Starting /dee2/code/volunteer_pipeline.sh SRR7171076 current disk space = 3089048444928 free memory = 1580149624 SRR7171076 SRAfilesize cdfc8bcb25fb9106e2ede7266c051663 SRR7171076.sra SRR7171076.sra file validated SRR7171076 is paired end SRR7171076 is conventional basespace SRR7171076 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.542 30.0 18.0 33.0 18.0 33.0 2 29.20375 31.0 27.0 33.0 25.0 33.0 3 31.61025 33.0 31.0 33.0 28.0 33.0 4 32.43025 33.0 33.0 33.0 31.0 34.0 5 33.07525 33.0 33.0 34.0 33.0 34.0 6 37.07925 38.0 37.0 38.0 36.0 38.0 7 37.36075 38.0 38.0 38.0 37.0 38.0 8 37.47925 38.0 38.0 38.0 37.0 38.0 9 37.55375 38.0 38.0 38.0 38.0 38.0 10-14 37.600350000000006 38.0 38.0 38.0 37.8 38.0 15-19 37.583749999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.513099999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.4653 38.0 38.0 38.0 37.4 38.0 30-34 37.46805 38.0 38.0 38.0 37.2 38.0 35-39 37.45085 38.0 38.0 38.0 37.2 38.0 40-44 37.3995 38.0 38.0 38.0 37.0 38.0 45-49 37.3668 38.0 38.0 38.0 37.0 38.0 50-54 36.99515 38.0 38.0 38.0 35.6 38.0 55-59 36.0039 38.0 36.8 38.0 29.8 38.0 60-64 37.002050000000004 38.0 38.0 38.0 35.6 38.0 65-69 37.05155 38.0 38.0 38.0 36.0 38.0 70-74 36.87115 38.0 38.0 38.0 35.4 38.0 75-79 36.80120000000001 38.0 38.0 38.0 34.8 38.0 80-84 36.75815 38.0 38.0 38.0 35.0 38.0 85-89 36.477599999999995 38.0 37.8 38.0 33.8 38.0 90-94 36.44155 38.0 37.6 38.0 34.0 38.0 95-99 36.29469999999999 38.0 37.0 38.0 33.8 38.0 100-104 36.305699999999995 38.0 37.0 38.0 34.0 38.0 105-109 36.193349999999995 38.0 37.0 38.0 33.4 38.0 110-114 35.90525 38.0 37.0 38.0 32.4 38.0 115-119 35.379400000000004 38.0 36.0 38.0 29.2 38.0 120-124 35.3586 38.0 36.0 38.0 29.4 38.0 125-129 35.1513 38.0 35.8 38.0 28.4 38.0 130-134 31.999450000000003 35.8 28.6 38.0 20.2 38.0 135-139 33.9509 38.0 34.0 38.0 23.4 38.0 140-144 33.53335 38.0 34.0 38.0 20.6 38.0 145-149 32.59375 38.0 33.2 38.0 15.2 38.0 150-151 28.19475 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 0.0 16 3.0 17 3.0 18 2.0 19 5.0 20 2.0 21 3.0 22 5.0 23 10.0 24 13.0 25 18.0 26 16.0 27 19.0 28 17.0 29 24.0 30 46.0 31 62.0 32 96.0 33 128.0 34 197.0 35 509.0 36 1179.0 37 1637.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.99154334038055 14.297040169133194 9.513742071881607 28.197674418604652 2 22.005501375343837 16.454113528382095 35.55888972243061 25.98149537384346 3 18.4 25.650000000000002 28.349999999999998 27.6 4 22.875 32.975 24.05 20.1 5 22.6 35.025 24.25 18.125 6 17.525 36.375 26.625 19.475 7 13.675 22.275 46.75 17.299999999999997 8 17.599999999999998 23.275000000000002 31.075000000000003 28.050000000000004 9 17.825 23.724999999999998 32.775 25.674999999999997 10-14 20.3 29.335 26.995 23.369999999999997 15-19 20.485 28.505000000000003 27.894999999999996 23.115 20-24 19.705000000000002 29.37 27.93 22.994999999999997 25-29 20.055 29.349999999999998 27.98 22.615 30-34 20.225 28.904999999999998 27.935 22.935 35-39 20.135 28.595 28.015 23.255 40-44 20.580000000000002 28.465 28.23 22.725 45-49 20.349999999999998 28.73 27.24 23.68 50-54 20.575 28.815 27.96 22.650000000000002 55-59 20.28 28.77 27.625 23.325000000000003 