Starting /dee2/code/volunteer_pipeline.sh SRR7171074 current disk space = 3089063251968 free memory = 1580126468 SRR7171074 SRAfilesize 180056ee089f513f208281cb780c5f8c SRR7171074.sra SRR7171074.sra file validated SRR7171074 is paired end SRR7171074 is conventional basespace SRR7171074 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171074_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.39025 28.0 18.0 33.0 18.0 33.0 2 29.27775 31.0 27.0 33.0 25.0 33.0 3 29.364 31.0 28.0 33.0 25.0 33.0 4 30.0735 31.0 29.0 33.0 27.0 33.0 5 31.913 33.0 31.0 33.0 29.0 33.0 6 36.375 38.0 37.0 38.0 34.0 38.0 7 37.1025 38.0 38.0 38.0 36.0 38.0 8 37.35525 38.0 38.0 38.0 37.0 38.0 9 37.44125 38.0 38.0 38.0 37.0 38.0 10-14 37.4839 38.0 38.0 38.0 37.0 38.0 15-19 37.44070000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.544850000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.0959 38.0 38.0 38.0 35.8 38.0 30-34 37.20315000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.256600000000006 38.0 36.4 38.0 31.2 38.0 40-44 37.2029 38.0 38.0 38.0 37.0 38.0 45-49 36.7669 38.0 37.8 38.0 34.4 38.0 50-54 37.172549999999994 38.0 38.0 38.0 36.4 38.0 55-59 37.210449999999994 38.0 38.0 38.0 36.6 38.0 60-64 36.527699999999996 38.0 37.4 38.0 33.2 38.0 65-69 36.0553 38.0 36.4 38.0 30.2 38.0 70-74 36.43095 38.0 37.6 38.0 32.6 38.0 75-79 36.85255 38.0 38.0 38.0 35.4 38.0 80-84 36.765 38.0 38.0 38.0 35.2 38.0 85-89 35.56925 38.0 36.0 38.0 30.4 38.0 90-94 35.8699 38.0 36.4 38.0 31.6 38.0 95-99 35.19145 38.0 36.0 38.0 24.8 38.0 100-104 36.03945 38.0 37.0 38.0 32.6 38.0 105-109 36.18294999999999 38.0 37.4 38.0 33.4 38.0 110-114 35.1313 38.0 35.6 38.0 27.6 38.0 115-119 32.27415 34.8 29.4 37.8 23.6 38.0 120-124 35.57795 38.0 36.6 38.0 31.0 38.0 125-129 35.257400000000004 38.0 36.0 38.0 30.2 38.0 130-134 34.2428 38.0 34.0 38.0 23.6 38.0 135-139 34.2441 38.0 33.6 38.0 25.2 38.0 140-144 33.62635 38.0 33.0 38.0 21.8 38.0 145-149 30.11535 36.0 26.8 38.0 8.0 38.0 150-151 26.422375000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 1.0 17 4.0 18 5.0 19 2.0 20 8.0 21 2.0 22 6.0 23 13.0 24 9.0 25 16.0 26 29.0 27 19.0 28 37.0 29 40.0 30 64.0 31 110.0 32 114.0 33 144.0 34 262.0 35 573.0 36 1406.0 37 1131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.72204806687565 11.859979101358412 9.561128526645767 40.85684430512016 2 19.0 18.725 37.175000000000004 25.1 3 18.4 23.974999999999998 28.65 28.975 4 22.0 30.275000000000002 23.625 24.099999999999998 5 21.891418563922944 35.851888916687514 24.31823867900926 17.938453840380287 6 16.875 36.775000000000006 26.400000000000002 19.950000000000003 7 14.475 22.7 43.9 18.925 8 17.2 23.150000000000002 32.375 27.275 9 17.849999999999998 22.95 33.5 25.7 10-14 19.755 29.494999999999997 26.884999999999998 23.865 15-19 19.79 28.48 27.735 23.995 20-24 20.095 28.694999999999997 27.785 23.425 25-29 19.650000000000002 29.035 27.810000000000002 23.505000000000003 30-34 19.57 28.854999999999997 28.199999999999996 23.375 35-39 20.345 29.04 27.0 23.615 40-44 19.945 28.634999999999998 27.815 23.605 45-49 20.28 28.175 27.884999999999998 23.66 50-54 20.979999999999997 27.685 28.165000000000003 23.169999999999998 55-59 20.71 28.804999999999996 27.200000000000003 23.285 60-64 20.485 28.48 