Starting /dee2/code/volunteer_pipeline.sh SRR7171071 current disk space = 3089317523456 free memory = 1437350460 SRR7171071 SRAfilesize 0dd4d75084397994893266ac7bfa544b SRR7171071.sra SRR7171071.sra file validated SRR7171071 is paired end SRR7171071 is conventional basespace SRR7171071 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171071_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.31375 18.0 18.0 25.0 18.0 32.0 2 26.62275 27.0 25.0 29.0 18.0 31.0 3 27.56875 29.0 25.0 31.0 18.0 33.0 4 30.4125 31.0 29.0 33.0 27.0 33.0 5 31.1725 33.0 31.0 33.0 29.0 33.0 6 36.24475 38.0 36.0 38.0 33.0 38.0 7 37.042 38.0 38.0 38.0 35.0 38.0 8 36.998 38.0 38.0 38.0 35.0 38.0 9 36.60375 38.0 38.0 38.0 34.0 38.0 10-14 37.3557 38.0 38.0 38.0 36.8 38.0 15-19 37.46835 38.0 38.0 38.0 37.0 38.0 20-24 37.4778 38.0 38.0 38.0 37.0 38.0 25-29 37.385349999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.43325 38.0 38.0 38.0 37.0 38.0 35-39 36.514700000000005 38.0 37.2 38.0 31.8 38.0 40-44 36.80845 38.0 37.8 38.0 34.4 38.0 45-49 37.0659 38.0 37.8 38.0 36.2 38.0 50-54 37.167500000000004 38.0 38.0 38.0 36.0 38.0 55-59 35.7293 38.0 35.4 38.0 30.0 38.0 60-64 37.00535 38.0 38.0 38.0 36.0 38.0 65-69 37.00940000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.80795 38.0 38.0 38.0 35.0 38.0 75-79 36.7937 38.0 38.0 38.0 35.2 38.0 80-84 36.8006 38.0 38.0 38.0 35.0 38.0 85-89 36.452149999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.160000000000004 38.0 37.4 38.0 33.4 38.0 95-99 36.36105 38.0 38.0 38.0 34.0 38.0 100-104 36.4396 38.0 38.0 38.0 34.0 38.0 105-109 36.238749999999996 38.0 37.6 38.0 33.6 38.0 110-114 35.7543 38.0 37.0 38.0 31.0 38.0 115-119 35.66465 38.0 36.8 38.0 31.4 38.0 120-124 35.69539999999999 38.0 37.0 38.0 31.4 38.0 125-129 35.50525 38.0 36.2 38.0 31.0 38.0 130-134 32.6199 37.2 30.0 38.0 18.8 38.0 135-139 34.47795 38.0 34.8 38.0 26.6 38.0 140-144 34.31655 38.0 34.6 38.0 25.4 38.0 145-149 33.63615 38.0 33.4 38.0 22.8 38.0 150-151 29.365625 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 2.0 13 1.0 14 3.0 15 0.0 16 2.0 17 5.0 18 2.0 19 5.0 20 4.0 21 8.0 22 6.0 23 6.0 24 6.0 25 12.0 26 16.0 27 11.0 28 25.0 29 35.0 30 43.0 31 64.0 32 82.0 33 144.0 34 234.0 35 432.0 36 1265.0 37 1580.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.37467018469657 17.361477572559366 9.419525065963061 30.844327176781 2 22.230557639409852 17.37934483620905 35.3088272068017 25.081270317579396 3 18.975 24.725 28.125 28.175 4 22.55 31.3 22.95 23.200000000000003 5 21.25 35.775 24.474999999999998 18.5 6 16.875 35.975 27.500000000000004 19.650000000000002 7 13.950000000000001 22.5 45.225 18.325 8 17.299999999999997 23.175 32.025 27.500000000000004 9 17.275 23.875 33.900000000000006 24.95 10-14 20.265 30.145 26.790000000000003 22.8 15-19 20.225 28.22 28.26 23.294999999999998 20-24 20.115 29.049999999999997 27.884999999999998 22.95 25-29 19.7 28.494999999999997 28.28 23.525 30-34 19.689999999999998 28.405 28.625 23.28 35-39 20.3 28.910000000000004 27.62 23.169999999999998 40-44 20.205000000000002 28.720000000000002 28.325 22.75 45-49 20.474999999999998 28.449999999999996 27.655 23.419999999999998 50-54 19.775000000000002 