Starting /dee2/code/volunteer_pipeline.sh SRR7171069 current disk space = 3089240489984 free memory = 1547433808 SRR7171069 SRAfilesize e0521751a2ee0e004b5ec15489a8800d SRR7171069.sra SRR7171069.sra file validated SRR7171069 is paired end SRR7171069 is conventional basespace SRR7171069 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171069_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.14 18.0 18.0 18.0 18.0 32.0 2 27.37875 27.0 27.0 29.0 25.0 31.0 3 27.55975 29.0 25.0 31.0 18.0 33.0 4 30.539 31.0 29.0 33.0 27.0 33.0 5 31.74325 33.0 32.0 33.0 30.0 33.0 6 32.82975 36.0 31.0 38.0 16.0 38.0 7 36.03075 38.0 36.0 38.0 31.0 38.0 8 36.723 38.0 37.0 38.0 34.0 38.0 9 37.20475 38.0 38.0 38.0 36.0 38.0 10-14 37.38685 38.0 38.0 38.0 36.8 38.0 15-19 37.42235000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.5217 38.0 38.0 38.0 37.2 38.0 25-29 37.51625 38.0 38.0 38.0 37.6 38.0 30-34 37.504000000000005 38.0 38.0 38.0 37.6 38.0 35-39 36.8917 38.0 38.0 38.0 34.4 38.0 40-44 37.41929999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.313100000000006 38.0 38.0 38.0 36.8 38.0 50-54 34.2302 36.2 29.2 38.0 28.4 38.0 55-59 36.11750000000001 37.8 35.6 38.0 32.4 38.0 60-64 37.14685 38.0 38.0 38.0 36.0 38.0 65-69 37.093 38.0 38.0 38.0 36.0 38.0 70-74 36.9601 38.0 38.0 38.0 35.4 38.0 75-79 36.84054999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.8258 38.0 38.0 38.0 34.8 38.0 85-89 36.66065 38.0 38.0 38.0 34.6 38.0 90-94 36.441599999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.5106 38.0 38.0 38.0 34.0 38.0 100-104 36.25965 38.0 37.2 38.0 33.6 38.0 105-109 36.26565000000001 38.0 37.0 38.0 34.0 38.0 110-114 35.838350000000005 38.0 37.0 38.0 32.0 38.0 115-119 35.626850000000005 38.0 36.4 38.0 30.8 38.0 120-124 35.529399999999995 38.0 36.0 38.0 31.0 38.0 125-129 35.311400000000006 38.0 36.0 38.0 29.8 38.0 130-134 28.8375 31.4 22.6 37.2 18.0 38.0 135-139 33.780049999999996 37.2 33.8 38.0 23.4 38.0 140-144 33.918899999999994 38.0 34.2 38.0 22.6 38.0 145-149 32.7913 38.0 33.0 38.0 16.6 38.0 150-151 28.652375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 3.0 18 3.0 19 7.0 20 4.0 21 6.0 22 2.0 23 5.0 24 6.0 25 11.0 26 16.0 27 14.0 28 32.0 29 40.0 30 65.0 31 53.0 32 102.0 33 163.0 34 265.0 35 670.0 36 1681.0 37 847.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.50463720676487 26.841243862520457 10.7746863066012 36.87943262411347 2 20.230057514378593 19.179794948737182 36.459114778694676 24.131032758189548 3 20.225 22.900000000000002 26.924999999999997 29.95 4 22.2 33.225 22.3 22.275 5 21.425 34.975 26.125 17.474999999999998 6 17.025000000000002 37.05 26.275 19.650000000000002 7 12.950000000000001 22.2 45.975 18.875 8 16.575 22.875 32.800000000000004 27.750000000000004 9 16.525000000000002 24.825 32.375 26.275 10-14 19.580000000000002 30.125 27.215 23.080000000000002 15-19 19.395 28.765 28.345 23.494999999999997 20-24 19.49 28.95 28.4 23.16 25-29 19.345000000000002 28.93 28.22 23.505000000000003 30-34 19.985 28.804999999999996 28.065 23.145 35-39 19.900000000000002 29.145 28.015 22.939999999999998 40-44 20.24 28.935 27.935 22.89 45-49 20.215 28.49 28.16 23.135 50-54 19.67 28.73 28.299999999999997 23.3 55-59 20.09 28.705000000000002 27.905 23.3 60-64 19.905 28.505000000000003 28.470000000000002 23.119999999999997 65-69 19.985 28.994999999999997 27.6 23.419999999999998 70-74 20.27 28.53 27.935 23.265 75-79 19.66 29.604999999999997 27.43 23.305 80-84 19.465 28.87 28.1 23.565 85-89 19.325 28.744999999999997 28.499999999999996 23.43 90-94 20.13 28.82 27.67 23.380000000000003 95-99 19.825 29.04 27.605 23.53 100-104 20.145 28.575 27.474999999999998 23.805 105-109 20.205000000000002 28.83 27.85 23.115 110-114 19.85 28.694999999999997 27.560000000000002 23.895 115-119 20.65 28.77 27.88 22.7 120-124 20.105 29.235 27.675 22.985 125-129 20.200000000000003 29.185 27.034999999999997 23.580000000000002 