Starting /dee2/code/volunteer_pipeline.sh SRR7171075 current disk space = 2824036548608 free memory = 1581067560 SRR7171075 SRAfilesize 28886ee6b041d56876a046bacb807e3b SRR7171075.sra SRR7171075.sra file validated SRR7171075 is paired end SRR7171075 is conventional basespace SRR7171075 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171075_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.93225 27.0 18.0 33.0 18.0 33.0 2 24.6 25.0 18.0 30.0 18.0 33.0 3 27.7735 29.0 27.0 31.0 18.0 33.0 4 31.06875 31.0 30.0 33.0 29.0 33.0 5 32.005 33.0 31.0 33.0 30.0 33.0 6 34.30275 37.0 34.0 38.0 26.0 38.0 7 35.53425 38.0 35.0 38.0 30.0 38.0 8 36.71975 38.0 37.0 38.0 34.0 38.0 9 37.30075 38.0 38.0 38.0 36.0 38.0 10-14 37.382850000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.487649999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.5428 38.0 38.0 38.0 38.0 38.0 25-29 37.549549999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.4296 38.0 38.0 38.0 37.4 38.0 35-39 37.4313 38.0 38.0 38.0 37.2 38.0 40-44 37.4325 38.0 38.0 38.0 37.0 38.0 45-49 37.3756 38.0 38.0 38.0 37.0 38.0 50-54 37.252250000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.186299999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.2228 38.0 38.0 38.0 37.0 38.0 65-69 36.3792 38.0 37.6 38.0 33.0 38.0 70-74 36.380649999999996 38.0 37.4 38.0 31.4 38.0 75-79 36.983850000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.9873 38.0 38.0 38.0 36.0 38.0 85-89 36.83065 38.0 38.0 38.0 35.6 38.0 90-94 36.68345000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.66275 38.0 38.0 38.0 34.8 38.0 100-104 36.61695 38.0 38.0 38.0 34.4 38.0 105-109 36.53035 38.0 38.0 38.0 34.0 38.0 110-114 36.3937 38.0 37.8 38.0 34.0 38.0 115-119 36.065999999999995 38.0 37.0 38.0 33.2 38.0 120-124 36.00015 38.0 37.0 38.0 32.2 38.0 125-129 35.5324 38.0 36.2 38.0 30.6 38.0 130-134 34.9505 38.0 35.4 38.0 28.4 38.0 135-139 34.8146 38.0 35.4 38.0 28.8 38.0 140-144 33.9809 38.0 33.2 38.0 24.8 38.0 145-149 33.0933 38.0 33.0 38.0 17.8 38.0 150-151 27.66675 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 3.0 9 1.0 10 3.0 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 7.0 23 4.0 24 8.0 25 15.0 26 6.0 27 11.0 28 20.0 29 33.0 30 33.0 31 63.0 32 97.0 33 123.0 34 187.0 35 373.0 36 1028.0 37 1972.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.3469387755102 13.418367346938776 9.005102040816325 40.2295918367347 2 18.2 18.0 36.425000000000004 27.375 3 16.900000000000002 24.4 30.3 28.4 4 21.475 32.775 23.65 22.1 5 20.325 34.2 27.55 17.925 6 16.275000000000002 36.525 25.724999999999998 21.475 7 13.025 22.35 45.5 19.125 8 17.375 22.225 32.75 27.650000000000002 9 17.625 23.45 33.925 25.0 10-14 19.575 30.025000000000002 27.195000000000004 23.205000000000002 15-19 19.75 28.615000000000002 28.050000000000004 23.585 20-24 19.3 29.020000000000003 28.155 23.525 25-29 19.845 29.215000000000003 27.71 23.23 30-34 19.395 28.860000000000003 28.565 23.18 35-39 19.735 28.79 27.589999999999996 23.885 40-44 19.865 28.849999999999998 28.125 23.16 45-49 19.96 28.410000000000004 27.88 23.75 50-54 19.655 28.720000000000002 28.27 23.355 55-59 19.525000000000002 29.299999999999997 27.750000000000004 23.425 60-64 19.185 29.09 28.455000000000002 23.27 65-69 19.134999999999998 29.110000000000003 28.185 23.57 70-74 20.165 28.64 28.055000000000003 23.14 75-79 19.585 28.595 28.175 23.645 80-84 20.01 28.754999999999995 27.785 23.45 85-89 19.585 29.054999999999996 28.249999999999996 23.11 90-94 20.175 28.335 27.615000000000002 23.875 95-99 19.72 28.895 27.694999999999997 23.69 100-104 20.07 28.88 27.48 23.57 105-109 19.935 29.615000000000002 27.365000000000002 23.085 110-114 20.145 28.535 28.025 23.294999999999998 115-119 20.25 28.88 27.275 23.595 120-124 20.625 28.549999999999997 27.29 23.535 125-129 20.73 28.884999999999998 27.205000000000002 23.18 130-134 20.895 28.13 27.495000000000005 