Starting /dee2/code/volunteer_pipeline.sh SRR7171077 current disk space = 3089056563200 free memory = 1582274680 SRR7171077 SRAfilesize 3178a6a352866fd3c02f8919d1d3f242 SRR7171077.sra SRR7171077.sra file validated SRR7171077 is paired end SRR7171077 is conventional basespace SRR7171077 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171077_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.0495 18.0 18.0 18.0 18.0 32.0 2 26.14525 27.0 25.0 29.0 18.0 31.0 3 26.86 27.0 25.0 30.0 18.0 33.0 4 29.71025 31.0 29.0 33.0 27.0 33.0 5 30.431 31.0 29.0 33.0 27.0 33.0 6 35.50275 37.0 35.0 38.0 31.0 38.0 7 36.508 38.0 37.0 38.0 34.0 38.0 8 36.71 38.0 37.0 38.0 34.0 38.0 9 35.82975 38.0 37.0 38.0 29.0 38.0 10-14 37.236749999999994 38.0 38.0 38.0 36.2 38.0 15-19 37.4667 38.0 38.0 38.0 37.0 38.0 20-24 37.5593 38.0 38.0 38.0 37.8 38.0 25-29 37.49115 38.0 38.0 38.0 38.0 38.0 30-34 37.46585 38.0 38.0 38.0 37.8 38.0 35-39 37.42035 38.0 38.0 38.0 37.2 38.0 40-44 37.34415 38.0 38.0 38.0 37.0 38.0 45-49 37.19715 38.0 38.0 38.0 36.8 38.0 50-54 35.748149999999995 38.0 35.4 38.0 30.4 38.0 55-59 37.0495 38.0 38.0 38.0 36.0 38.0 60-64 37.1 38.0 38.0 38.0 36.0 38.0 65-69 37.14385 38.0 38.0 38.0 36.2 38.0 70-74 37.07015 38.0 38.0 38.0 36.0 38.0 75-79 36.9648 38.0 38.0 38.0 36.0 38.0 80-84 36.378699999999995 38.0 37.8 38.0 33.4 38.0 85-89 36.63875 38.0 38.0 38.0 34.6 38.0 90-94 36.53959999999999 38.0 38.0 38.0 34.2 38.0 95-99 36.56105 38.0 38.0 38.0 34.2 38.0 100-104 36.50115 38.0 38.0 38.0 34.0 38.0 105-109 36.47205 38.0 38.0 38.0 34.0 38.0 110-114 36.031549999999996 38.0 37.0 38.0 33.0 38.0 115-119 35.9053 38.0 37.0 38.0 32.2 38.0 120-124 35.707350000000005 38.0 36.6 38.0 31.4 38.0 125-129 35.31765 38.0 36.0 38.0 30.4 38.0 130-134 33.93255 38.0 33.0 38.0 22.8 38.0 135-139 34.597300000000004 38.0 34.0 38.0 27.6 38.0 140-144 34.15745 38.0 33.6 38.0 25.4 38.0 145-149 33.23995 38.0 33.0 38.0 20.4 38.0 150-151 27.356125 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 3.0 8 4.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 2.0 19 4.0 20 3.0 21 4.0 22 3.0 23 5.0 24 14.0 25 9.0 26 9.0 27 15.0 28 24.0 29 35.0 30 43.0 31 58.0 32 94.0 33 144.0 34 219.0 35 406.0 36 1221.0 37 1673.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.50130548302872 18.433420365535248 7.754569190600521 27.31070496083551 2 21.925 17.4 33.550000000000004 27.125 3 18.625 24.15 28.9 28.325 4 24.099999999999998 29.025000000000002 24.825 22.05 5 22.405601400350086 33.65841460365091 24.20605151287822 19.72993248312078 6 17.724999999999998 36.5 25.624999999999996 20.150000000000002 7 13.575000000000001 23.674999999999997 44.1 18.65 8 17.65 23.375 33.324999999999996 25.650000000000002 9 18.15 24.45 31.0 26.400000000000002 10-14 20.345 29.265 27.105 23.285 15-19 19.88 28.299999999999997 28.27 23.549999999999997 20-24 20.085 28.34 28.28 23.294999999999998 25-29 19.605 