28.525 28.355000000000004 23.345 55-59 20.275000000000002 28.29 28.275 23.16 60-64 19.830000000000002 28.175 28.395 23.599999999999998 65-69 20.424999999999997 28.935 27.46 23.18 70-74 20.02 28.860000000000003 27.139999999999997 23.98 75-79 20.9 28.725 27.47 22.905 80-84 20.515 28.935 27.22 23.330000000000002 85-89 20.54 28.449999999999996 27.810000000000002 23.200000000000003 90-94 20.369999999999997 28.28 27.855 23.494999999999997 95-99 20.34 28.585 28.075 23.0 100-104 20.4 28.9 27.560000000000002 23.14 105-109 20.369999999999997 28.28 28.044999999999998 23.305 110-114 21.404999999999998 28.505000000000003 27.134999999999998 22.955000000000002 115-119 20.625 28.389999999999997 27.544999999999998 23.44 120-124 20.745 28.22 27.839999999999996 23.195 125-129 20.955 28.67 26.845000000000002 23.53 130-134 20.73 29.304999999999996 26.31 23.655 135-139 21.19 28.58 27.589999999999996 22.64 140-144 20.645 27.935 26.76 24.66 145-149 20.755000000000003 29.09 26.555 23.599999999999998 150-151 20.849999999999998 28.1 26.887499999999996 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 1.5 4 2.5 5 2.0 6 1.0 7 0.5 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.5 21 1.5 22 1.0 23 2.0 24 3.0 25 6.0 26 7.0 27 10.5 28 15.5 29 22.5 30 29.5 31 26.0 32 37.5 33 55.5 34 66.0 35 83.0 36 97.0 37 117.5 38 149.5 39 172.0 40 192.0 41 216.0 42 225.0 43 231.5 44 241.5 45 250.0 46 237.5 47 225.5 48 215.5 49 186.0 50 173.5 51 156.0 52 122.0 53 101.5 54 83.0 55 54.0 56 39.0 57 37.5 58 30.5 59 22.0 60 15.0 61 8.0 62 4.5 63 3.5 64 3.0 65 1.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.25 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.925 0.0 0.0 0.0 0.0 120-121 4.35 0.0 0.0 0.0 0.0 122-123 4.6625 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.825 0.0 0.0 0.0 0.0 128-129 6.275 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.275 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 50 0.0013336722 17.392498 140-144 >>END_MODULE SRR7171071 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171071_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79275 33.0 33.0 34.0 32.0 34.0 2 32.8555 34.0 33.0 34.0 32.0 34.0 3 32.834 34.0 33.0 34.0 32.0 34.0 4 32.75175 34.0 33.0 34.0 32.0 34.0 5 32.768 34.0 33.0 34.0 32.0 34.0 6 36.855 38.0 38.0 38.0 36.0 38.0 7 36.6765 38.0 38.0 38.0 35.0 38.0 8 36.753 38.0 38.0 38.0 36.0 38.0 9 36.739 38.0 38.0 38.0 36.0 38.0 10-14 36.83945000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.87095 38.0 38.0 38.0 36.0 38.0 20-24 36.04735000000001 38.0 37.4 38.0 30.2 38.0 25-29 36.400999999999996 38.0 38.0 38.0 34.0 38.0 30-34 36.5806 38.0 38.0 38.0 35.2 38.0 35-39 36.60305 38.0 38.0 38.0 35.2 38.0 40-44 35.7551 38.0 36.0 38.0 31.6 38.0 45-49 36.20445 38.0 37.4 38.0 33.2 38.0 50-54 36.661500000000004 38.0 38.0 38.0 35.6 38.0 55-59 36.62395 38.0 38.0 38.0 35.2 38.0 60-64 36.4884 38.0 38.0 38.0 34.4 38.0 65-69 36.45720000000001 38.0 38.0 38.0 34.4 38.0 70-74 36.430749999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.3767 38.0 38.0 38.0 34.2 38.0 80-84 36.311099999999996 38.0 38.0 38.0 33.8 38.0 85-89 36.2707 38.0 38.0 38.0 34.0 38.0 90-94 36.13335 38.0 38.0 38.0 34.0 38.0 