Starting /dee2/code/volunteer_pipeline.sh SRR7171072 current disk space = 3089295261696 free memory = 1460047324 SRR7171072 SRAfilesize d62353c4295d7375e775557bc1e50cd7 SRR7171072.sra SRR7171072.sra file validated SRR7171072 is paired end SRR7171072 is conventional basespace SRR7171072 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171072_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.164 18.0 18.0 25.0 18.0 32.0 2 26.22825 27.0 25.0 29.0 18.0 31.0 3 27.35325 28.0 25.0 31.0 18.0 33.0 4 30.1305 31.0 29.0 33.0 27.0 33.0 5 31.0135 33.0 31.0 33.0 29.0 33.0 6 36.13175 37.0 36.0 38.0 33.0 38.0 7 37.00125 38.0 37.0 38.0 35.0 38.0 8 36.90925 38.0 38.0 38.0 35.0 38.0 9 36.606 38.0 38.0 38.0 34.0 38.0 10-14 37.31405 38.0 38.0 38.0 36.6 38.0 15-19 37.4431 38.0 38.0 38.0 37.0 38.0 20-24 37.474250000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.4197 38.0 38.0 38.0 37.0 38.0 30-34 37.46045 38.0 38.0 38.0 37.0 38.0 35-39 36.43300000000001 38.0 37.2 38.0 31.8 38.0 40-44 36.85245 38.0 37.8 38.0 34.6 38.0 45-49 37.107350000000004 38.0 37.8 38.0 35.8 38.0 50-54 37.213350000000005 38.0 38.0 38.0 36.6 38.0 55-59 35.8125 38.0 35.6 38.0 30.2 38.0 60-64 37.0551 38.0 38.0 38.0 35.8 38.0 65-69 37.01305000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.8378 38.0 38.0 38.0 35.2 38.0 75-79 36.82234999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.77955 38.0 38.0 38.0 35.0 38.0 85-89 36.4342 38.0 38.0 38.0 34.0 38.0 90-94 36.21294999999999 38.0 37.2 38.0 33.6 38.0 95-99 36.336200000000005 38.0 37.4 38.0 33.8 38.0 100-104 36.367650000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.1843 38.0 37.0 38.0 33.8 38.0 110-114 35.8307 38.0 37.0 38.0 31.4 38.0 115-119 35.6242 38.0 36.4 38.0 31.4 38.0 120-124 35.59345 38.0 36.2 38.0 31.0 38.0 125-129 35.4357 38.0 36.0 38.0 30.2 38.0 130-134 32.6029 37.2 30.2 38.0 18.8 38.0 135-139 34.34335 37.8 34.8 38.0 25.0 38.0 140-144 34.1003 38.0 34.0 38.0 23.6 38.0 145-149 33.2404 38.0 33.4 38.0 19.2 38.0 150-151 28.81575 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 3.0 16 2.0 17 3.0 18 3.0 19 2.0 20 2.0 21 3.0 22 4.0 23 5.0 24 6.0 25 10.0 26 9.0 27 16.0 28 24.0 29 38.0 30 45.0 31 76.0 32 98.0 33 173.0 34 246.0 35 486.0 36 1355.0 37 1383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.88243064729194 18.071334214002643 9.801849405548218 35.2443857331572 2 20.390292719539655 20.84063047285464 35.7518138603953 23.01726294721041 3 20.4 25.825 27.500000000000004 26.275 4 21.025 33.225 23.3 22.45 5 22.475 35.449999999999996 24.325 17.75 6 18.625 35.475 26.400000000000002 19.5 7 13.950000000000001 23.225 44.35 18.475 8 18.175 22.325 31.25 28.249999999999996 9 16.975 24.375 33.375 25.275 10-14 19.415 29.549999999999997 26.985 24.05 15-19 19.835 28.689999999999998 28.07 23.405 20-24 19.43 28.915000000000003 28.349999999999998 23.305 25-29 19.485 28.315 28.7 23.5 30-34 19.139999999999997 29.38 27.685 23.794999999999998 35-39 19.835 29.12 27.875 23.169999999999998 40-44 20.330000000000002 28.585 27.775 23.31 45-49 20.810000000000002 28.48 27.705000000000002 23.005 50-54 19.625 28.860000000000003 28.12 23.395 55-59 20.13 29.365000000000002 27.605 22.900000000000002 60-64 20.055 28.925 27.744999999999997 23.275000000000002 65-69 