60-64 20.31 29.625 27.595 22.470000000000002 65-69 20.005 28.535 27.825 23.635 70-74 20.72 28.15 28.1 23.03 75-79 20.54 27.839999999999996 28.244999999999997 23.375 80-84 20.05 28.485 27.905 23.56 85-89 20.405 29.03 27.49 23.075000000000003 90-94 20.71 28.555000000000003 27.16 23.575 95-99 20.349999999999998 28.515 28.044999999999998 23.09 100-104 21.215 29.299999999999997 26.565 22.919999999999998 105-109 21.175 29.299999999999997 26.575 22.95 110-114 21.815 28.599999999999998 26.58 23.005 115-119 21.365000000000002 28.565 27.065 23.005 120-124 21.26 28.060000000000002 27.529999999999998 23.150000000000002 125-129 21.065 28.62 26.855 23.46 130-134 20.815 29.509999999999998 26.615 23.06 135-139 21.584999999999997 28.799999999999997 26.58 23.035 140-144 20.97 27.935 27.015 24.08 145-149 20.95 28.050000000000004 26.605 24.395 150-151 21.349999999999998 29.099999999999998 25.8625 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 2.0 21 3.5 22 3.0 23 4.0 24 4.0 25 3.0 26 7.0 27 10.0 28 11.0 29 15.0 30 18.5 31 26.5 32 41.5 33 55.0 34 72.5 35 85.0 36 98.0 37 114.5 38 144.0 39 176.0 40 189.0 41 215.0 42 246.0 43 257.0 44 268.0 45 263.0 46 243.5 47 245.0 48 233.5 49 197.5 50 154.5 51 121.0 52 96.0 53 81.0 54 69.0 55 50.5 56 43.0 57 37.5 58 29.5 59 24.0 60 15.5 61 8.5 62 5.5 63 3.0 64 1.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.4 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.225 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.2375 0.0 0.0 0.0 0.0 122-123 5.6875 0.0 0.0 0.0 0.0 124-125 6.199999999999999 0.0 0.0 0.0 0.0 126-127 6.7 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.425 0.0 0.0 0.0 0.0 132-133 7.9625 0.0 0.0 0.0 0.0 134-135 8.8375 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138-139 10.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTCAG 10 0.006836113 144.9625 145 >>END_MODULE SRR7171076 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57125 33.0 33.0 34.0 32.0 34.0 2 32.8365 33.0 33.0 34.0 32.0 34.0 3 30.61175 33.0 31.0 34.0 18.0 34.0 4 32.17725 33.0 32.0 34.0 28.0 34.0 5 32.73675 33.0 33.0 34.0 32.0 34.0 6 37.15225 38.0 38.0 38.0 37.0 38.0 7 37.1585 38.0 38.0 38.0 37.0 38.0 8 37.3265 38.0 38.0 38.0 37.0 38.0 9 37.3495 38.0 38.0 38.0 37.0 38.0 10-14 37.35855 38.0 38.0 38.0 37.6 38.0 15-19 37.295399999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.0049 38.0 38.0 38.0 36.4 38.0 25-29 36.86965 38.0 38.0 38.0 36.0 38.0 30-34 37.1094 38.0 38.0 38.0 36.6 38.0 35-39 37.179700000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.1906 38.0 38.0 38.0 36.8 38.0 45-49 37.1562 38.0 38.0 38.0 37.0 38.0 50-54 37.1474 38.0 38.0 38.0 36.8 38.0 55-59 37.07725000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.01265 38.0 38.0 38.0 36.0 38.0 65-69 37.01205 38.0 38.0 38.0 36.2 38.0 70-74 36.9843 38.0 38.0 38.0 36.0 38.0 75-79 36.9611 38.0 38.0 38.0 36.0 38.0 80-84 36.7423 38.0 38.0 38.0 35.4 38.0 85-89 36.6583 38.0 38.0 38.0 35.0 38.0 90-94 36.7159 38.0 38.0 38.0 35.2 38.0 95-99 36.652 38.0 38.0 38.0 35.0 38.0 100-104 36.41025 38.0 38.0 38.0 34.0 38.0 105-109 36.038 38.0 37.6 38.0 33.2 38.0 110-114 34.46704999999999 37.6 33.6 38.0 27.4 38.0 115-119 35.55205 38.0 36.2 38.0 30.8 38.0 120-124 35.72345 38.0 36.8 38.0 31.4 38.0 125-129 35.38285 38.0 36.0 38.0 31.0 38.0 130-134 35.0204 38.0 35.6 38.0 29.0 38.0 135-139 34.642450000000004 38.0 35.4 38.0 27.4 38.0 140-144 33.922200000000004 38.0 33.4 38.0 24.0 38.0 145-149 32.934749999999994 38.0 33.0 38.0 17.8 38.0 150-151 27.662750000000003 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 2.0 6 2.