Starting /dee2/code/volunteer_pipeline.sh SRR7171073 current disk space = 3089240948736 free memory = 1473138208 SRR7171073 SRAfilesize f69c7e1aefb4e55838aab8a5d436e218 SRR7171073.sra SRR7171073.sra file validated SRR7171073 is paired end SRR7171073 is conventional basespace SRR7171073 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.26525 18.0 18.0 18.0 18.0 32.0 2 24.603 25.0 18.0 27.0 18.0 29.0 3 25.87475 27.0 25.0 29.0 18.0 31.0 4 29.1515 30.0 28.0 31.0 25.0 33.0 5 29.18275 31.0 29.0 33.0 25.0 33.0 6 34.08875 37.0 34.0 38.0 28.0 38.0 7 36.216 38.0 36.0 38.0 31.0 38.0 8 36.2865 38.0 37.0 38.0 33.0 38.0 9 37.14825 38.0 38.0 38.0 36.0 38.0 10-14 37.3858 38.0 38.0 38.0 36.8 38.0 15-19 37.4527 38.0 38.0 38.0 37.0 38.0 20-24 37.52315 38.0 38.0 38.0 37.6 38.0 25-29 37.5472 38.0 38.0 38.0 38.0 38.0 30-34 37.50955 38.0 38.0 38.0 37.8 38.0 35-39 37.43305 38.0 38.0 38.0 37.6 38.0 40-44 37.45225000000001 38.0 38.0 38.0 37.2 38.0 45-49 37.42745000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.36045 38.0 38.0 38.0 36.8 38.0 55-59 37.2487 38.0 38.0 38.0 37.0 38.0 60-64 37.25575 38.0 38.0 38.0 36.6 38.0 65-69 36.2266 38.0 37.2 38.0 32.0 38.0 70-74 36.33489999999999 38.0 37.2 38.0 31.2 38.0 75-79 37.081 38.0 38.0 38.0 35.8 38.0 80-84 37.0052 38.0 38.0 38.0 36.0 38.0 85-89 36.8037 38.0 38.0 38.0 35.2 38.0 90-94 36.665350000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.69029999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.54645000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.50015 38.0 38.0 38.0 34.0 38.0 110-114 36.40045 38.0 38.0 38.0 34.0 38.0 115-119 36.12945 38.0 37.0 38.0 33.4 38.0 120-124 36.0773 38.0 37.0 38.0 32.8 38.0 125-129 35.589099999999995 38.0 36.4 38.0 31.0 38.0 130-134 34.90575 38.0 35.0 38.0 28.8 38.0 135-139 34.6275 38.0 34.8 38.0 27.4 38.0 140-144 34.05499999999999 38.0 33.8 38.0 24.8 38.0 145-149 33.1887 38.0 33.0 38.0 17.0 38.0 150-151 27.558625 34.0 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 2.0 20 0.0 21 4.0 22 4.0 23 5.0 24 5.0 25 15.0 26 13.0 27 21.0 28 32.0 29 27.0 30 44.0 31 61.0 32 83.0 33 116.0 34 206.0 35 402.0 36 1141.0 37 1808.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.96155817529472 31.77857508969759 8.66222450025628 34.597642234751405 2 20.180045011252815 20.005001250312578 34.858714678669664 24.956239059764943 3 20.0 25.974999999999998 27.425 26.6 4 21.875 34.150000000000006 22.3 21.675 5 22.075 34.775 24.7 18.45 6 17.825 37.65 24.5 20.025000000000002 7 13.625000000000002 22.6 44.875 18.9 8 17.375 23.400000000000002 31.6 27.625 9 16.525000000000002 24.3 32.925 26.25 10-14 19.220000000000002 29.705 27.375 23.7 15-19 19.93 28.439999999999998 28.244999999999997 23.385 20-24 19.835 29.099999999999998 27.529999999999998 23.535 25-29 19.869999999999997 29.005 28.075 23.05 30-34 20.044999999999998 28.115000000000002 28.585 23.255 35-39 19.515 28.645 28.08 23.76 40-44 19.71 28.65 28.395 23.244999999999997 45-49 19.755 28.615000000000002 27.465 24.165 50-54 20.169999999999998 29.025000000000002 27.735 23.07 55-59 20.07 28.53 27.900000000000002 23.5 60-64 20.65 29.15 27.224999999999998 22.975 65-69 20.1 29.160000000000004 27.245 