20.415 28.804999999999996 27.884999999999998 22.895 70-74 20.105 28.945 27.715 23.235 75-79 20.195 29.15 27.644999999999996 23.01 80-84 20.285 29.195 27.685 22.835 85-89 20.035 28.660000000000004 27.860000000000003 23.445 90-94 20.43 29.154999999999998 27.18 23.235 95-99 19.965 28.88 27.985 23.169999999999998 100-104 20.25 29.060000000000002 27.55 23.14 105-109 20.59 28.915000000000003 27.555000000000003 22.939999999999998 110-114 20.415 28.875 27.755000000000003 22.955000000000002 115-119 20.395 28.625 28.215 22.765 120-124 21.085 28.285 27.79 22.84 125-129 20.495 29.29 26.875 23.34 130-134 20.635 29.255 26.66 23.45 135-139 21.335 28.605000000000004 26.674999999999997 23.385 140-144 21.285 28.89 26.555 23.27 145-149 20.615 29.025000000000002 26.43 23.93 150-151 20.325 29.462500000000002 26.987499999999997 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.0 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 1.0 21 3.0 22 4.0 23 4.0 24 4.5 25 4.5 26 7.5 27 12.0 28 19.0 29 21.5 30 22.5 31 29.0 32 46.5 33 60.0 34 71.0 35 92.5 36 104.0 37 118.0 38 126.0 39 150.0 40 191.0 41 218.5 42 258.0 43 271.5 44 257.0 45 260.0 46 255.0 47 229.5 48 197.0 49 185.5 50 172.5 51 132.0 52 110.5 53 84.0 54 55.5 55 48.0 56 41.0 57 35.0 58 25.5 59 20.5 60 13.0 61 6.0 62 6.0 63 5.5 64 3.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.375 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.7125000000000004 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.612500000000001 0.0 0.0 0.0 0.0 118-119 5.225 0.0 0.0 0.0 0.0 120-121 5.7 0.0 0.0 0.0 0.0 122-123 6.1 0.0 0.0 0.0 0.0 124-125 6.6625 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.5 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 10.100000000000001 0.0 0.0 0.0 0.0 136-137 10.8 0.0 0.0 0.0 0.0 138-139 11.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCCTT 10 0.0060887975 150.61038 1 ATAATAT 10 0.006836113 144.9625 3 GGCCTTC 10 0.006836113 144.9625 2 >>END_MODULE SRR7171072 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171072_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81625 33.0 33.0 34.0 32.0 34.0 2 32.86975 34.0 33.0 34.0 32.0 34.0 3 32.8425 34.0 33.0 34.0 32.0 34.0 4 32.83275 34.0 33.0 34.0 32.0 34.0 5 32.7725 34.0 33.0 34.0 32.0 34.0 6 36.81125 38.0 38.0 38.0 36.0 38.0 7 36.7135 38.0 38.0 38.0 36.0 38.0 8 36.78375 38.0 38.0 38.0 36.0 38.0 9 36.8585 38.0 38.0 38.0 36.0 38.0 10-14 36.9099 38.0 38.0 38.0 36.0 38.0 15-19 36.92195 38.0 38.0 38.0 36.0 38.0 20-24 36.07195 38.0 37.4 38.0 30.6 38.0 25-29 36.449250000000006 38.0 38.0 38.0 34.6 38.0 30-34 36.620349999999995 38.0 38.0 38.0 35.6 38.0 35-39 36.6493 38.0 38.0 38.0 35.4 38.0 40-44 35.790499999999994 38.0 36.0 38.0 31.8 38.0 45-49 36.3133 38.0 37.4 38.0 33.6 38.0 50-54 36.70700000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.680550000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.5437 38.0 38.0 38.0 35.0 38.0 65-69 36.48915 38.0 38.0 38.0 34.8 38.0 70-74 36.470000000000006 38.0 38.0 38.0 34.4 38.0 75-79 36.444100000000006 38.0 38.0 38.0 34.4 38.0 80-84 36.29430000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.2145 38.0 38.0 38.0 33.8 38.0 90-94 36.1904 38.0 38.0 38.0 34.0 38.0 95-99 36.01035 38.0 37.8 38.0 33.6 