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 3.0 16 3.0 17 0.0 18 3.0 19 7.0 20 5.0 21 1.0 22 4.0 23 7.0 24 13.0 25 18.0 26 18.0 27 18.0 28 23.0 29 30.0 30 42.0 31 60.0 32 70.0 33 110.0 34 164.0 35 300.0 36 789.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 20.974999999999998 12.2 20.849999999999998 2 27.975 23.425 30.099999999999998 18.5 3 20.974999999999998 26.05 33.125 19.85 4 24.18104526131533 34.40860215053764 22.455613903475868 18.95473868467117 5 23.055763940985248 37.30932733183296 21.005251312828207 18.629657414353588 6 19.775000000000002 38.125 23.799999999999997 18.3 7 19.650000000000002 19.35 40.025 20.974999999999998 8 20.925 23.275000000000002 27.85 27.950000000000003 9 21.4 25.374999999999996 28.625 24.6 10-14 23.835 28.694999999999997 26.035000000000004 21.435000000000002 15-19 22.595000000000002 28.244999999999997 27.834999999999997 21.325 20-24 22.775000000000002 28.38 27.700000000000003 21.145 25-29 23.39 28.21 27.525 20.875 30-34 22.6 28.144999999999996 28.435 20.82 35-39 22.845 28.025 28.345 20.785 40-44 23.080000000000002 27.384999999999998 28.485 21.05 45-49 23.165 27.794999999999998 27.884999999999998 21.154999999999998 50-54 23.005 27.715 27.694999999999997 21.584999999999997 55-59 22.745 28.199999999999996 27.97 21.085 60-64 22.720000000000002 27.54 28.194999999999997 21.545 65-69 22.99 27.474999999999998 28.13 21.404999999999998 70-74 23.07 27.515 28.07 21.345 75-79 22.98 27.96 27.700000000000003 21.36 80-84 23.225 27.889999999999997 27.76 21.125 85-89 23.52 27.605 27.725 21.15 90-94 23.156157807890395 28.05140257012851 27.636381819090953 21.156057802890142 95-99 22.869999999999997 28.025 28.155 20.95 100-104 23.935000000000002 28.265 27.339999999999996 20.46 105-109 23.67736773677368 27.727772777277725 27.81278127812781 20.78207820782078 110-114 24.015 28.115000000000002 27.810000000000002 20.06 115-119 24.13 28.155 27.495000000000005 20.22 120-124 23.615 28.749999999999996 27.500000000000004 20.135 125-129 23.849999999999998 28.134999999999998 27.555000000000003 20.46 130-134 25.1 27.565 27.150000000000002 20.185 135-139 24.53122656132807 27.991399569978498 27.251362568128407 20.226011300565027 140-144 24.855 28.310000000000002 27.310000000000002 19.525000000000002 145-149 25.605 28.09 27.015 19.29 150-151 26.025 28.3125 26.937499999999996 18.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 1.0 24 1.0 25 3.5 26 5.5 27 6.0 28 7.0 29 9.0 30 10.0 31 14.0 32 25.5 33 35.0 34 43.5 35 57.0 36 88.5 37 120.5 38 132.5 39 152.5 40 183.5 41 207.5 42 241.5 43 265.5 44 291.0 45 296.0 46 254.5 47 236.0 48 227.5 49 194.5 50 163.0 51 144.5 52 123.5 53 104.0 54 90.5 55 77.0 56 54.0 57 37.0 58 30.5 59 20.5 60 9.5 61 5.5 62 6.0 63 5.0 64 2.5 65 0.5 66 0.