95-99 36.05915 38.0 37.8 38.0 33.8 38.0 100-104 35.83005 38.0 37.2 38.0 33.0 38.0 105-109 35.44064999999999 38.0 36.8 38.0 30.6 38.0 110-114 35.134 38.0 36.2 38.0 28.4 38.0 115-119 35.4103 38.0 36.8 38.0 31.0 38.0 120-124 34.94365 38.0 35.8 38.0 27.2 38.0 125-129 34.32715 38.0 34.8 38.0 24.6 38.0 130-134 34.1427 38.0 34.0 38.0 24.0 38.0 135-139 33.71055 38.0 33.2 38.0 22.2 38.0 140-144 32.933949999999996 38.0 33.0 38.0 17.0 38.0 145-149 31.731300000000005 38.0 32.6 38.0 8.4 38.0 150-151 25.826124999999998 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 4.0 5 3.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 0.0 12 2.0 13 4.0 14 6.0 15 3.0 16 7.0 17 3.0 18 6.0 19 1.0 20 7.0 21 10.0 22 14.0 23 8.0 24 23.0 25 22.0 26 22.0 27 21.0 28 39.0 29 37.0 30 65.0 31 81.0 32 115.0 33 128.0 34 198.0 35 347.0 36 763.0 37 2035.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.425 19.8 12.25 22.525000000000002 2 25.775 24.925 32.175 17.125 3 20.525 27.150000000000002 31.900000000000002 20.424999999999997 4 23.925 35.3 22.575 18.2 5 23.9 37.724999999999994 21.65 16.725 6 19.15 40.075 22.925 17.849999999999998 7 19.275000000000002 19.125 40.725 20.875 8 20.525 23.974999999999998 28.1 27.400000000000002 9 22.25 24.55 29.875 23.325000000000003 10-14 23.445 29.054999999999996 26.450000000000003 21.05 15-19 22.525000000000002 28.599999999999998 28.189999999999998 20.685000000000002 20-24 23.235 28.98 27.200000000000003 20.585 25-29 23.28 27.655 28.24 20.825 30-34 22.85 27.685 28.765 20.7 35-39 22.86 28.02 28.310000000000002 20.810000000000002 40-44 23.185 28.244999999999997 28.23 20.34 45-49 23.32 27.655 28.444999999999997 20.580000000000002 50-54 22.955000000000002 28.084999999999997 28.52 20.44 55-59 23.005 28.305000000000003 27.894999999999996 20.794999999999998 60-64 22.875 28.139999999999997 27.845 21.14 65-69 23.14 27.66 27.965 21.235 70-74 23.09 27.735 28.565 20.61 75-79 22.81 28.249999999999996 27.775 21.165 80-84 22.875 28.345 27.665 21.115000000000002 85-89 23.419999999999998 28.325 27.07 21.185000000000002 90-94 23.7 27.01 28.315 20.974999999999998 95-99 23.06 27.894999999999996 28.09 20.955 100-104 23.330000000000002 27.96 28.04 20.669999999999998 105-109 23.549999999999997 27.49 28.51 20.45 110-114 23.595 28.205000000000002 27.705000000000002 20.495 115-119 24.39 27.834999999999997 27.52 20.255000000000003 120-124 24.235 28.355000000000004 26.810000000000002 20.599999999999998 125-129 24.15 28.48 27.355 20.015 130-134 24.735 27.435 27.439999999999998 20.39 135-139 24.68 27.944999999999997 27.6 19.775000000000002 140-144 24.845 27.485 27.625 20.044999999999998 145-149 24.995 28.060000000000002 26.985 19.96 150-151 24.712500000000002 28.325 27.3125 19.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.5 22 1.5 23 1.5 24 2.0 25 3.5 26 7.0 27 7.5 28 8.5 29 11.0 30 14.5 31 19.0 32 27.0 33 39.0 34 46.0 35 66.0 36 97.0 37 120.0 38 150.5 39 179.0 40 194.5 41 227.5 42 246.0 43 243.5 44 253.5 45 265.5 46 267.0 47 263.5 48 234.5 49 193.0 50 172.5 51 145.5 52 113.0 53 85.5 54 68.5 55 59.0 56 44.0 57 33.0 58 25.5 59 19.0 60 13.5 61 7.5 62 7.5 63 5.0 64 2.