38.0 100-104 35.88445 38.0 37.4 38.0 32.8 38.0 105-109 35.38995 38.0 36.6 38.0 30.2 38.0 110-114 35.146699999999996 38.0 36.2 38.0 28.6 38.0 115-119 35.2885 38.0 36.2 38.0 30.2 38.0 120-124 34.856849999999994 38.0 35.8 38.0 27.4 38.0 125-129 34.28965 38.0 34.6 38.0 24.2 38.0 130-134 34.1755 38.0 34.2 38.0 24.2 38.0 135-139 33.695949999999996 38.0 33.4 38.0 22.0 38.0 140-144 32.70555 38.0 33.0 38.0 15.6 38.0 145-149 31.486349999999998 38.0 32.0 38.0 8.4 38.0 150-151 25.914749999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 5.0 4 3.0 5 2.0 6 2.0 7 1.0 8 1.0 9 3.0 10 2.0 11 1.0 12 2.0 13 3.0 14 1.0 15 9.0 16 2.0 17 4.0 18 2.0 19 8.0 20 6.0 21 6.0 22 8.0 23 12.0 24 14.0 25 12.0 26 15.0 27 24.0 28 47.0 29 53.0 30 58.0 31 77.0 32 113.0 33 140.0 34 211.0 35 338.0 36 788.0 37 2007.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.975 20.075000000000003 12.575 26.375 2 25.15 26.700000000000003 33.1 15.049999999999999 3 21.6 27.425 31.525 19.45 4 24.625 35.3 21.85 18.224999999999998 5 23.95 37.6 22.025 16.425 6 18.9 39.050000000000004 24.625 17.424999999999997 7 18.5 18.775 40.6 22.125 8 19.650000000000002 25.45 28.675 26.224999999999998 9 22.425 25.05 29.2 23.325000000000003 10-14 22.98 29.505 26.334999999999997 21.18 15-19 23.055 28.74 27.925 20.28 20-24 22.685 28.54 27.925 20.849999999999998 25-29 22.85 28.910000000000004 27.950000000000003 20.29 30-34 22.73 28.084999999999997 28.310000000000002 20.875 35-39 22.525000000000002 27.58 29.115000000000002 20.78 40-44 22.685 28.335 28.560000000000002 20.419999999999998 45-49 22.62 28.060000000000002 28.970000000000002 20.349999999999998 50-54 22.88 28.405 28.035 20.68 55-59 22.74 27.975 28.065 21.22 60-64 22.8 27.834999999999997 28.78 20.585 65-69 23.055 27.735 28.405 20.805 70-74 23.145 27.68 28.244999999999997 20.93 75-79 23.05 27.834999999999997 28.410000000000004 20.705000000000002 80-84 22.67 28.565 27.860000000000003 20.905 85-89 23.369999999999997 28.310000000000002 28.084999999999997 20.235 90-94 23.23 28.22 27.73 20.82 95-99 23.29 27.74 28.560000000000002 20.41 100-104 23.51 28.265 28.27 19.955000000000002 105-109 23.919999999999998 27.685 28.810000000000002 19.585 110-114 24.16 27.98 27.91 19.950000000000003 115-119 24.415 28.205000000000002 27.839999999999996 19.54 120-124 24.645 28.060000000000002 27.765 19.53 125-129 24.9 28.16 27.3 19.64 130-134 24.7 27.295 27.939999999999998 20.064999999999998 135-139 25.009999999999998 27.92 27.345000000000002 19.725 140-144 25.924999999999997 27.779999999999998 27.36 18.935 145-149 25.380000000000003 27.650000000000002 27.625 19.345000000000002 150-151 25.587500000000002 26.7125 27.925 19.775000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 3.0 24 5.0 25 4.0 26 3.5 27 6.5 28 9.5 29 12.5 30 20.0 31 25.5 32 34.5 33 43.5 34 52.5 35 72.5 36 96.5 37 118.5 38 136.5 39 166.0 40 203.0 41 230.5 42 268.0 43 290.0 44 270.5 45 255.5 46 253.0 47 243.0 48 229.5 49 196.0 50 159.5 51 130.5 52 106.5 53 84.5 54 65.0 55 55.0 56 39.5 57 25.5 58 19.0 59 17.5 60 11.0 61 5.5 62 5.5 63 4.5 64 2.