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5545752457776657 1.0999999999999999 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.6625 0.0 0.0 0.0 0.0 110-111 3.0125 0.0 0.0 0.0 0.0 112-113 3.4000000000000004 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.1 0.0 0.0 0.0 0.0 118-119 4.65 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.3 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.3625 0.0 0.0 0.0 0.0 130-131 7.7 0.0 0.0 0.0 0.0 132-133 8.225000000000001 0.0 0.0 0.0 0.0 134-135 9.0375 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834587 spots for SRR7171076.sra Written 834587 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra Read 834582 spots for SRR7171076.sra Written 834582 spots for SRR7171076.sra SRR ids: ['SRR7171076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qr989beg SRR7171076.sra spots: 16691645 blocks: [[1, 834582], [834583, 1669164], [1669165, 2503746], [2503747, 3338328], [3338329, 4172910], [4172911, 5007492], [5007493, 5842074], [5842075, 6676656], [6676657, 7511238], [7511239, 8345820], [8345821, 9180402], [9180403, 10014984], [10014985, 10849566], [10849567, 11684148], [11684149, 12518730], [12518731, 13353312], [13353313, 14187894], [14187895, 15022476], [15022477, 15857058], [15857059, 16691645]] SRR7171076 file size 5634550 SRR7171076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171076 SRR7171076_1.fastq SRR7171076_2.fastq Input file: SRR7171076_1.fastq Paired file: SRR7171076_2.fastq trimmed: SRR7171076-trimmed-pair1.fastq, SRR7171076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:07:16 2025 >> started Fri Feb 14 01:07:40 2025 >> done (23.979s) 16691645 read pairs processed; of these: 19999 ( 0.12%) short read pairs filtered out after trimming by size control 25564 ( 0.15%) empty read pairs filtered out after trimming by size control 16646082 (99.73%) read pairs available; of these: 9945101 (59.74%) trimmed read pairs available after processing 6700981 (40.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 10 0.00% 21 14 0.00% 22 11 0.00% 23 11 0.00% 24 9 0.00% 25 14 0.00% 26 6 0.00% 27 13 0.00% 28 9 0.00% 29 9 0.00% 30 11 0.00% 31 36 0.00% 32 17 0.00% 33 20 0.00% 34 18 0.00% 35 22 0.00% 36 26 0.00% 37 32 0.00% 38 30 0.00% 39 24 0.00% 40 32 0.00% 41 49 0.00% 42 43 0.00% 43 52 0.00% 44 59 0.00% 45 55 0.00% 46 81 0.00% 47 82 0.00% 48 116 0.00% 49 116 0.00% 50 132 0.00% 51 160 0.00% 52 158 0.00% 53 194 0.00% 54 198 0.00% 55 274 0.00% 56 261 0.00% 57 284 0.00% 58 344 0.00% 59 351 0.00% 60 480 0.00% 61 518 0.00% 62 528 0.00% 63 653 0.00% 64 706 0.00% 65 771 0.00% 66 881 0.01% 67 952 0.01% 68 1109 0.01% 69 1177 0.01% 70 1462 0.01% 71 1646 0.01% 72 1894 0.01% 73 2127 0.01% 74 2383 0.01% 75 2628 0.02% 76 3084 0.02% 77 3721 0.02% 78 3649 0.02% 79 3757 0.02% 80 4455 0.03% 81 4962 0.03% 82 5685 0.03% 83 6463 0.04% 84 7751 0.05% 85 8789 0.05% 86 9810 0.06% 87 10439 0.06% 88 10851 0.07% 89 11361 0.07% 90 12387 0.07% 91 13297 0.08% 92 14252 0.09% 93 15930 0.10% 94 16770 0.10% 95 18393 0.11% 96 19118 0.11% 97 19335 0.12% 98 20465 0.12% 99 21379 0.13% 100 23099 0.14% 