27.650000000000002 23.385 65-69 19.77 29.720000000000002 27.43 23.080000000000002 70-74 20.205000000000002 29.24 27.339999999999996 23.215 75-79 20.26 28.845 27.805000000000003 23.09 80-84 20.181009050452523 28.621431071553577 27.316365818290915 23.881194059702985 85-89 20.415 28.875 27.339999999999996 23.369999999999997 90-94 20.415 27.985 28.1 23.5 95-99 20.52 28.305000000000003 27.915 23.26 100-104 20.61 28.895 27.0 23.494999999999997 105-109 20.605 28.17 27.700000000000003 23.525 110-114 21.265 28.27 26.61 23.855 115-119 21.060000000000002 28.499999999999996 27.52 22.919999999999998 120-124 20.955 28.595 26.6 23.849999999999998 125-129 20.845 28.505000000000003 26.815 23.835 130-134 20.849999999999998 28.720000000000002 26.61 23.82 135-139 21.25 28.54 26.33 23.880000000000003 140-144 20.93 28.37 26.445 24.255 145-149 21.035 28.76 26.3 23.905 150-151 21.350844277673545 28.080050031269543 25.97873671044403 24.590368980612883 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 2.0 22 3.5 23 3.5 24 2.5 25 5.0 26 6.5 27 8.5 28 14.5 29 16.5 30 18.0 31 26.5 32 32.0 33 46.5 34 66.0 35 78.5 36 104.0 37 127.5 38 139.5 39 170.5 40 195.5 41 209.5 42 228.5 43 242.5 44 259.0 45 264.5 46 246.0 47 238.5 48 234.5 49 204.0 50 160.5 51 122.0 52 105.5 53 90.0 54 75.5 55 64.5 56 49.0 57 37.0 58 26.0 59 23.0 60 21.0 61 11.0 62 4.5 63 2.5 64 1.5 65 2.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.32630522088353414 0.65 3 0.0 0.0 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5249999999999999 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.1625 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.1500000000000004 0.0 0.0 0.0 0.0 116-117 3.6 0.0 0.0 0.0 0.0 118-119 4.125 0.0 0.0 0.0 0.0 120-121 4.637499999999999 0.0 0.0 0.0 0.0 122-123 5.137499999999999 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.1375 0.0 0.0 0.0 0.0 128-129 6.75 0.0 0.0 0.0 0.0 130-131 7.4 0.0 0.0 0.0 0.0 132-133 8.05 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.175 0.0 0.0 0.0 0.0 138-139 9.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171074 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171074_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73225 33.0 33.0 34.0 32.0 34.0 2 32.651 33.0 33.0 34.0 32.0 34.0 3 32.82825 34.0 33.0 34.0 32.0 34.0 4 32.86525 34.0 33.0 34.0 32.0 34.0 5 32.76725 34.0 33.0 34.0 32.0 34.0 6 37.00575 38.0 38.0 38.0 36.0 38.0 7 37.07725 38.0 38.0 38.0 37.0 38.0 8 37.043 38.0 38.0 38.0 36.0 38.0 9 37.077 38.0 38.0 38.0 37.0 38.0 10-14 36.94295 38.0 38.0 38.0 36.2 38.0 15-19 36.9568 38.0 38.0 38.0 36.0 38.0 20-24 36.64630000000001 38.0 38.0 38.0 34.8 38.0 25-29 36.91715000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.9226 38.0 38.0 38.0 36.0 38.0 35-39 36.94135 38.0 38.0 38.0 36.0 38.0 40-44 36.82625 38.0 38.0 38.0 35.8 38.0 45-49 36.61685 38.0 38.0 38.0 35.0 38.0 50-54 36.720749999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.72055 38.0 38.0 38.0 35.6 38.0 60-64 36.609300000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.6531 38.0 38.0 38.0 35.0 38.0 70-74 36.56385 38.0 38.0 38.0 34.6 38.0 75-79 36.48815 38.0 38.0 38.0 34.6 38.0 80-84 36.35875 38.0 38.0 38.0 34.2 38.0 85-89 36.27295 38.0 38.0 38.0 34.0 38.0 90-94 