23.494999999999997 70-74 20.265 28.715000000000003 27.544999999999998 23.474999999999998 75-79 19.759999999999998 29.054999999999996 28.175 23.01 80-84 20.235 29.125 27.400000000000002 23.24 85-89 20.855 28.575 27.38 23.189999999999998 90-94 20.4 28.93 27.315 23.355 95-99 20.681034051702586 28.601430071503575 27.891394569728483 22.826141307065352 100-104 21.08 28.610000000000003 27.02 23.29 105-109 20.685000000000002 29.12 27.345000000000002 22.85 110-114 20.225 28.815 27.49 23.47 115-119 20.080000000000002 29.17 27.279999999999998 23.47 120-124 20.41 28.685 27.43 23.474999999999998 125-129 20.544999999999998 28.77 26.915 23.77 130-134 21.345 28.46 26.82 23.375 135-139 21.18 28.58 26.445 23.794999999999998 140-144 20.485 28.24 27.425 23.849999999999998 145-149 20.544999999999998 28.525 27.21 23.72 150-151 20.792698174543638 27.91947986996749 27.04426106526632 24.243560890222557 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.5 23 3.5 24 4.5 25 5.5 26 6.5 27 13.0 28 19.0 29 19.0 30 27.5 31 33.5 32 36.5 33 54.5 34 73.5 35 88.0 36 101.5 37 126.5 38 155.0 39 184.0 40 211.5 41 219.0 42 226.5 43 239.5 44 252.5 45 246.0 46 235.5 47 242.0 48 229.5 49 189.0 50 155.5 51 126.0 52 93.5 53 81.5 54 74.0 55 62.5 56 51.5 57 33.5 58 18.0 59 11.5 60 13.5 61 13.5 62 7.5 63 3.5 64 2.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.45 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.8624999999999998 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.4625000000000004 0.0 0.0 0.0 0.0 110-111 2.9000000000000004 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.75 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.824999999999999 0.0 0.0 0.0 0.0 124-125 5.487500000000001 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.199999999999999 0.0 0.0 0.0 0.0 132-133 7.75 0.0 0.0 0.0 0.0 134-135 8.175 0.0 0.0 0.0 0.0 136-137 8.6375 0.0 0.0 0.0 0.0 138-139 9.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAATA 10 0.0068343505 144.975 145 >>END_MODULE SRR7171073 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.812 33.0 32.0 34.0 27.0 34.0 2 32.501 33.0 33.0 34.0 31.0 34.0 3 32.6675 33.0 33.0 34.0 32.0 34.0 4 32.77625 33.0 33.0 34.0 32.0 34.0 5 32.84525 34.0 33.0 34.0 32.0 34.0 6 37.0805 38.0 38.0 38.0 36.0 38.0 7 37.144 38.0 38.0 38.0 37.0 38.0 8 37.0275 38.0 38.0 38.0 37.0 38.0 9 37.0655 38.0 38.0 38.0 37.0 38.0 10-14 36.825300000000006 38.0 38.0 38.0 35.2 38.0 15-19 36.93410000000001 38.0 38.0 38.0 35.8 38.0 20-24 35.077600000000004 38.0 34.8 38.0 26.8 38.0 25-29 36.77499999999999 38.0 37.8 38.0 35.6 38.0 30-34 37.011250000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.948750000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.87365 38.0 38.0 38.0 36.0 38.0 45-49 36.6981 38.0 38.0 38.0 35.4 38.0 50-54 36.098200000000006 38.0 37.4 38.0 32.2 38.0 55-59 36.617250000000006 38.0 38.0 38.0 34.8 38.0 60-64 36.65955 38.0 38.0 38.0 35.0 38.0 65-69 36.4811 38.0 38.0 38.0 34.4 38.0 70-74 36.48075 38.0 38.0 38.0 34.8 38.0 75-79 36.4264 38.0 38.0 38.0 34.4 38.0 80-84 35.44215 38.0 36.6 38.0 29.0 38.0 85-89 36.20315000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.2965 38.0 38.0 38.0 34.0 38.0 