Starting /dee2/code/volunteer_pipeline.sh SRR7171070 current disk space = 3089141972992 free memory = 1582581388 SRR7171070 SRAfilesize 8787c72f96e05bf3c6d99d384176a5be SRR7171070.sra SRR7171070.sra file validated SRR7171070 is paired end SRR7171070 is conventional basespace SRR7171070 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171070_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.469 18.0 18.0 18.0 18.0 30.0 2 27.99775 28.0 27.0 30.0 25.0 31.0 3 29.46925 31.0 29.0 33.0 25.0 33.0 4 31.4505 33.0 31.0 33.0 29.0 33.0 5 32.578 33.0 33.0 33.0 32.0 33.0 6 34.252 37.0 34.0 38.0 26.0 38.0 7 36.63025 38.0 37.0 38.0 34.0 38.0 8 37.155 38.0 38.0 38.0 36.0 38.0 9 37.49075 38.0 38.0 38.0 37.0 38.0 10-14 37.4871 38.0 38.0 38.0 37.4 38.0 15-19 37.53189999999999 38.0 38.0 38.0 37.8 38.0 20-24 37.539 38.0 38.0 38.0 37.4 38.0 25-29 37.49165 38.0 38.0 38.0 37.2 38.0 30-34 37.47355 38.0 38.0 38.0 37.2 38.0 35-39 36.928900000000006 38.0 38.0 38.0 34.8 38.0 40-44 37.3369 38.0 38.0 38.0 37.0 38.0 45-49 37.27705 38.0 38.0 38.0 36.8 38.0 50-54 34.592349999999996 37.2 32.6 38.0 28.4 38.0 55-59 36.21655 37.8 35.8 38.0 32.8 38.0 60-64 37.07315 38.0 38.0 38.0 36.0 38.0 65-69 37.02315 38.0 38.0 38.0 36.0 38.0 70-74 36.86185 38.0 38.0 38.0 35.0 38.0 75-79 36.78885 38.0 38.0 38.0 35.0 38.0 80-84 36.69405 38.0 38.0 38.0 34.6 38.0 85-89 36.4996 38.0 38.0 38.0 34.0 38.0 90-94 36.326449999999994 38.0 37.6 38.0 33.8 38.0 95-99 36.44555 38.0 37.4 38.0 34.0 38.0 100-104 36.192099999999996 38.0 37.0 38.0 33.6 38.0 105-109 36.17555 38.0 37.0 38.0 33.6 38.0 110-114 35.8474 38.0 36.6 38.0 32.2 38.0 115-119 35.509299999999996 38.0 36.0 38.0 30.2 38.0 120-124 35.511100000000006 38.0 36.0 38.0 30.6 38.0 125-129 35.16615 38.0 35.6 38.0 28.2 38.0 130-134 29.242800000000006 32.2 22.6 37.2 16.4 38.0 135-139 33.7764 37.2 33.6 38.0 24.2 38.0 140-144 33.933550000000004 38.0 34.0 38.0 23.4 38.0 145-149 32.70495 38.0 33.0 38.0 17.8 38.0 150-151 28.304125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 5.0 19 7.0 20 4.0 21 3.0 22 4.0 23 4.0 24 14.0 25 13.0 26 15.0 27 16.0 28 33.0 29 35.0 30 51.0 31 80.0 32 84.0 33 158.0 34 277.0 35 598.0 36 1601.0 37 991.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.65461847389558 13.065595716198125 16.92101740294511 36.358768406961175 2 19.875 18.125 36.4 25.6 3 18.05 23.05 29.599999999999998 29.299999999999997 4 22.3 29.975 24.5 23.225 5 21.425 34.35 25.15 19.075 6 17.7 36.0 26.674999999999997 19.625 7 14.825 21.875 43.45 19.85 8 17.0 24.224999999999998 31.674999999999997 27.1 9 17.175 22.275 34.275 26.275 10-14 19.939999999999998 29.205 27.3 23.555 15-19 20.4 28.79 27.0 23.810000000000002 20-24 19.805 28.985 27.305 23.905 25-29 20.085 28.444999999999997 27.32 24.15 30-34 19.925 28.310000000000002 28.075 23.69 35-39 20.05 27.91 28.055000000000003 23.985 40-44 20.13 28.54 27.250000000000004 24.08 45-49 19.865 28.485 27.365000000000002 24.285 50-54 20.395 28.015 28.17 23.419999999999998 55-59 20.4 28.685 27.18 23.735 60-64 20.275000000000002 27.96 27.689999999999998 24.075 65-69 19.384999999999998 28.77 27.834999999999997 24.01 70-74 19.885 28.025 27.74 24.349999999999998 75-79 19.950000000000003 28.42 27.750000000000004 23.880000000000003 80-84 20.185 28.235 27.915 23.665 85-89 20.415 28.71 27.155 23.72 90-94 