29.4 27.52 23.474999999999998 30-34 19.86 28.634999999999998 28.09 23.415 35-39 20.34 28.73 27.405 23.525 40-44 19.994999999999997 28.744999999999997 27.439999999999998 23.82 45-49 19.84 28.83 27.625 23.705000000000002 50-54 20.0 28.59 27.985 23.425 55-59 20.07 28.13 28.015 23.785 60-64 20.015 28.244999999999997 28.23 23.51 65-69 19.99 28.89 27.515 23.605 70-74 20.064999999999998 28.315 28.07 23.549999999999997 75-79 20.235 27.93 27.985 23.849999999999998 80-84 20.135 28.645 27.805000000000003 23.415 85-89 21.07 28.910000000000004 27.060000000000002 22.96 90-94 20.28 29.099999999999998 27.555000000000003 23.064999999999998 95-99 20.075000000000003 28.310000000000002 28.21 23.405 100-104 20.585 28.62 27.485 23.31 105-109 20.515 28.625 27.834999999999997 23.025000000000002 110-114 20.965 28.645 27.515 22.875 115-119 21.385 28.7 27.32 22.595000000000002 120-124 20.835 28.965000000000003 26.700000000000003 23.5 125-129 21.335 27.544999999999998 27.145000000000003 23.974999999999998 130-134 21.25 27.97 26.83 23.95 135-139 21.18 28.04 27.08 23.7 140-144 21.315 27.584999999999997 27.11 23.990000000000002 145-149 20.794999999999998 28.345 26.490000000000002 24.37 150-151 21.661869603303714 28.29433112251283 26.11688149167814 23.92691778250532 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 2.0 2 1.5 3 1.0 4 0.5 5 0.0 6 1.0 7 2.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 0.0 23 0.5 24 2.5 25 4.0 26 4.0 27 6.5 28 13.5 29 15.5 30 20.5 31 34.0 32 40.0 33 44.0 34 66.0 35 88.0 36 105.0 37 125.0 38 133.5 39 150.5 40 175.5 41 203.5 42 227.5 43 250.5 44 260.0 45 261.0 46 272.5 47 249.5 48 210.0 49 193.5 50 172.5 51 137.0 52 119.5 53 96.5 54 68.0 55 57.0 56 52.5 57 42.5 58 24.0 59 16.0 60 14.0 61 7.5 62 6.0 63 5.0 64 1.5 65 1.0 66 1.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54705586311022 98.9 2 0.377453447408153 0.75 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025163563160543533 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.0374999999999996 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.1500000000000004 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.2375 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.15 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.625 0.0 0.0 0.0 0.0 126-127 7.012499999999999 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.175 0.0 0.0 0.0 0.0 132-133 8.9375 0.0 0.0 0.0 0.0 134-135 9.65 0.0 0.0 0.0 0.0 136-137 10.225000000000001 0.0 0.0 0.0 0.0 138-139 10.975000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171077 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171077_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17375 33.0 32.0 34.0 28.0 34.0 2 30.1445 33.0 28.0 34.0 18.0 34.0 3 31.8735 33.0 32.0 34.0 27.0 34.0 4 32.3005 33.0 33.0 34.0 31.0 34.0 5 32.5285 33.0 33.0 34.0 32.0 34.0 6 36.74275 38.0 38.0 38.0 36.0 38.0 7 36.94175 