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49634852681945 98.775 2 0.4281037522034752 0.8500000000000001 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02518257365902795 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.7625 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.199999999999999 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.800000000000001 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 8.1625 0.0 0.0 0.0 0.0 130-131 8.9 0.0 0.0 0.0 0.0 132-133 9.6875 0.0 0.0 0.0 0.0 134-135 10.5625 0.0 0.0 0.0 0.0 136-137 11.2375 0.0 0.0 0.0 0.0 138-139 12.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGCTAA 10 0.006830828 145.0 8 GGCTAAG 10 0.006830828 145.0 9 GTGGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849140 spots for SRR7171072.sra Written 849140 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra Read 849131 spots for SRR7171072.sra Written 849131 spots for SRR7171072.sra SRR ids: ['SRR7171072.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_18cao8kx SRR7171072.sra spots: 16982629 blocks: [[1, 849131], [849132, 1698262], [1698263, 2547393], [2547394, 3396524], [3396525, 4245655], [4245656, 5094786], [5094787, 5943917], [5943918, 6793048], [6793049, 7642179], [7642180, 8491310], [8491311, 9340441], [9340442, 10189572], [10189573, 11038703], [11038704, 11887834], [11887835, 12736965], [12736966, 13586096], [13586097, 14435227], [14435228, 15284358], [15284359, 16133489], [16133490, 16982629]] SRR7171072 file size 5733155 SRR7171072 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171072 SRR7171072_1.fastq SRR7171072_2.fastq Input file: SRR7171072_1.fastq Paired file: SRR7171072_2.fastq trimmed: SRR7171072-trimmed-pair1.fastq, SRR7171072-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:26:41 2025 >> started Thu Feb 13 23:27:02 2025 >> done (21.739s) 16982629 read pairs processed; of these: 19817 ( 0.12%) short read pairs filtered out after trimming by size control 24775 ( 0.15%) empty read pairs filtered out after trimming by size control 16938037 (99.74%) read pairs available; of these: 10004313 (59.06%) trimmed read pairs available after processing 6933724 (40.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 4 0.00% 21 9 0.00% 22 7 0.00% 23 9 0.00% 24 13 0.00% 25 10 0.00% 26 13 0.00% 27 9 0.00% 28 13 0.00% 29 10 0.00% 30 16 0.00% 31 12 0.00% 32 8 0.00% 33 16 0.00% 34 18 0.00% 35 21 0.00% 36 22 0.00% 37 31 0.00% 38 21 0.00% 39 42 0.00% 40 57 0.00% 41 34 0.00% 42 67 0.00% 43 65 0.00% 44 65 0.00% 45 69 0.00% 46 84 0.00% 47 94 0.00% 48 107 0.00% 49 127 0.00% 50 182 0.00% 51 192 0.00% 52 193 0.00% 53 231 0.00% 54 264 0.00% 55 263 0.00% 56 317 0.00% 57 339 0.00% 58 388 0.00% 59 485 0.00% 60 542 0.00% 61 591 0.00% 62 666 0.00% 63 730 0.00% 64 832 0.00% 65 903 0.01% 66 980 0.01% 67 1069 0.01% 68 1222 0.01% 69 1405 0.01% 70 1645 0.01% 71 1883 0.01% 72 2180 0.01% 73 2494 0.01% 74 2677 0.02% 75 3142 0.02% 76 3650 0.02% 77 4220 0.02% 78 3996 0.02% 79 4367 0.03% 80 4909 0.03% 81 5518 0.03% 82 6355 0.04% 83 7153 0.04% 84 8487 0.05% 85 9600 0.06% 86 10352 0.06% 87 11287 0.07% 88 11932 0.07% 89 12716 0.08% 90 13510 0.08% 91 14676 0.09% 92 15876 0.09% 93 17672 0.10% 94 18448 0.11% 95 19965 0.12% 96 20827 0.12% 97 21839 0.13% 98 22372 0.13% 99 23759 0.14% 100 25344 0.15% 101 26363 0.16% 102 28707 0.17% 103 29819 0.18% 104 31523 0.19% 105 33330 0.20% 106 35152 0.21% 107 35913 0.21% 108 36931 0.22% 