20.04 28.470000000000002 27.36 24.13 95-99 20.46 28.15 27.675 23.715 100-104 20.705000000000002 28.77 27.215 23.31 105-109 20.09 28.57 27.37 23.97 110-114 20.755000000000003 28.349999999999998 27.77 23.125 115-119 21.075 28.18 27.310000000000002 23.435 120-124 20.48 27.900000000000002 26.715 24.905 125-129 20.965 28.59 26.834999999999997 23.61 130-134 21.105 28.315 27.08 23.5 135-139 21.154999999999998 27.555000000000003 27.150000000000002 24.14 140-144 21.125 27.76 26.314999999999998 24.8 145-149 20.665 28.43 26.47 24.435000000000002 150-151 20.95 28.012500000000003 26.700000000000003 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 0.5 24 0.0 25 2.0 26 4.0 27 9.0 28 14.0 29 15.5 30 23.0 31 32.5 32 43.0 33 55.5 34 69.0 35 82.0 36 100.0 37 123.5 38 139.0 39 150.0 40 162.5 41 189.5 42 224.0 43 240.5 44 255.5 45 259.0 46 240.0 47 235.0 48 223.5 49 198.0 50 176.0 51 144.0 52 115.0 53 110.0 54 97.5 55 67.5 56 55.0 57 41.0 58 30.0 59 25.5 60 16.5 61 11.5 62 6.5 63 3.0 64 2.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01215805471124 97.725 2 0.8358662613981762 1.6500000000000001 3 0.050658561296859174 0.15 4 0.07598784194528875 0.3 5 0.0 0.0 6 0.0 0.0 7 0.025329280648429587 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 1.0125000000000002 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.9 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.6625 0.0 0.0 0.0 0.0 116-117 4.1875 0.0 0.0 0.0 0.0 118-119 4.737500000000001 0.0 0.0 0.0 0.0 120-121 5.012499999999999 0.0 0.0 0.0 0.0 122-123 5.2875 0.0 0.0 0.0 0.0 124-125 5.55 0.0 0.0 0.0 0.0 126-127 5.8875 0.0 0.0 0.0 0.0 128-129 6.237500000000001 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 6.862500000000001 0.0 0.0 0.0 0.0 134-135 7.2625 0.0 0.0 0.0 0.0 136-137 8.037500000000001 0.0 0.0 0.0 0.0 138-139 8.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGAA 10 0.0068396386 144.9375 4 >>END_MODULE SRR7171070 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171070_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.071 33.0 33.0 34.0 32.0 34.0 2 33.10125 34.0 33.0 34.0 32.0 34.0 3 32.96575 34.0 33.0 34.0 32.0 34.0 4 32.98775 34.0 33.0 34.0 32.0 34.0 5 33.12625 34.0 33.0 34.0 33.0 34.0 6 37.21575 38.0 38.0 38.0 37.0 38.0 7 36.129 38.0 38.0 38.0 33.0 38.0 8 37.03525 38.0 38.0 38.0 36.0 38.0 9 37.20125 38.0 38.0 38.0 37.0 38.0 10-14 37.2736 38.0 38.0 38.0 37.2 38.0 15-19 37.205949999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.1049 38.0 38.0 38.0 36.8 38.0 25-29 36.82815 38.0 38.0 38.0 35.8 38.0 30-34 37.16009999999999 38.0 38.0 38.0 36.8 38.0 35-39 37.1799 38.0 38.0 38.0 37.0 38.0 40-44 37.1445 38.0 38.0 38.0 37.0 38.0 45-49 35.84055 38.0 36.0 38.0 30.4 38.0 50-54 37.067099999999996 38.0 38.0 38.0 37.0 38.0 55-59 36.97145 38.0 38.0 38.0 36.2 38.0 60-64 36.95825000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.99745 38.0 38.0 38.0 36.2 38.0 70-74 36.872249999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.88869999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.74745 38.0 38.0 38.0 35.8 38.0 85-89 36.68845 38.0 38.0 38.0 35.6 38.0 90-94 36.598200000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.51415 38.0 38.0 38.0 35.0 38.0 100-104 36.320550000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.11685 