36.173300000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.1162 38.0 38.0 38.0 33.6 38.0 100-104 35.80315 38.0 37.4 38.0 31.8 38.0 105-109 35.555600000000005 38.0 37.0 38.0 30.6 38.0 110-114 35.492000000000004 38.0 37.0 38.0 31.0 38.0 115-119 35.17815 38.0 36.4 38.0 29.2 38.0 120-124 34.96875 38.0 36.0 38.0 28.6 38.0 125-129 34.368050000000004 38.0 35.6 38.0 25.6 38.0 130-134 34.12885 38.0 35.0 38.0 24.6 38.0 135-139 33.28025 38.0 33.6 38.0 18.2 38.0 140-144 32.057900000000004 38.0 32.2 38.0 13.0 38.0 145-149 30.91115 38.0 31.0 38.0 5.8 38.0 150-151 24.372374999999998 30.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 2.0 6 2.0 7 2.0 8 1.0 9 2.0 10 3.0 11 0.0 12 0.0 13 2.0 14 5.0 15 4.0 16 5.0 17 4.0 18 7.0 19 9.0 20 10.0 21 5.0 22 10.0 23 17.0 24 27.0 25 18.0 26 37.0 27 34.0 28 41.0 29 45.0 30 54.0 31 86.0 32 101.0 33 122.0 34 149.0 35 330.0 36 698.0 37 2155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.2 18.825 12.675 28.299999999999997 2 24.325 26.974999999999998 33.2 15.5 3 20.8 28.15 30.75 20.3 4 24.9 34.4 22.475 18.224999999999998 5 24.125 36.725 22.625 16.525000000000002 6 18.625 36.625 26.200000000000003 18.55 7 18.825 19.125 41.125 20.925 8 22.0 23.974999999999998 28.799999999999997 25.224999999999998 9 22.1 24.675 30.225 23.0 10-14 23.835 28.535 26.26 21.37 15-19 22.37 28.449999999999996 28.015 21.165 20-24 22.81 28.044999999999998 28.33 20.815 25-29 23.195 27.860000000000003 28.12 20.825 30-34 22.825 28.54 28.07 20.565 35-39 22.84 27.845 28.095 21.22 40-44 23.41 28.07 28.205000000000002 20.315 45-49 22.900000000000002 28.07 28.144999999999996 20.885 50-54 22.770000000000003 27.655 28.410000000000004 21.165 55-59 23.49 27.834999999999997 27.68 20.995 60-64 22.770000000000003 27.26 28.52 21.45 65-69 23.185 27.935 27.900000000000002 20.979999999999997 70-74 23.205000000000002 27.615000000000002 28.08 21.099999999999998 75-79 23.22 28.015 28.12 20.645 80-84 23.06 27.955000000000002 28.02 20.965 85-89 24.235 27.455000000000002 27.800000000000004 20.51 90-94 23.48 28.26 27.775 20.485 95-99 23.435 27.325 28.315 20.925 100-104 23.995 27.305 28.444999999999997 20.255000000000003 105-109 23.66 27.865000000000002 28.15 20.325 110-114 23.335 27.905 27.860000000000003 20.9 115-119 24.305 28.194999999999997 27.26 20.24 120-124 23.865 28.98 27.045 20.11 125-129 24.415 27.485 27.455000000000002 20.645 130-134 24.275 27.589999999999996 28.044999999999998 20.09 135-139 25.575 26.985 27.265 20.175 140-144 25.679999999999996 28.165000000000003 26.555 19.6 145-149 25.495 27.825 27.029999999999998 19.650000000000002 150-151 26.207155366524894 27.645734300725543 26.957718288716535 19.189392044033024 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 1.5 23 2.5 24 3.5 25 5.0 26 5.5 27 7.0 28 11.5 29 14.5 30 19.0 31 24.5 32 30.0 33 42.0 34 45.5 35 61.5 36 90.0 37 109.5 38 122.5 39 162.5 40 203.0 41 212.0 42 238.5 43 263.5 44 271.5 45 272.0 46 260.5 47 237.5 48 240.5 49 206.0 50 166.0 51 150.5 52 117.0 53 98.5 54 76.0 55 57.0 56 42.5 57 31.5 58 24.0 59 19.0 60 16.0 61 13.0 62 8.0 63 4.0 64 2.0 65 1.0 66 1.0 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.5287009063444109 1.05 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.6375000000000002 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.7875 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.25 0.0 0.0 0.0 0.0 118-119 4.8125 0.0 0.0 0.0 0.0 120-121 5.3375 0.0 0.0 0.0 0.0 122-123 5.824999999999999 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 6.8125 0.0 0.0 0.0 0.0 128-129 7.449999999999999 0.0 0.0 0.0 0.0 130-131 8.075 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.375 0.0 0.0 0.0 0.0 136-137 9.9 0.0 0.0 0.0 0.0 138-139 10.