95-99 36.15185 38.0 38.0 38.0 34.0 38.0 100-104 35.873400000000004 38.0 37.4 38.0 32.6 38.0 105-109 35.1113 38.0 36.4 38.0 27.0 38.0 110-114 35.359899999999996 38.0 36.6 38.0 30.0 38.0 115-119 35.33995 38.0 37.0 38.0 30.6 38.0 120-124 35.076449999999994 38.0 36.0 38.0 29.2 38.0 125-129 34.7562 38.0 35.8 38.0 27.6 38.0 130-134 33.928999999999995 38.0 34.0 38.0 22.6 38.0 135-139 33.40465 38.0 33.2 38.0 20.0 38.0 140-144 32.409850000000006 38.0 32.6 38.0 14.2 38.0 145-149 31.68415 38.0 32.2 38.0 10.4 38.0 150-151 25.624875000000003 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 5.0 5 2.0 6 2.0 7 3.0 8 0.0 9 3.0 10 2.0 11 2.0 12 5.0 13 2.0 14 3.0 15 3.0 16 5.0 17 2.0 18 2.0 19 7.0 20 8.0 21 9.0 22 6.0 23 10.0 24 24.0 25 15.0 26 21.0 27 31.0 28 39.0 29 41.0 30 58.0 31 70.0 32 99.0 33 149.0 34 240.0 35 355.0 36 854.0 37 1908.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 19.0 13.850000000000001 27.0 2 26.924999999999997 25.324999999999996 31.15 16.6 3 20.724999999999998 28.95 31.1 19.225 4 24.925 34.575 20.724999999999998 19.775000000000002 5 22.45 37.7 22.025 17.825 6 18.4 39.25 24.575 17.775 7 17.7 19.35 42.25 20.7 8 20.8 24.25 28.975 25.974999999999998 9 22.55 24.025 29.425 24.0 10-14 23.965 27.87 26.784999999999997 21.38 15-19 22.37 28.33 28.595 20.705000000000002 20-24 23.155 27.939999999999998 28.455000000000002 20.45 25-29 22.375 29.025000000000002 28.244999999999997 20.355 30-34 22.67 28.515 27.939999999999998 20.875 35-39 22.14 28.415000000000003 28.275 21.17 40-44 22.965 28.084999999999997 28.355000000000004 20.595 45-49 22.795 28.125 28.595 20.485 50-54 22.945 28.110000000000003 28.305000000000003 20.64 55-59 23.145 27.85 28.435 20.57 60-64 22.73 27.625 29.01 20.635 65-69 22.994999999999997 28.18 28.1 20.724999999999998 70-74 23.41 27.950000000000003 27.779999999999998 20.86 75-79 23.195 27.474999999999998 28.59 20.74 80-84 23.335 27.85 28.17 20.645 85-89 24.4 27.49 27.875 20.235 90-94 23.49 28.110000000000003 28.07 20.330000000000002 95-99 23.18 27.76 28.455000000000002 20.605 100-104 23.915 27.705000000000002 27.66 20.72 105-109 23.265 27.79 28.799999999999997 20.145 110-114 24.165 27.375 28.015 20.445 115-119 23.615 28.28 27.435 20.669999999999998 120-124 24.21 27.49 28.59 19.71 125-129 23.93 27.935 27.615000000000002 20.52 130-134 24.02 27.615000000000002 28.025 20.34 135-139 24.51 27.694999999999997 27.639999999999997 20.155 140-144 24.695 26.93 27.97 20.405 145-149 25.335 27.500000000000004 27.55 19.615 150-151 26.144036009002253 27.694423605901473 26.85671417854464 19.30482620655164 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 3.0 26 5.0 27 8.5 28 12.0 29 15.0 30 17.0 31 22.0 32 29.5 33 37.0 34 50.5 35 67.5 36 101.5 37 121.0 38 135.5 39 174.5 40 211.5 41 244.5 42 249.0 43 253.5 44 299.0 45 303.0 46 264.5 47 228.0 48 205.0 49 183.0 50 153.5 51 123.5 52 96.5 53 83.5 54 66.5 55 60.0 56 49.5 57 34.5 58 25.5 59 19.0 60 14.5 61 10.5 62 6.5 63 2.0 64 1.