38.0 37.8 38.0 33.6 38.0 110-114 34.07035 38.0 33.8 38.0 23.2 38.0 115-119 35.83755000000001 38.0 37.0 38.0 32.8 38.0 120-124 35.7291 38.0 36.8 38.0 32.2 38.0 125-129 35.46169999999999 38.0 36.4 38.0 31.4 38.0 130-134 35.22235 38.0 36.0 38.0 31.0 38.0 135-139 34.6347 38.0 35.4 38.0 28.4 38.0 140-144 33.98945 38.0 33.4 38.0 24.4 38.0 145-149 33.13615 38.0 33.0 38.0 18.4 38.0 150-151 28.076875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 1.0 5 2.0 6 0.0 7 2.0 8 1.0 9 2.0 10 1.0 11 3.0 12 2.0 13 1.0 14 5.0 15 5.0 16 4.0 17 2.0 18 6.0 19 4.0 20 7.0 21 5.0 22 7.0 23 6.0 24 8.0 25 10.0 26 15.0 27 17.0 28 26.0 29 25.0 30 44.0 31 59.0 32 68.0 33 91.0 34 156.0 35 284.0 36 775.0 37 2345.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.125 20.474999999999998 11.799999999999999 25.6 2 26.25 25.85 30.15 17.75 3 20.925 28.375 31.125000000000004 19.575 4 25.387693846923458 35.5927963981991 20.860430215107552 18.159079539769884 5 24.95 38.05 20.225 16.775000000000002 6 19.325 38.95 23.375 18.35 7 20.45 20.1 39.375 20.075000000000003 8 19.975 25.1 28.349999999999998 26.575 9 21.825 24.325 31.075000000000003 22.775000000000002 10-14 23.705000000000002 28.835 25.935000000000002 21.525 15-19 22.54 28.854999999999997 27.12 21.485000000000003 20-24 23.565 28.410000000000004 27.12 20.905 25-29 23.66 28.16 27.810000000000002 20.369999999999997 30-34 22.705000000000002 28.044999999999998 28.055000000000003 21.195 35-39 23.175 27.72 28.175 20.93 40-44 23.315 28.225 27.47 20.990000000000002 45-49 23.01 27.625 27.894999999999996 21.47 50-54 22.7 28.310000000000002 27.860000000000003 21.13 55-59 23.115 27.555000000000003 27.839999999999996 21.490000000000002 60-64 23.3 27.544999999999998 27.810000000000002 21.345 65-69 23.82 26.815 28.125 21.240000000000002 70-74 23.485 27.975 27.284999999999997 21.255 75-79 23.49 27.905 27.005000000000003 21.6 80-84 24.15 27.845 26.97 21.035 85-89 23.98 28.075 27.21 20.735 90-94 24.415 27.415 27.55 20.62 95-99 24.154999999999998 28.595 26.96 20.29 100-104 23.974999999999998 27.889999999999997 27.139999999999997 20.995 105-109 23.87 27.655 27.725 20.75 110-114 24.665 28.194999999999997 26.955000000000002 20.185 115-119 24.654999999999998 28.84 26.605 19.900000000000002 120-124 24.72 28.16 26.729999999999997 20.39 125-129 24.945 28.205000000000002 26.955000000000002 19.895 130-134 25.25 27.42 27.229999999999997 20.1 135-139 25.145 27.77 26.979999999999997 20.105 140-144 25.635 28.23 26.875 19.259999999999998 145-149 26.279999999999998 27.73 26.775 19.215 150-151 27.037499999999998 27.325 25.887500000000003 19.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 1.5 26 3.0 27 6.5 28 9.0 29 14.0 30 18.0 31 24.5 32 32.0 33 34.5 34 45.0 35 64.0 36 79.0 37 93.5 38 122.0 39 156.5 40 187.0 41 202.5 42 238.0 43 276.5 44 274.5 45 259.5 46 243.5 47 232.0 48 221.0 49 203.0 50 175.0 51 146.0 52 116.5 53 98.5 54 95.0 55 85.5 56 70.5 57 53.5 58 37.0 59 24.0 60 15.5 61 11.5 62 11.0 63 7.5 64 3.