130-134 20.515 29.09 27.43 22.965 135-139 21.115000000000002 28.265 27.13 23.49 140-144 20.54 28.79 27.084999999999997 23.585 145-149 20.54 28.525 26.884999999999998 24.05 150-151 20.0875 28.762500000000003 26.5 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 3.0 23 4.5 24 4.5 25 5.0 26 10.0 27 14.5 28 16.5 29 25.5 30 36.0 31 40.5 32 46.0 33 59.0 34 71.5 35 78.5 36 105.0 37 127.5 38 146.5 39 182.5 40 202.0 41 227.5 42 252.5 43 254.5 44 252.0 45 266.5 46 256.0 47 225.0 48 206.5 49 181.0 50 145.0 51 117.0 52 100.5 53 82.5 54 64.0 55 48.5 56 45.0 57 31.0 58 15.5 59 14.5 60 10.5 61 6.5 62 5.0 63 3.5 64 3.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.35 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.525 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.9625 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 5.6 0.0 0.0 0.0 0.0 126-127 5.8 0.0 0.0 0.0 0.0 128-129 6.15 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.012499999999999 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTACAT 10 0.006846698 144.88751 5 >>END_MODULE SRR7171069 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171069_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00575 33.0 33.0 34.0 32.0 34.0 2 33.04575 34.0 33.0 34.0 32.0 34.0 3 32.9845 34.0 33.0 34.0 32.0 34.0 4 33.03075 34.0 33.0 34.0 32.0 34.0 5 33.136 34.0 33.0 34.0 33.0 34.0 6 37.1415 38.0 38.0 38.0 37.0 38.0 7 36.526 38.0 38.0 38.0 34.0 38.0 8 37.128 38.0 38.0 38.0 36.0 38.0 9 37.21075 38.0 38.0 38.0 37.0 38.0 10-14 37.300549999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.22615 38.0 38.0 38.0 36.8 38.0 20-24 37.08745 38.0 38.0 38.0 36.6 38.0 25-29 36.850699999999996 38.0 38.0 38.0 35.8 38.0 30-34 37.1742 38.0 38.0 38.0 37.0 38.0 35-39 37.1696 38.0 38.0 38.0 37.0 38.0 40-44 37.20215 38.0 38.0 38.0 36.8 38.0 45-49 35.992999999999995 38.0 36.4 38.0 30.4 38.0 50-54 37.1069 38.0 38.0 38.0 36.6 38.0 55-59 37.02825 38.0 38.0 38.0 36.2 38.0 60-64 36.98895 38.0 38.0 38.0 36.0 38.0 65-69 37.0285 38.0 38.0 38.0 36.0 38.0 70-74 36.92615000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.9097 38.0 38.0 38.0 36.0 38.0 80-84 36.7951 38.0 38.0 38.0 35.6 38.0 85-89 36.75404999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.524249999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.56510000000001 38.0 38.0 38.0 34.6 38.0 100-104 36.27945 38.0 38.0 38.0 34.0 38.0 105-109 36.00305 38.0 37.6 38.0 32.8 38.0 110-114 33.75359999999999 37.6 32.8 38.0 23.0 38.0 115-119 35.7084 38.0 36.8 38.0 31.2 38.0 120-124 35.56705 38.0 36.6 38.0 31.4 38.0 125-129 35.189400000000006 38.0 36.0 38.0 29.2 38.0 130-134 34.951 38.0 35.8 38.0 28.0 38.0 135-139 34.361599999999996 38.0 34.4 38.0 26.4 38.0 140-144 33.7709 38.0 33.0 38.0 22.6 38.0 145-149 32.68 38.0 33.0 38.0 14.4 38.0 150-151 27.31825 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 4.0 13 2.0 14 1.0 15 1.0 16 1.0 17 4.0 18 2.0 19 10.0 20 10.0 21 4.0 22 10.0 23 4.0 24 14.0 25 18.0 26 14.0 27 29.0 28 37.0 29 28.0 30 36.0 31 60.0 32 83.0 33 101.0 34 171.0 35 345.0 36 843.0 37 2158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 16.85 13.425 29.349999999999998 2 23.325000000000003 26.150000000000002 34.75 15.775 3 19.975 27.975 30.0 22.05 4 24.88744372186093 35.16758379189594 21.96098049024512 17.983991995998 5 23.825 36.875 22.825 16.475 6 19.025 38.425 24.525 18.025 7 18.95 18.825 42.95 19.275000000000002 8 20.525 23.625 29.275000000000002 26.575 9 22.6 24.15 29.349999999999998 23.9 10-14 23.305 28.615000000000002 26.55 21.529999999999998 15-19 23.095 27.815 28.215 20.875 20-24 22.93 28.27 28.215 20.585 25-29 22.97 28.395 28.345 20.29 30-34 22.215 28.315 28.82 20.65 35-39 23.11 28.310000000000002 28.660000000000004 19.919999999999998 40-44 22.53 28.084999999999997 28.970000000000002 20.415 45-49 22.66 28.794999999999998 28.03 20.515 50-54 22.725 28.01 28.854999999999997 