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCGA 10 0.006830828 145.0 8 GATGATA 10 0.006830828 145.0 2 TGATAAC 10 0.006830828 145.0 4 ATAACCA 10 0.006830828 145.0 6 AACAGCT 10 0.006830828 145.0 145 >>END_MODULE Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961264 spots for SRR7171074.sra Written 961264 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra Read 961254 spots for SRR7171074.sra Written 961254 spots for SRR7171074.sra SRR ids: ['SRR7171074.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__nx28y_w SRR7171074.sra spots: 19225090 blocks: [[1, 961254], [961255, 1922508], [1922509, 2883762], [2883763, 3845016], [3845017, 4806270], [4806271, 5767524], [5767525, 6728778], [6728779, 7690032], [7690033, 8651286], [8651287, 9612540], [9612541, 10573794], [10573795, 11535048], [11535049, 12496302], [12496303, 13457556], [13457557, 14418810], [14418811, 15380064], [15380065, 16341318], [16341319, 17302572], [17302573, 18263826], [18263827, 19225090]] SRR7171074 file size 6493051 SRR7171074 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171074 SRR7171074_1.fastq SRR7171074_2.fastq Input file: SRR7171074_1.fastq Paired file: SRR7171074_2.fastq trimmed: SRR7171074-trimmed-pair1.fastq, SRR7171074-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:50:24 2025 >> started Fri Feb 14 00:50:43 2025 >> done (19.965s) 19225090 read pairs processed; of these: 19049 ( 0.10%) short read pairs filtered out after trimming by size control 42682 ( 0.22%) empty read pairs filtered out after trimming by size control 19163359 (99.68%) read pairs available; of these: 11901034 (62.10%) trimmed read pairs available after processing 7262325 (37.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 13 0.00% 21 12 0.00% 22 16 0.00% 23 13 0.00% 24 12 0.00% 25 24 0.00% 26 19 0.00% 27 17 0.00% 28 20 0.00% 29 22 0.00% 30 26 0.00% 31 36 0.00% 32 46 0.00% 33 44 0.00% 34 30 0.00% 35 51 0.00% 36 56 0.00% 37 73 0.00% 38 75 0.00% 39 77 0.00% 40 109 0.00% 41 105 0.00% 42 112 0.00% 43 132 0.00% 44 154 0.00% 45 177 0.00% 46 177 0.00% 47 225 0.00% 48 226 0.00% 49 292 0.00% 50 336 0.00% 51 344 0.00% 52 399 0.00% 53 420 0.00% 54 455 0.00% 55 514 0.00% 56 532 0.00% 57 590 0.00% 58 701 0.00% 59 777 0.00% 60 957 0.00% 61 1035 0.01% 62 1183 0.01% 63 1289 0.01% 64 1394 0.01% 65 1474 0.01% 66 1540 0.01% 67 1741 0.01% 68 1945 0.01% 69 2204 0.01% 70 2503 0.01% 71 2899 0.02% 72 3495 0.02% 73 3902 0.02% 74 4289 0.02% 75 5073 0.03% 76 7999 0.04% 77 7175 0.04% 78 5826 0.03% 79 6465 0.03% 80 7078 0.04% 81 7910 0.04% 82 8700 0.05% 83 9796 0.05% 84 11522 0.06% 85 12799 0.07% 86 13807 0.07% 87 14310 0.07% 88 15715 0.08% 89 16704 0.09% 90 17564 0.09% 91 18900 0.10% 92 20075 0.10% 93 21969 0.11% 94 23580 0.12% 95 25173 0.13% 96 26226 0.14% 97 27168 0.14% 98 28108 0.15% 99 29560 0.15% 100 31288 0.16% 101 32026 