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4281037522034752 0.8500000000000001 3 0.15109544195416771 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.11249999999999999 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 5.075 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.387499999999999 0.0 0.0 0.0 0.0 130-131 6.9125 0.0 0.0 0.0 0.0 132-133 7.5125 0.0 0.0 0.0 0.0 134-135 8.1125 0.0 0.0 0.0 0.0 136-137 8.725 0.0 0.0 0.0 0.0 138-139 9.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGATCG 40 0.0076550315 18.125 140-144 GATCGGA 55 0.0025160722 15.818182 140-144 >>END_MODULE Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra Read 913959 spots for SRR7171071.sra Written 913959 spots for SRR7171071.sra SRR ids: ['SRR7171071.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w_jgoi6x SRR7171071.sra spots: 18279180 blocks: [[1, 913959], [913960, 1827918], [1827919, 2741877], [2741878, 3655836], [3655837, 4569795], [4569796, 5483754], [5483755, 6397713], [6397714, 7311672], [7311673, 8225631], [8225632, 9139590], [9139591, 10053549], [10053550, 10967508], [10967509, 11881467], [11881468, 12795426], [12795427, 13709385], [13709386, 14623344], [14623345, 15537303], [15537304, 16451262], [16451263, 17365221], [17365222, 18279180]] SRR7171071 file size 6172513 SRR7171071 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171071 SRR7171071_1.fastq SRR7171071_2.fastq Input file: SRR7171071_1.fastq Paired file: SRR7171071_2.fastq trimmed: SRR7171071-trimmed-pair1.fastq, SRR7171071-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:19:47 2025 >> started Thu Feb 13 23:20:07 2025 >> done (20.388s) 18279180 read pairs processed; of these: 26713 ( 0.15%) short read pairs filtered out after trimming by size control 31469 ( 0.17%) empty read pairs filtered out after trimming by size control 18220998 (99.68%) read pairs available; of these: 10357029 (56.84%) trimmed read pairs available after processing 7863969 (43.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 9 0.00% 21 13 0.00% 22 18 0.00% 23 27 0.00% 24 25 0.00% 25 32 0.00% 26 23 0.00% 27 36 0.00% 28 26 0.00% 29 21 0.00% 30 22 0.00% 31 17 0.00% 32 17 0.00% 33 18 0.00% 34 21 0.00% 35 31 0.00% 36 22 0.00% 37 30 0.00% 38 41 0.00% 39 40 0.00% 40 51 0.00% 41 44 0.00% 42 60 0.00% 43 59 0.00% 44 64 0.00% 45 72 0.00% 46 91 0.00% 47 95 0.00% 48 104 0.00% 49 116 0.00% 50 120 0.00% 51 162 0.00% 52 174 0.00% 53 194 0.00% 54 193 0.00% 55 223 0.00% 56 255 0.00% 57 274 0.00% 58 304 0.00% 59 342 0.00% 60 396 0.00% 61 469 0.00% 62 515 0.00% 63 524 0.00% 64 648 0.00% 65 673 0.00% 66 733 0.00% 67 836 0.00% 68 912 0.01% 69 1051 0.01% 70 1175 0.01% 71 1417 0.01% 72 1567 0.01% 73 1712 0.01% 74 1888 0.01% 75 2338 0.01% 76 2945 0.02% 77 3151 0.02% 78 3057 0.02% 79 3323 0.02% 80 3630 0.02% 81 4137 0.02% 82 4812 0.03% 83 5427 0.03% 84 7254 0.04% 85 8380 0.05% 86 9492 0.05% 87 10334 0.06% 88 11463 0.06% 89 11739 0.06% 90 11919 0.07% 91 12789 0.07% 92 13356 0.07% 93 14190 0.08% 94 15118 0.08% 95 16157 0.09% 96 16906 0.09% 97 17468 0.10% 98 18664 0.10% 99 19618 0.11% 100 20733 0.11% 101 21963 0.12% 102 23535 0.13% 103 24975 0.14% 104 26590 0.15% 105 28177 0.15% 106 29639 0.16% 107 30814 0.17% 108 31745 0.17% 109 