20.41 55-59 22.52 27.915 28.4 21.165 60-64 23.075000000000003 27.779999999999998 28.935 20.21 65-69 22.49 27.750000000000004 28.694999999999997 21.065 70-74 22.884999999999998 27.839999999999996 28.610000000000003 20.665 75-79 23.28 27.71 28.415000000000003 20.595 80-84 22.955000000000002 28.715000000000003 28.305000000000003 20.025000000000002 85-89 23.155 28.299999999999997 28.000000000000004 20.544999999999998 90-94 22.865 27.839999999999996 28.92 20.375 95-99 23.405 28.349999999999998 28.22 20.025000000000002 100-104 23.56 27.91 28.544999999999998 19.985 105-109 23.880000000000003 28.560000000000002 27.52 20.04 110-114 23.43 27.955000000000002 28.26 20.355 115-119 24.104999999999997 28.89 27.395000000000003 19.61 120-124 24.125 28.735 27.515 19.625 125-129 24.55 27.665 27.779999999999998 20.005 130-134 24.745 27.939999999999998 27.834999999999997 19.48 135-139 25.31 27.250000000000004 28.02 19.42 140-144 25.22 28.09 27.62 19.07 145-149 25.180000000000003 28.43 27.08 19.31 150-151 25.3125 27.35 27.525 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 2.5 24 4.0 25 4.0 26 4.0 27 4.0 28 7.5 29 17.0 30 20.5 31 27.5 32 35.5 33 46.5 34 65.5 35 78.5 36 96.5 37 126.5 38 150.0 39 181.0 40 206.0 41 228.0 42 263.0 43 278.0 44 275.0 45 264.5 46 244.0 47 239.5 48 224.0 49 184.5 50 156.0 51 129.5 52 100.0 53 76.5 54 67.5 55 54.5 56 37.5 57 29.5 58 21.5 59 16.5 60 13.0 61 8.0 62 4.5 63 1.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52128999748048 98.75 2 0.327538422776518 0.65 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.02519526329050139 0.125 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 2.9125 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.9 0.0 0.0 0.0 0.0 126-127 6.375 0.0 0.0 0.0 0.0 128-129 6.887499999999999 0.0 0.0 0.0 0.0 130-131 7.525 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.45 0.0 0.0 0.0 0.0 138-139 10.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra Read 1005839 spots for SRR7171069.sra Written 1005839 spots for SRR7171069.sra SRR ids: ['SRR7171069.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xojxay5m SRR7171069.sra spots: 20116780 blocks: [[1, 1005839], [1005840, 2011678], [2011679, 3017517], [3017518, 4023356], [4023357, 5029195], [5029196, 6035034], [6035035, 7040873], [7040874, 8046712], [8046713, 9052551], [9052552, 10058390], [10058391, 11064229], [11064230, 12070068], [12070069, 13075907], [13075908, 14081746], [14081747, 15087585], [15087586, 16093424], [16093425, 17099263], [17099264, 18105102], [18105103, 19110941], [19110942, 20116780]] SRR7171069 file size 6795216 SRR7171069 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171069 SRR7171069_1.fastq SRR7171069_2.fastq Input file: SRR7171069_1.fastq Paired file: SRR7171069_2.fastq trimmed: SRR7171069-trimmed-pair1.fastq, SRR7171069-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:36:05 2025 >> started Thu Feb 13 23:36:39 2025 >> done (33.665s) 20116780 read pairs processed; of these: 12311 ( 0.06%) short read pairs filtered out after trimming by size control 23020 ( 0.11%) empty read pairs filtered out after trimming by size control 20081449 (99.82%) read pairs available; of these: 11521876 (57.38%) trimmed read pairs available after processing 8559573 (42.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 9 0.00% 21 5 0.00% 22 7 0.00% 23 6 0.00% 24 10 0.00% 25 12 0.00% 26 11 0.00% 27 18 0.00% 28 20 0.00% 29 14 0.00% 30 9 0.00% 31 11 0.00% 32 14 0.00% 33 14 0.00% 34 27 0.00% 35 19 0.00% 36 25 0.00% 37 29 0.00% 38 36 0.00% 39 28 0.00% 40 45 0.00% 41 39 0.00% 42 64 0.00% 43 71 0.00% 44 66 0.00% 45 69 0.00% 46 75 0.00% 47 83 0.00% 48 100 0.00% 49 116 0.00% 50 138 0.00% 51 159 0.00% 52 208 0.00% 53 203 0.00% 54 212 0.00% 55 273 0.00% 56 265 0.00% 57 309 0.00% 58 365 0.00% 59 383 0.00% 60 435 0.00% 61 513 0.00% 62 636 0.00% 63 674 0.00% 64 799 0.00% 65 833 0.00% 