0.17% 102 34111 0.18% 103 35711 0.19% 104 37263 0.19% 105 39208 0.20% 106 40806 0.21% 107 42322 0.22% 108 43069 0.22% 109 44607 0.23% 110 45504 0.24% 111 46974 0.25% 112 48612 0.25% 113 50211 0.26% 114 51634 0.27% 115 53986 0.28% 116 55585 0.29% 117 57085 0.30% 118 59008 0.31% 119 59278 0.31% 120 61269 0.32% 121 63315 0.33% 122 64190 0.33% 123 67379 0.35% 124 69372 0.36% 125 70346 0.37% 126 73736 0.38% 127 76078 0.40% 128 78374 0.41% 129 81762 0.43% 130 84529 0.44% 131 86794 0.45% 132 90318 0.47% 133 94342 0.49% 134 100013 0.52% 135 105315 0.55% 136 111834 0.58% 137 119397 0.62% 138 127277 0.66% 139 138063 0.72% 140 146479 0.76% 141 159237 0.83% 142 173208 0.90% 143 191620 1.00% 144 220573 1.15% 145 256606 1.34% 146 314121 1.64% 147 412633 2.15% 148 618764 3.23% 149 1201707 6.27% 150 5105568 26.64% 151 7262325 37.90% 19163359 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=64.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.59 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=18.16 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.1 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7171074 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 00:51:26 Started mapping on | Feb 14 00:51:27 Finished on | Feb 14 00:53:20 Mapping speed, Million of reads per hour | 610.51 Number of input reads | 19163359 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 18057317 Uniquely mapped reads % | 94.23% Average mapped length | 288.94 Number of splices: Total | 16636217 Number of splices: Annotated (sjdb) | 16276253 Number of splices: GT/AG | 16312503 Number of splices: GC/AG | 264854 Number of splices: AT/AC | 10167 Number of splices: Non-canonical | 48693 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 492512 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 153745 % of reads mapped to too many loci | 0.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 632544 632544 632544 N_multimapping 492512 492512 492512 N_noFeature 782707 17791084 891732 N_ambiguous 270550 1245 112672 UnstrandedReadsAssigned:17004060 PositiveStrandReadsAssigned:264988 NegativeStrandReadsAssigned:17052913 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171074 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171074-trimmed-pair1.fastq SRR7171074-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,163,359 reads, 17,137,499 reads pseudoaligned [quant] estimated average fragment length: 225.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7171074.ke.tsv 34699 SRR7171074.se.tsv 87100 total ==> SRR7171074.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.26 675 21.8896 Potri.005G024800.1.v4.1 1035 810.257 139 9.97626 Potri.004G059700.1.v4.1 961 736.272 27 2.13256 Potri.007G009000.2.v4.1 1416 1191.26 0 0 Potri.003G141000.2.v4.1 2943 2718.26 909.185 19.4508 Potri.016G087400.1.v4.1 270 91.3285 923.755 588.203 Potri.015G069301.1.v4.1 564 343.175 0 0 Potri.010G195200.1.v4.1 1773 1548.26 53.7841 2.02016 Potri.012G127500.1.v4.1 977 752.257 118 9.12203 ==> SRR7171074.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1419 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 56 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 8 SRR7171074 completed mapping pipeline successfully