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48756729043835 96.05 2 1.179184824403999 2.3 3 0.12817226352217378 0.375 4 0.07690335811330429 0.3 5 0.05126890540886952 0.25 6 0.02563445270443476 0.15 7 0.02563445270443476 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 16 0.4 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (97% over 34bp) ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.9875 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.5375 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 4.925 0.0 0.0 0.0 0.0 122-123 5.4125 0.0 0.0 0.0 0.0 124-125 5.975 0.0 0.0 0.0 0.0 126-127 6.7 0.0 0.0 0.0 0.0 128-129 7.300000000000001 0.0 0.0 0.0 0.0 130-131 7.762499999999999 0.0 0.0 0.0 0.0 132-133 8.225 0.0 0.0 0.0 0.0 134-135 8.6875 0.0 0.0 0.0 0.0 136-137 9.475 0.0 0.0 0.0 0.0 138-139 10.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAAT 10 0.006830828 145.0 1 >>END_MODULE Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804294 spots for SRR7171070.sra Written 804294 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra Read 804292 spots for SRR7171070.sra Written 804292 spots for SRR7171070.sra SRR ids: ['SRR7171070.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c40dxmlz SRR7171070.sra spots: 16085842 blocks: [[1, 804292], [804293, 1608584], [1608585, 2412876], [2412877, 3217168], [3217169, 4021460], [4021461, 4825752], [4825753, 5630044], [5630045, 6434336], [6434337, 7238628], [7238629, 8042920], [8042921, 8847212], [8847213, 9651504], [9651505, 10455796], [10455797, 11260088], [11260089, 12064380], [12064381, 12868672], [12868673, 13672964], [13672965, 14477256], [14477257, 15281548], [15281549, 16085842]] SRR7171070 file size 5429263 SRR7171070 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171070 SRR7171070_1.fastq SRR7171070_2.fastq Input file: SRR7171070_1.fastq Paired file: SRR7171070_2.fastq trimmed: SRR7171070-trimmed-pair1.fastq, SRR7171070-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:17:24 2025 >> started Fri Feb 14 00:17:41 2025 >> done (17.605s) 16085842 read pairs processed; of these: 15585 ( 0.10%) short read pairs filtered out after trimming by size control 30760 ( 0.19%) empty read pairs filtered out after trimming by size control 16039497 (99.71%) read pairs available; of these: 9021262 (56.24%) trimmed read pairs available after processing 7018235 (43.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 6 0.00% 21 6 0.00% 22 10 0.00% 23 14 0.00% 24 13 0.00% 25 12 0.00% 26 12 0.00% 27 14 0.00% 28 14 0.00% 29 18 0.00% 30 14 0.00% 31 11 0.00% 32 21 0.00% 33 11 0.00% 34 10 0.00% 35 26 0.00% 36 14 0.00% 37 15 0.00% 38 26 0.00% 39 31 0.00% 40 37 0.00% 41 42 0.00% 42 42 0.00% 43 50 0.00% 44 68 0.00% 45 72 0.00% 46 72 0.00% 47 74 0.00% 48 90 0.00% 49 111 0.00% 50 123 0.00% 51 132 0.00% 52 161 0.00% 53 190 0.00% 54 158 0.00% 55 210 0.00% 56 213 0.00% 57 274 0.00% 58 302 0.00% 59 335 0.00% 60 389 0.00% 61 447 0.00% 62 488 0.00% 63 595 0.00% 64 607 0.00% 65 754 0.00% 66 732 0.00% 67 888 0.01% 68 939 0.01% 69 1103 0.01% 70 1273 0.01% 71 1434 0.01% 72 1672 0.01% 73 1913 0.01% 74 2152 0.01% 75 2415 0.02% 76 2768 0.02% 77 3203 0.02% 78 3125 0.02% 79 3580 0.02% 80 3813 0.02% 81 4496 0.03% 82 5117 0.03% 83 5772 0.04% 84 7260 0.05% 85 7967 0.05% 86 8927 0.06% 87 9359 0.06% 88 10250 0.06% 89 10373 0.06% 90 11360 0.07% 91 12389 0.08% 92 13143 0.08% 93 14785 0.09% 94 15757 0.10% 95 17213 0.11% 96 17394 0.11% 97 18604 0.12% 98 19378 0.12% 99 20105 0.13% 100 21798 0.14% 101 22319 0.14% 102 23680 0.15% 103 25197 0.16% 104 26693 0.17% 105 28295 0.18% 106 29209 0.18% 107 30077 0.19% 