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.3017349761126477 0.6 3 0.10057832537088257 0.3 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.7625 0.0 0.0 0.0 0.0 112-113 2.9749999999999996 0.0 0.0 0.0 0.0 114-115 3.2875 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.8625 0.0 0.0 0.0 0.0 120-121 4.3125 0.0 0.0 0.0 0.0 122-123 4.699999999999999 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.575 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.6125 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.5 0.0 0.0 0.0 0.0 138-139 9.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTTT 10 0.006830828 145.0 3 CATTTTC 10 0.006830828 145.0 5 GAAGACT 10 0.006830828 145.0 9 ATTTTCG 10 0.006830828 145.0 6 AAAAAAA 40 0.0076550315 18.125 45-49 >>END_MODULE Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884624 spots for SRR7171073.sra Written 884624 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra Read 884608 spots for SRR7171073.sra Written 884608 spots for SRR7171073.sra SRR ids: ['SRR7171073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2egnvobl SRR7171073.sra spots: 17692176 blocks: [[1, 884608], [884609, 1769216], [1769217, 2653824], [2653825, 3538432], [3538433, 4423040], [4423041, 5307648], [5307649, 6192256], [6192257, 7076864], [7076865, 7961472], [7961473, 8846080], [8846081, 9730688], [9730689, 10615296], [10615297, 11499904], [11499905, 12384512], [12384513, 13269120], [13269121, 14153728], [14153729, 15038336], [15038337, 15922944], [15922945, 16807552], [16807553, 17692176]] SRR7171073 file size 5973597 SRR7171073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171073 SRR7171073_1.fastq SRR7171073_2.fastq Input file: SRR7171073_1.fastq Paired file: SRR7171073_2.fastq trimmed: SRR7171073-trimmed-pair1.fastq, SRR7171073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 23:34:27 2025 >> started Thu Feb 13 23:34:56 2025 >> done (29.001s) 17692176 read pairs processed; of these: 19415 ( 0.11%) short read pairs filtered out after trimming by size control 29314 ( 0.17%) empty read pairs filtered out after trimming by size control 17643447 (99.72%) read pairs available; of these: 11141319 (63.15%) trimmed read pairs available after processing 6502128 (36.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 7 0.00% 20 14 0.00% 21 9 0.00% 22 6 0.00% 23 18 0.00% 24 10 0.00% 25 14 0.00% 26 16 0.00% 27 16 0.00% 28 11 0.00% 29 17 0.00% 30 22 0.00% 31 12 0.00% 32 11 0.00% 33 19 0.00% 34 15 0.00% 35 23 0.00% 36 20 0.00% 37 26 0.00% 38 24 0.00% 39 44 0.00% 40 39 0.00% 41 43 0.00% 42 64 0.00% 43 56 0.00% 44 66 0.00% 45 68 0.00% 46 74 0.00% 47 88 0.00% 48 102 0.00% 49 122 0.00% 50 143 0.00% 51 145 0.00% 52 198 0.00% 53 184 0.00% 54 211 0.00% 55 242 0.00% 56 268 0.00% 57 270 0.00% 58 319 0.00% 59 364 0.00% 60 425 0.00% 61 481 0.00% 62 524 0.00% 63 620 0.00% 64 658 0.00% 65 770 0.00% 66 799 0.00% 67 920 0.01% 68 971 0.01% 69 1076 0.01% 70 1289 0.01% 71 1478 0.01% 72 1730 0.01% 73 1872 0.01% 74 2124 0.01% 75 2377 0.01% 76 3059 0.02% 77 3125 0.02% 78 3030 0.02% 79 3458 0.02% 80 3809 0.02% 81 4194 0.02% 82 4853 0.03% 83 5720 0.03% 84 6906 0.04% 85 7940 0.05% 86 8554 0.05% 87 9045 0.05% 88 9707 0.06% 89 10232 0.06% 90 11128 0.06% 91 12186 0.07% 92 13174 0.07% 93 13969 0.08% 94 14961 0.08% 95 16240 0.09% 96 17021 0.10% 97 17821 0.10% 98 18244 0.10% 99 19173 0.11% 100 20527 0.12% 101 21463 