66 963 0.00% 67 974 0.00% 68 1180 0.01% 69 1268 0.01% 70 1500 0.01% 71 1694 0.01% 72 1986 0.01% 73 2235 0.01% 74 2525 0.01% 75 2988 0.01% 76 3247 0.02% 77 3765 0.02% 78 3856 0.02% 79 4141 0.02% 80 4668 0.02% 81 5388 0.03% 82 6034 0.03% 83 7061 0.04% 84 8138 0.04% 85 9272 0.05% 86 9976 0.05% 87 10734 0.05% 88 11797 0.06% 89 12637 0.06% 90 13313 0.07% 91 14863 0.07% 92 16002 0.08% 93 17521 0.09% 94 18947 0.09% 95 20465 0.10% 96 21355 0.11% 97 22745 0.11% 98 23688 0.12% 99 24877 0.12% 100 26642 0.13% 101 27688 0.14% 102 29898 0.15% 103 31698 0.16% 104 33430 0.17% 105 35340 0.18% 106 37022 0.18% 107 38214 0.19% 108 39703 0.20% 109 41746 0.21% 110 42962 0.21% 111 44634 0.22% 112 46572 0.23% 113 48704 0.24% 114 50687 0.25% 115 53087 0.26% 116 54990 0.27% 117 55862 0.28% 118 57741 0.29% 119 58880 0.29% 120 60310 0.30% 121 62448 0.31% 122 64218 0.32% 123 66410 0.33% 124 68783 0.34% 125 71288 0.35% 126 73596 0.37% 127 75236 0.37% 128 77583 0.39% 129 79340 0.40% 130 81988 0.41% 131 84343 0.42% 132 87365 0.44% 133 91768 0.46% 134 94909 0.47% 135 100651 0.50% 136 105037 0.52% 137 111007 0.55% 138 116983 0.58% 139 124739 0.62% 140 132575 0.66% 141 145274 0.72% 142 160325 0.80% 143 182009 0.91% 144 211203 1.05% 145 251457 1.25% 146 312996 1.56% 147 423525 2.11% 148 641858 3.20% 149 1225451 6.10% 150 4962428 24.71% 151 8559573 42.62% 20081449 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=19 prefix-density=0.32 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=31.98 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=17 prefix-density=0.45 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=33.33 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171069 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:37:23 Started mapping on | Feb 13 23:37:24 Finished on | Feb 13 23:39:38 Mapping speed, Million of reads per hour | 539.50 Number of input reads | 20081449 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19017812 Uniquely mapped reads % | 94.70% Average mapped length | 290.37 Number of splices: Total | 17974146 Number of splices: Annotated (sjdb) | 17499085 Number of splices: GT/AG | 17627995 Number of splices: GC/AG | 259425 Number of splices: AT/AC | 11144 Number of splices: Non-canonical | 75582 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 546455 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 46571 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.26% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531531 531531 531531 N_multimapping 546455 546455 546455 N_noFeature 864476 18691303 1000948 N_ambiguous 350436 1351 159734 UnstrandedReadsAssigned:17802900 PositiveStrandReadsAssigned:325158 NegativeStrandReadsAssigned:17857130 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171069 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171069-trimmed-pair1.fastq SRR7171069-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,081,449 reads, 17,745,112 reads pseudoaligned [quant] estimated average fragment length: 221.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7171069.ke.tsv 34699 SRR7171069.se.tsv 87100 total ==> SRR7171069.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.01 1066 30.7646 Potri.005G024800.1.v4.1 1035 814.008 320 20.3876 Potri.004G059700.1.v4.1 961 740.032 7 0.490559 Potri.007G009000.2.v4.1 1416 1195.01 0 0 Potri.003G141000.2.v4.1 2943 2722.01 1157.87 22.0604 Potri.016G087400.1.v4.1 270 89.6198 1580 914.318 Potri.015G069301.1.v4.1 564 346.575 0 0 Potri.010G195200.1.v4.1 1773 1552.01 366.933 12.2613 Potri.012G127500.1.v4.1 977 756.014 105 7.20284 ==> SRR7171069.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 680 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 399 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 25 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 19 SRR7171069 completed mapping pipeline successfully