23.48 135-139 20.669999999999998 28.9 26.900000000000002 23.53 140-144 20.69 28.275 27.405 23.630000000000003 145-149 20.51 28.799999999999997 26.729999999999997 23.96 150-151 20.852606575821977 29.666208276034506 26.340792599074884 23.140392549068633 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 2.0 23 2.5 24 3.5 25 7.5 26 6.0 27 7.0 28 19.5 29 23.5 30 26.0 31 30.0 32 34.5 33 48.0 34 67.0 35 89.5 36 106.0 37 131.5 38 169.0 39 186.5 40 194.0 41 222.5 42 233.0 43 238.0 44 261.5 45 265.5 46 258.0 47 247.0 48 217.5 49 176.5 50 149.0 51 131.0 52 105.5 53 84.0 54 64.0 55 51.5 56 41.0 57 26.0 58 22.5 59 15.5 60 7.5 61 5.5 62 4.0 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7000000000000002 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.475 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.725 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.007666461 18.120312 15-19 >>END_MODULE SRR7171075 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171075_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1565 33.0 33.0 34.0 31.0 34.0 2 32.7105 33.0 33.0 34.0 32.0 34.0 3 32.94125 34.0 33.0 34.0 32.0 34.0 4 32.94525 34.0 33.0 34.0 32.0 34.0 5 32.9995 34.0 33.0 34.0 32.0 34.0 6 37.2405 38.0 38.0 38.0 37.0 38.0 7 37.28775 38.0 38.0 38.0 37.0 38.0 8 37.29775 38.0 38.0 38.0 37.0 38.0 9 37.2925 38.0 38.0 38.0 37.0 38.0 10-14 37.062799999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.124649999999995 38.0 38.0 38.0 36.8 38.0 20-24 35.3869 38.0 35.2 38.0 27.0 38.0 25-29 37.028949999999995 38.0 37.8 38.0 36.2 38.0 30-34 37.2333 38.0 38.0 38.0 37.0 38.0 35-39 37.156349999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.101350000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.9841 38.0 38.0 38.0 36.4 38.0 50-54 36.496449999999996 38.0 37.8 38.0 34.2 38.0 55-59 36.97865 38.0 38.0 38.0 36.2 38.0 60-64 36.933499999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.82285 38.0 38.0 38.0 36.0 38.0 70-74 36.8288 38.0 38.0 38.0 36.0 38.0 75-79 36.8146 38.0 38.0 38.0 36.0 38.0 80-84 36.01195 38.0 37.2 38.0 30.4 38.0 85-89 36.630700000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.6315 38.0 38.0 38.0 34.8 38.0 95-99 36.4738 38.0 38.0 38.0 34.4 38.0 100-104 36.32025 38.0 38.0 38.0 34.0 38.0 105-109 35.5118 38.0 37.0 38.0 28.4 38.0 110-114 35.88945 38.0 37.0 38.0 32.8 38.0 115-119 35.70765 38.0 37.0 38.0 31.0 38.0 120-124 35.623200000000004 38.0 37.0 38.0 31.0 38.0 125-129 35.361799999999995 38.0 36.8 38.0 30.0 38.0 130-134 34.641999999999996 38.0 35.4 38.0 27.6 38.0 135-139 34.05385 38.0 34.0 38.0 23.6 38.0 140-144 33.2127 38.0 33.0 38.0 19.8 38.0 145-149 32.58865 38.0 33.0 38.0 12.0 38.0 150-151 26.548625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 1.0 5 2.0 6 0.0 7 0.0 8 1.0 9 3.0 10 3.0 11 2.0 12 1.0 13 2.0 14 2.0 15 1.0 16 1.0 17 0.0 18 2.0 19 2.0 20 4.0 21 6.0 22 7.0 23 14.0 24 10.0 25 11.0 26 13.0 27 23.0 28 28.0 29 40.0 30 49.0 31 53.0 32 90.0 33 135.0 34 191.0 35 313.0 36 798.0 37 2175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.475 19.7 12.375 26.450000000000003 2 24.825 27.325 32.6 15.25 3 21.25 27.525 30.85 20.375 4 24.25 35.85 21.675 18.224999999999998 5 24.45 37.525 22.825 15.2 6 18.4 38.1 24.2 19.3 7 19.1 18.65 42.449999999999996 19.8 8 20.0 24.95 28.275 26.775 9 20.95 24.0 30.375000000000004 24.675 10-14 23.23 28.799999999999997 26.424999999999997 21.545 15-19 23.080000000000002 28.15 27.715 21.055 20-24 22.85 28.965000000000003 27.839999999999996 20.345 25-29 22.75 28.694999999999997 28.095 20.46 30-34 22.485 28.51 28.595 20.41 35-39 22.345000000000002 28.22 28.754999999999995 20.68 40-44 22.564999999999998 29.125 28.235 20.075000000000003 45-49 22.955000000000002 28.07 29.015 19.96 50-54 22.925 28.08 28.799999999999997 20.195 55-59 23.29 27.98 28.105000000000004 20.625 60-64 23.635 27.775 27.855 20.735 65-69 23.064999999999998 28.044999999999998 28.244999999999997 