109 38037 0.22% 110 39360 0.23% 111 40330 0.24% 112 42414 0.25% 113 44322 0.26% 114 46663 0.28% 115 48505 0.29% 116 49604 0.29% 117 50743 0.30% 118 51638 0.30% 119 52387 0.31% 120 53987 0.32% 121 54999 0.32% 122 57157 0.34% 123 59005 0.35% 124 61638 0.36% 125 63168 0.37% 126 64638 0.38% 127 66763 0.39% 128 68092 0.40% 129 70547 0.42% 130 72176 0.43% 131 74091 0.44% 132 76953 0.45% 133 81550 0.48% 134 84666 0.50% 135 88689 0.52% 136 93617 0.55% 137 98476 0.58% 138 104196 0.62% 139 111662 0.66% 140 119392 0.70% 141 130510 0.77% 142 145441 0.86% 143 163947 0.97% 144 191181 1.13% 145 229317 1.35% 146 283651 1.67% 147 387813 2.29% 148 564392 3.33% 149 1054567 6.23% 150 4120565 24.33% 151 6933724 40.94% 16938037 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=17 prefix-density=0.44 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=13.55 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=2.3 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACCTCTTGGTGTTTTAGGTACGCAATATCG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=54.52 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.0 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7171072 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:27:47 Started mapping on | Feb 13 23:27:48 Finished on | Feb 13 23:29:46 Mapping speed, Million of reads per hour | 516.75 Number of input reads | 16938037 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15902712 Uniquely mapped reads % | 93.89% Average mapped length | 289.35 Number of splices: Total | 14641598 Number of splices: Annotated (sjdb) | 14290046 Number of splices: GT/AG | 14355964 Number of splices: GC/AG | 220225 Number of splices: AT/AC | 9185 Number of splices: Non-canonical | 56224 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490479 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 104114 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565493 565493 565493 N_multimapping 490479 490479 490479 N_noFeature 675034 15648614 772042 N_ambiguous 288931 1181 131229 UnstrandedReadsAssigned:14938747 PositiveStrandReadsAssigned:252917 NegativeStrandReadsAssigned:14999441 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171072 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171072-trimmed-pair1.fastq SRR7171072-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,938,037 reads, 15,009,317 reads pseudoaligned [quant] estimated average fragment length: 218.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7171072.ke.tsv 34699 SRR7171072.se.tsv 87100 total ==> SRR7171072.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.1 1459.64 51.3644 Potri.005G024800.1.v4.1 1035 817.102 219 16.9778 Potri.004G059700.1.v4.1 961 743.113 6 0.511458 Potri.007G009000.2.v4.1 1416 1198.1 0 0 Potri.003G141000.2.v4.1 2943 2725.1 968.119 22.504 Potri.016G087400.1.v4.1 270 90.3796 930 651.817 Potri.015G069301.1.v4.1 564 348.975 0 0 Potri.010G195200.1.v4.1 1773 1555.1 149 6.06933 Potri.012G127500.1.v4.1 977 759.113 125 10.4308 ==> SRR7171072.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 609 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 100 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7171072 completed mapping pipeline successfully