108 31384 0.20% 109 32883 0.21% 110 33303 0.21% 111 34267 0.21% 112 36646 0.23% 113 38254 0.24% 114 39292 0.24% 115 41011 0.26% 116 42539 0.27% 117 43379 0.27% 118 44327 0.28% 119 45157 0.28% 120 47056 0.29% 121 47683 0.30% 122 48710 0.30% 123 51589 0.32% 124 53175 0.33% 125 54160 0.34% 126 55843 0.35% 127 56940 0.35% 128 58590 0.37% 129 60301 0.38% 130 61686 0.38% 131 63291 0.39% 132 65668 0.41% 133 68941 0.43% 134 72297 0.45% 135 76199 0.48% 136 78866 0.49% 137 83359 0.52% 138 87449 0.55% 139 94445 0.59% 140 100010 0.62% 141 108665 0.68% 142 119866 0.75% 143 135665 0.85% 144 158617 0.99% 145 187725 1.17% 146 235282 1.47% 147 319065 1.99% 148 488825 3.05% 149 950504 5.93% 150 3994077 24.90% 151 7018235 43.76% 16039497 reads passed initial QC criterion=sequence-density sequence-density=1.14 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=1.13 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=16.23 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=8 prefix-density=0.88 prefix-fanout=2.4 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=31.40 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7171070 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:18:29 Started mapping on | Feb 14 00:18:29 Finished on | Feb 14 00:20:41 Mapping speed, Million of reads per hour | 437.44 Number of input reads | 16039497 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14837403 Uniquely mapped reads % | 92.51% Average mapped length | 290.79 Number of splices: Total | 14745236 Number of splices: Annotated (sjdb) | 14398641 Number of splices: GT/AG | 14472869 Number of splices: GC/AG | 212952 Number of splices: AT/AC | 10351 Number of splices: Non-canonical | 49064 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372749 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 36937 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.87% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 844451 844451 844451 N_multimapping 372749 372749 372749 N_noFeature 526374 14483602 635883 N_ambiguous 363896 1000 119057 UnstrandedReadsAssigned:13947133 PositiveStrandReadsAssigned:352801 NegativeStrandReadsAssigned:14082463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171070 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171070-trimmed-pair1.fastq SRR7171070-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,039,497 reads, 13,996,022 reads pseudoaligned [quant] estimated average fragment length: 222.561 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7171070.ke.tsv 34699 SRR7171070.se.tsv 87100 total ==> SRR7171070.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.44 598 15.0695 Potri.005G024800.1.v4.1 1035 813.439 228 12.6888 Potri.004G059700.1.v4.1 961 739.453 21 1.28564 Potri.007G009000.2.v4.1 1416 1194.44 0 0 Potri.003G141000.2.v4.1 2943 2721.44 478 7.95132 Potri.016G087400.1.v4.1 270 88.0486 1087.14 558.949 Potri.015G069301.1.v4.1 564 345.293 0 0 Potri.010G195200.1.v4.1 1773 1551.44 38 1.10881 Potri.012G127500.1.v4.1 977 755.448 154 9.22838 ==> SRR7171070.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 447 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 535 Potri.001G212900.v4.1 43 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7171070 completed mapping pipeline successfully