101 23701 0.14% 102 25885 0.16% 103 27048 0.16% 104 28843 0.17% 105 30162 0.18% 106 31067 0.19% 107 32642 0.20% 108 33432 0.20% 109 34377 0.21% 110 35532 0.21% 111 37025 0.22% 112 38688 0.23% 113 40749 0.24% 114 42446 0.25% 115 43942 0.26% 116 45083 0.27% 117 46251 0.28% 118 46943 0.28% 119 48033 0.29% 120 49670 0.30% 121 50841 0.31% 122 52175 0.31% 123 55321 0.33% 124 57319 0.34% 125 59082 0.35% 126 61256 0.37% 127 62743 0.38% 128 63788 0.38% 129 66319 0.40% 130 67955 0.41% 131 70173 0.42% 132 72966 0.44% 133 77406 0.47% 134 80982 0.49% 135 86304 0.52% 136 90419 0.54% 137 96096 0.58% 138 102504 0.62% 139 109256 0.66% 140 117524 0.71% 141 129690 0.78% 142 144976 0.87% 143 164760 0.99% 144 194507 1.17% 145 233817 1.40% 146 289517 1.74% 147 391701 2.35% 148 592676 3.56% 149 1128235 6.78% 150 4120765 24.76% 151 6700981 40.26% 16646082 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=19 fanout-score=27.18 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.5 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=20 prefix-density=0.72 prefix-fanout=2.1 sequence=ACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=58.17 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7171076 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:08:25 Started mapping on | Feb 14 01:08:25 Finished on | Feb 14 01:10:23 Mapping speed, Million of reads per hour | 507.85 Number of input reads | 16646082 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15510792 Uniquely mapped reads % | 93.18% Average mapped length | 289.93 Number of splices: Total | 14688342 Number of splices: Annotated (sjdb) | 14368494 Number of splices: GT/AG | 14411161 Number of splices: GC/AG | 217482 Number of splices: AT/AC | 9614 Number of splices: Non-canonical | 50085 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407878 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 45557 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747326 747326 747326 N_multimapping 407878 407878 407878 N_noFeature 568534 15225580 663848 N_ambiguous 295127 1276 104481 UnstrandedReadsAssigned:14647131 PositiveStrandReadsAssigned:283936 NegativeStrandReadsAssigned:14742463 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171076-trimmed-pair1.fastq SRR7171076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,646,082 reads, 14,668,905 reads pseudoaligned [quant] estimated average fragment length: 227.887 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7171076.ke.tsv 34699 SRR7171076.se.tsv 87100 total ==> SRR7171076.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.11 605 20.1658 Potri.005G024800.1.v4.1 1035 808.113 152 11.2294 Potri.004G059700.1.v4.1 961 734.147 15 1.21981 Potri.007G009000.2.v4.1 1416 1189.11 0 0 Potri.003G141000.2.v4.1 2943 2716.11 980 21.5408 Potri.016G087400.1.v4.1 270 90.1405 899 595.42 Potri.015G069301.1.v4.1 564 341.157 0 0 Potri.010G195200.1.v4.1 1773 1546.11 116 4.4792 Potri.012G127500.1.v4.1 977 750.132 31 2.46722 ==> SRR7171076.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 527 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171076 completed mapping pipeline successfully