done (20.709s) 12232894 read pairs processed; of these: 10780 ( 0.09%) short read pairs filtered out after trimming by size control 34060 ( 0.28%) empty read pairs filtered out after trimming by size control 12188054 (99.63%) read pairs available; of these: 7666611 (62.90%) trimmed read pairs available after processing 4521443 (37.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 9 0.00% 21 10 0.00% 22 6 0.00% 23 6 0.00% 24 10 0.00% 25 11 0.00% 26 16 0.00% 27 17 0.00% 28 12 0.00% 29 11 0.00% 30 20 0.00% 31 17 0.00% 32 32 0.00% 33 23 0.00% 34 33 0.00% 35 24 0.00% 36 31 0.00% 37 44 0.00% 38 54 0.00% 39 70 0.00% 40 84 0.00% 41 94 0.00% 42 91 0.00% 43 89 0.00% 44 107 0.00% 45 123 0.00% 46 148 0.00% 47 183 0.00% 48 171 0.00% 49 231 0.00% 50 298 0.00% 51 304 0.00% 52 378 0.00% 53 363 0.00% 54 396 0.00% 55 399 0.00% 56 438 0.00% 57 511 0.00% 58 590 0.00% 59 670 0.01% 60 819 0.01% 61 891 0.01% 62 1049 0.01% 63 1072 0.01% 64 1186 0.01% 65 1283 0.01% 66 1350 0.01% 67 1387 0.01% 68 1588 0.01% 69 1819 0.01% 70 2129 0.02% 71 2388 0.02% 72 2799 0.02% 73 3183 0.03% 74 3519 0.03% 75 4023 0.03% 76 5258 0.04% 77 5991 0.05% 78 4948 0.04% 79 5374 0.04% 80 5846 0.05% 81 6463 0.05% 82 7220 0.06% 83 8032 0.07% 84 9691 0.08% 85 10386 0.09% 86 10901 0.09% 87 11671 0.10% 88 12586 0.10% 89 12996 0.11% 90 13828 0.11% 91 15194 0.12% 92 16328 0.13% 93 17930 0.15% 94 19164 0.16% 95 20410 0.17% 96 20799 0.17% 97 21702 0.18% 98 22046 0.18% 99 22842 0.19% 100 24604 0.20% 101 24984 0.20% 102 27140 0.22% 103 28347 0.23% 104 29917 0.25% 105 31719 0.26% 106 32050 0.26% 107 32334 0.27% 108 33532 0.28% 109 34978 0.29% 110 35449 0.29% 111 36148 0.30% 112 37900 0.31% 113 39574 0.32% 114 40983 0.34% 115 42550 0.35% 116 43779 0.36% 117 43756 0.36% 118 44216 0.36% 119 44354 0.36% 120 45638 0.37% 121 46992 0.39% 122 47842 0.39% 123 50320 0.41% 124 51486 0.42% 125 52634 0.43% 126 54089 0.44% 127 55311 0.45% 128 56059 0.46% 129 56878 0.47% 130 57915 0.48% 131 59429 0.49% 132 60855 0.50% 133 64482 0.53% 134 67328 0.55% 135 71351 0.59% 136 74291 0.61% 137 78122 0.64% 138 81941 0.67% 139 86980 0.71% 140 92658 0.76% 141 100285 0.82% 142 110030 0.90% 143 122652 1.01% 144 142887 1.17% 145 168586 1.38% 146 207213 1.70% 147 275293 2.26% 148 411873 3.38% 149 782144 6.42% 150 2980506 24.45% 151 4521443 37.10% 12188054 reads passed initial QC criterion=sequence-density sequence-density=1.34 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=1.30 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=59.82 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.38 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=19 prefix-density=1.43 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=8.87 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.8 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171068 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:03:08 Started mapping on | Feb 13 23:03:08 Finished on | Feb 13 23:05:36 Mapping speed, Million of reads per hour | 296.47 Number of input reads | 12188054 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11360224 Uniquely mapped reads % | 93.21% Average mapped length | 286.91 Number of splices: Total | 10171855 Number of splices: Annotated (sjdb) | 9934119 Number of splices: GT/AG | 9980063 Number of splices: GC/AG | 142783 Number of splices: AT/AC | 7308 Number of splices: Non-canonical | 41701 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302008 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 29144 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 538148 538148 538148 N_multimapping 302008 302008 302008 N_noFeature 449238 11059695 540523 N_ambiguous 284368 734 74840 UnstrandedReadsAssigned:10626618 PositiveStrandReadsAssigned:299795 NegativeStrandReadsAssigned:10744861 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7171068 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171068-trimmed-pair1.fastq SRR7171068-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,188,054 reads, 10,658,240 reads pseudoaligned [quant] estimated average fragment length: 208.909 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7171068.ke.tsv 34699 SRR7171068.se.tsv 87100 total ==> SRR7171068.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.09 394 13.9178 Potri.005G024800.1.v4.1 1035 827.091 280 21.6461 Potri.004G059700.1.v4.1 961 753.097 14 1.18864 Potri.007G009000.2.v4.1 1416 1208.09 0 0 Potri.003G141000.2.v4.1 2943 2735.09 694.815 16.2432 Potri.016G087400.1.v4.1 270 96.1115 929 618.037 Potri.015G069301.1.v4.1 564 358.318 0 0 Potri.010G195200.1.v4.1 1773 1565.09 46 1.87928 Potri.012G127500.1.v4.1 977 769.091 101 8.39688 ==> SRR7171068.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 443 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR7171068 completed mapping pipeline successfully