20.645 70-74 23.35 27.985 28.73 19.935 75-79 22.85 27.765 28.804999999999996 20.580000000000002 80-84 23.195 28.110000000000003 28.389999999999997 20.305 85-89 23.31 28.23 28.294999999999998 20.165 90-94 23.419999999999998 27.925 28.634999999999998 20.02 95-99 24.035 27.794999999999998 28.1 20.07 100-104 23.385 28.025 28.389999999999997 20.200000000000003 105-109 23.185 27.785 28.105000000000004 20.925 110-114 24.07 28.37 27.644999999999996 19.915 115-119 23.62 28.28 28.299999999999997 19.8 120-124 23.849999999999998 28.025 28.199999999999996 19.925 125-129 23.705000000000002 28.32 27.785 20.19 130-134 24.335 28.04 27.805000000000003 19.82 135-139 24.3 28.465 27.68 19.555 140-144 24.745 28.26 27.615000000000002 19.38 145-149 25.77 28.499999999999996 27.224999999999998 18.505 150-151 25.900000000000002 27.9125 28.212500000000002 17.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.5 15 1.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 1.5 22 2.0 23 1.5 24 1.0 25 5.0 26 7.0 27 9.0 28 14.0 29 14.5 30 15.5 31 22.0 32 28.5 33 43.0 34 60.5 35 73.5 36 88.0 37 106.0 38 154.5 39 194.0 40 210.0 41 233.5 42 262.0 43 260.0 44 270.5 45 288.0 46 273.5 47 254.0 48 214.5 49 177.5 50 148.5 51 124.5 52 102.0 53 83.5 54 64.0 55 49.0 56 38.5 57 29.0 58 22.0 59 12.0 60 10.0 61 8.5 62 4.0 63 4.0 64 3.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.2259036144578313 0.44999999999999996 3 0.0502008032128514 0.15 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.525 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.775 0.0 0.0 0.0 0.0 124-125 4.175000000000001 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.699999999999999 0.0 0.0 0.0 0.0 132-133 6.2375 0.0 0.0 0.0 0.0 134-135 6.875 0.0 0.0 0.0 0.0 136-137 7.4625 0.0 0.0 0.0 0.0 138-139 7.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTATTTT 10 0.006830828 145.0 9 >>END_MODULE Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra Read 912254 spots for SRR7171075.sra Written 912254 spots for SRR7171075.sra SRR ids: ['SRR7171075.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_drpq8x71 SRR7171075.sra spots: 18245080 blocks: [[1, 912254], [912255, 1824508], [1824509, 2736762], [2736763, 3649016], [3649017, 4561270], [4561271, 5473524], [5473525, 6385778], [6385779, 7298032], [7298033, 8210286], [8210287, 9122540], [9122541, 10034794], [10034795, 10947048], [10947049, 11859302], [11859303, 12771556], [12771557, 13683810], [13683811, 14596064], [14596065, 15508318], [15508319, 16420572], [16420573, 17332826], [17332827, 18245080]] SRR7171075 file size 6160958 SRR7171075 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171075 SRR7171075_1.fastq SRR7171075_2.fastq Input file: SRR7171075_1.fastq Paired file: SRR7171075_2.fastq trimmed: SRR7171075-trimmed-pair1.fastq, SRR7171075-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 12:46:13 2025 >> started Thu Apr 10 12:46:33 2025 >> done (20.245s) 18245080 read pairs processed; of these: 13228 ( 0.07%) short read pairs filtered out after trimming by size control 15771 ( 0.09%) empty read pairs filtered out after trimming by size control 18216081 (99.84%) read pairs available; of these: 11277869 (61.91%) trimmed read pairs available after processing 6938212 (38.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 9 0.00% 21 9 0.00% 22 8 0.00% 23 7 0.00% 24 7 0.00% 25 7 0.00% 26 12 0.00% 27 17 0.00% 28 14 0.00% 29 12 0.00% 30 15 0.00% 31 15 0.00% 32 15 0.00% 33 24 0.00% 34 17 0.00% 35 23 0.00% 36 34 0.00% 37 18 0.00% 38 38 0.00% 39 27 0.00% 40 29 0.00% 41 42 0.00% 42 45 0.00% 43 53 0.00% 44 48 0.00% 45 50 0.00% 46 65 0.00% 47 79 0.00% 48 87 0.00% 49 117 0.00% 50 110 0.00% 51 142 0.00% 52 143 0.00% 53 170 0.00% 54 184 0.00% 55 183 0.00% 56 211 0.00% 57 236 0.00% 58 301 0.00% 59 319 0.00% 60 350 0.00% 61 438 0.00% 62 497 0.00% 63 543 0.00% 64 626 0.00% 65 720 0.00% 66 725 0.00% 67 815 0.00% 68 975 