0.12% 102 23228 0.13% 103 24944 0.14% 104 26291 0.15% 105 27661 0.16% 106 29192 0.17% 107 29674 0.17% 108 30198 0.17% 109 31716 0.18% 110 32684 0.19% 111 34111 0.19% 112 35626 0.20% 113 37367 0.21% 114 39274 0.22% 115 41413 0.23% 116 42782 0.24% 117 44038 0.25% 118 44589 0.25% 119 46263 0.26% 120 47143 0.27% 121 49254 0.28% 122 51356 0.29% 123 53821 0.31% 124 56669 0.32% 125 58541 0.33% 126 61651 0.35% 127 63510 0.36% 128 65600 0.37% 129 67687 0.38% 130 70817 0.40% 131 73757 0.42% 132 78011 0.44% 133 83542 0.47% 134 88722 0.50% 135 95446 0.54% 136 102132 0.58% 137 109681 0.62% 138 117346 0.67% 139 125263 0.71% 140 134083 0.76% 141 146327 0.83% 142 162867 0.92% 143 181289 1.03% 144 208884 1.18% 145 251682 1.43% 146 306647 1.74% 147 415208 2.35% 148 644403 3.65% 149 1277918 7.24% 150 4969929 28.17% 151 6502128 36.85% 17643447 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=16 prefix-density=0.36 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=77.18 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=58.32 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.9 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGT SRR7171073 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 23:35:40 Started mapping on | Feb 13 23:35:40 Finished on | Feb 13 23:40:48 Mapping speed, Million of reads per hour | 206.22 Number of input reads | 17643447 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16543096 Uniquely mapped reads % | 93.76% Average mapped length | 290.55 Number of splices: Total | 15658729 Number of splices: Annotated (sjdb) | 15273857 Number of splices: GT/AG | 15368126 Number of splices: GC/AG | 227712 Number of splices: AT/AC | 9606 Number of splices: Non-canonical | 53285 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 494230 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 44702 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 628603 628603 628603 N_multimapping 494230 494230 494230 N_noFeature 709088 16290728 807294 N_ambiguous 281900 1066 127139 UnstrandedReadsAssigned:15552108 PositiveStrandReadsAssigned:251302 NegativeStrandReadsAssigned:15608663 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171073-trimmed-pair1.fastq SRR7171073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,643,447 reads, 15,547,992 reads pseudoaligned [quant] estimated average fragment length: 235.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR7171073.ke.tsv 34699 SRR7171073.se.tsv 87100 total ==> SRR7171073.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.27 1091 37.9011 Potri.005G024800.1.v4.1 1035 800.266 326 25.2364 Potri.004G059700.1.v4.1 961 726.325 4 0.341171 Potri.007G009000.2.v4.1 1416 1181.27 0 0 Potri.003G141000.2.v4.1 2943 2708.27 972.312 22.2412 Potri.016G087400.1.v4.1 270 86.0208 1218 877.177 Potri.015G069301.1.v4.1 564 335.2 0 0 Potri.010G195200.1.v4.1 1773 1538.27 403 16.2299 Potri.012G127500.1.v4.1 977 742.283 119 9.93163 ==> SRR7171073.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 401 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 101 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7171073 completed mapping pipeline successfully