33514 0.18% 110 34411 0.19% 111 36268 0.20% 112 37766 0.21% 113 39838 0.22% 114 42012 0.23% 115 43775 0.24% 116 45144 0.25% 117 46212 0.25% 118 47089 0.26% 119 48193 0.26% 120 49859 0.27% 121 51820 0.28% 122 53029 0.29% 123 55444 0.30% 124 57509 0.32% 125 58555 0.32% 126 61503 0.34% 127 63349 0.35% 128 65110 0.36% 129 67590 0.37% 130 69436 0.38% 131 71653 0.39% 132 75992 0.42% 133 79562 0.44% 134 83654 0.46% 135 88759 0.49% 136 92881 0.51% 137 99411 0.55% 138 105654 0.58% 139 114151 0.63% 140 122650 0.67% 141 135273 0.74% 142 149312 0.82% 143 169966 0.93% 144 199994 1.10% 145 239023 1.31% 146 296279 1.63% 147 403491 2.21% 148 590333 3.24% 149 1104771 6.06% 150 4522946 24.82% 151 7863969 43.16% 18220998 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=15 prefix-density=0.51 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=51.14 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=10 prefix-density=0.79 prefix-fanout=1.6 sequence=ATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=27.71 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7171071 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:20:51 Started mapping on | Feb 13 23:20:51 Finished on | Feb 13 23:23:02 Mapping speed, Million of reads per hour | 500.73 Number of input reads | 18220998 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16993988 Uniquely mapped reads % | 93.27% Average mapped length | 291.18 Number of splices: Total | 15936950 Number of splices: Annotated (sjdb) | 15585749 Number of splices: GT/AG | 15638987 Number of splices: GC/AG | 237340 Number of splices: AT/AC | 9896 Number of splices: Non-canonical | 50727 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492303 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 44153 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 769059 769059 769059 N_multimapping 492303 492303 492303 N_noFeature 637371 16696106 753853 N_ambiguous 292546 1355 110400 UnstrandedReadsAssigned:16064071 PositiveStrandReadsAssigned:296527 NegativeStrandReadsAssigned:16129735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171071 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171071-trimmed-pair1.fastq SRR7171071-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,220,998 reads, 16,100,981 reads pseudoaligned [quant] estimated average fragment length: 227.627 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7171071.ke.tsv 34699 SRR7171071.se.tsv 87100 total ==> SRR7171071.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.37 803 25.2361 Potri.005G024800.1.v4.1 1035 808.373 255 17.7591 Potri.004G059700.1.v4.1 961 734.384 9 0.689941 Potri.007G009000.2.v4.1 1416 1189.37 0 0 Potri.003G141000.2.v4.1 2943 2716.37 854.378 17.7073 Potri.016G087400.1.v4.1 270 86.494 1071.72 697.568 Potri.015G069301.1.v4.1 564 341.094 0 0 Potri.010G195200.1.v4.1 1773 1546.37 81 2.94892 Potri.012G127500.1.v4.1 977 750.373 165 12.3794 ==> SRR7171071.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 820 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 314 Potri.001G212900.v4.1 64 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7171071 completed mapping pipeline successfully