0.01% 69 1033 0.01% 70 1150 0.01% 71 1358 0.01% 72 1618 0.01% 73 1770 0.01% 74 1998 0.01% 75 2320 0.01% 76 2489 0.01% 77 2704 0.01% 78 2868 0.02% 79 3206 0.02% 80 3564 0.02% 81 4100 0.02% 82 4730 0.03% 83 5333 0.03% 84 6520 0.04% 85 7148 0.04% 86 7660 0.04% 87 8473 0.05% 88 8924 0.05% 89 9475 0.05% 90 10152 0.06% 91 10994 0.06% 92 11845 0.07% 93 12932 0.07% 94 14057 0.08% 95 15054 0.08% 96 16102 0.09% 97 16489 0.09% 98 17446 0.10% 99 18225 0.10% 100 19217 0.11% 101 20134 0.11% 102 21641 0.12% 103 23046 0.13% 104 24114 0.13% 105 25653 0.14% 106 26830 0.15% 107 27658 0.15% 108 28359 0.16% 109 29829 0.16% 110 30288 0.17% 111 31763 0.17% 112 33117 0.18% 113 35087 0.19% 114 36323 0.20% 115 37432 0.21% 116 39279 0.22% 117 40190 0.22% 118 41661 0.23% 119 42792 0.23% 120 43711 0.24% 121 45887 0.25% 122 47213 0.26% 123 49496 0.27% 124 51619 0.28% 125 53681 0.29% 126 56159 0.31% 127 58394 0.32% 128 60724 0.33% 129 63060 0.35% 130 65874 0.36% 131 68138 0.37% 132 71945 0.39% 133 76837 0.42% 134 81542 0.45% 135 87550 0.48% 136 93910 0.52% 137 101015 0.55% 138 108674 0.60% 139 116981 0.64% 140 127144 0.70% 141 138516 0.76% 142 154015 0.85% 143 171842 0.94% 144 200509 1.10% 145 244441 1.34% 146 300884 1.65% 147 414159 2.27% 148 650052 3.57% 149 1321437 7.25% 150 5297665 29.08% 151 6938212 38.09% 18216081 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=26 prefix-density=0.31 prefix-fanout=2.0 sequence=ACTCAACTTTGCTTGCTTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=18.97 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.2 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.59 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=40.41 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.0 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7171075 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 12:47:22 Started mapping on | Apr 10 12:47:22 Finished on | Apr 10 12:49:48 Mapping speed, Million of reads per hour | 449.16 Number of input reads | 18216081 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16829131 Uniquely mapped reads % | 92.39% Average mapped length | 291.33 Number of splices: Total | 15962224 Number of splices: Annotated (sjdb) | 15530485 Number of splices: GT/AG | 15664969 Number of splices: GC/AG | 218928 Number of splices: AT/AC | 11179 Number of splices: Non-canonical | 67148 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 609029 % of reads mapped to multiple loci | 3.34% Number of reads mapped to too many loci | 86464 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 792779 792779 792779 N_multimapping 609029 609029 609029 N_noFeature 680379 16590874 772628 N_ambiguous 319761 1384 172995 UnstrandedReadsAssigned:15828991 PositiveStrandReadsAssigned:236873 NegativeStrandReadsAssigned:15883508 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171075 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171075-trimmed-pair1.fastq SRR7171075-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,216,081 reads, 15,828,726 reads pseudoaligned [quant] estimated average fragment length: 239.63 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7171075.ke.tsv 34699 SRR7171075.se.tsv 87100 total ==> SRR7171075.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.37 1827 62.4554 Potri.005G024800.1.v4.1 1035 796.37 429 32.7673 Potri.004G059700.1.v4.1 961 722.412 12 1.0104 Potri.007G009000.2.v4.1 1416 1177.37 0 0 Potri.003G141000.2.v4.1 2943 2704.37 963.768 21.6772 Potri.016G087400.1.v4.1 270 84.0826 1098.22 794.478 Potri.015G069301.1.v4.1 564 329.933 0 0 Potri.010G195200.1.v4.1 1773 1534.37 774.973 30.7223 Potri.012G127500.1.v4.1 977 738.391 103 8.48493 ==> SRR7171075.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 415 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 222 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7171075 completed mapping pipeline successfully