38.0 38.0 38.0 36.0 38.0 8 36.9695 38.0 38.0 38.0 36.0 38.0 9 36.89275 38.0 38.0 38.0 36.0 38.0 10-14 36.835750000000004 38.0 38.0 38.0 35.8 38.0 15-19 36.85225 38.0 38.0 38.0 36.0 38.0 20-24 35.742599999999996 38.0 37.2 38.0 28.6 38.0 25-29 36.5981 38.0 37.8 38.0 34.2 38.0 30-34 36.8131 38.0 38.0 38.0 36.0 38.0 35-39 36.82085 38.0 38.0 38.0 36.2 38.0 40-44 36.7301 38.0 38.0 38.0 36.0 38.0 45-49 36.0038 38.0 37.4 38.0 29.8 38.0 50-54 36.6046 38.0 38.0 38.0 35.2 38.0 55-59 36.4969 38.0 38.0 38.0 34.8 38.0 60-64 35.45705 38.0 36.0 38.0 29.2 38.0 65-69 36.51805 38.0 38.0 38.0 34.6 38.0 70-74 36.37205 38.0 38.0 38.0 34.0 38.0 75-79 36.410250000000005 38.0 38.0 38.0 34.2 38.0 80-84 34.697449999999996 38.0 34.4 38.0 27.6 38.0 85-89 35.94925 38.0 37.6 38.0 33.4 38.0 90-94 36.0262 38.0 38.0 38.0 33.6 38.0 95-99 35.91515 38.0 37.8 38.0 33.6 38.0 100-104 35.623349999999995 38.0 37.2 38.0 32.2 38.0 105-109 34.66754999999999 38.0 35.2 38.0 27.2 38.0 110-114 33.39525 37.8 32.4 38.0 21.8 38.0 115-119 34.80865 38.0 36.0 38.0 27.2 38.0 120-124 34.650150000000004 38.0 35.8 38.0 26.8 38.0 125-129 34.3109 38.0 35.4 38.0 25.2 38.0 130-134 33.779250000000005 38.0 33.8 38.0 22.2 38.0 135-139 33.1378 38.0 33.0 38.0 19.0 38.0 140-144 32.114850000000004 38.0 32.0 38.0 13.0 38.0 145-149 30.814600000000002 37.8 30.4 38.0 6.0 38.0 150-151 24.07225 29.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 6.0 5 5.0 6 1.0 7 3.0 8 2.0 9 2.0 10 2.0 11 1.0 12 5.0 13 4.0 14 3.0 15 7.0 16 7.0 17 6.0 18 4.0 19 7.0 20 12.0 21 18.0 22 15.0 23 14.0 24 10.0 25 14.0 26 23.0 27 32.0 28 33.0 29 45.0 30 81.0 31 88.0 32 102.0 33 148.0 34 247.0 35 416.0 36 1030.0 37 1590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.74999999999999 19.8 10.225 19.225 2 25.8 24.0 30.599999999999998 19.6 3 21.85546386596649 27.831957989497376 31.48287071767942 18.829707426856714 4 25.5 33.475 22.35 18.675 5 23.7 37.875 21.85 16.575 6 20.45 37.075 23.275000000000002 19.2 7 20.150000000000002 20.200000000000003 38.074999999999996 21.575 8 19.900000000000002 24.7 29.075 26.325 9 21.125 24.25 30.15 24.474999999999998 10-14 22.865 28.865000000000002 26.6 21.67 15-19 22.8 28.165000000000003 27.83 21.205 20-24 22.53 28.199999999999996 28.435 20.835 25-29 23.29 28.34 28.035 20.335 30-34 23.625 28.32 27.694999999999997 20.36 35-39 22.64 27.515 28.63 21.215 40-44 22.665 28.485 27.96 20.89 45-49 23.035 27.805000000000003 28.485 20.674999999999997 50-54 22.245 28.93 27.99 20.835 55-59 22.869999999999997 28.065 27.83 21.235 60-64 23.615 27.975 27.794999999999998 20.615 65-69 23.599999999999998 28.199999999999996 27.395000000000003 20.805 70-74 22.720000000000002 28.194999999999997 27.765 21.32 75-79 23.665 27.474999999999998 27.825 21.035 80-84 23.485 27.055 28.325 21.135 85-89 23.68 28.07 27.595 20.655 90-94 23.285 28.310000000000002 27.834999999999997 20.57 95-99 23.625 28.33 27.465 20.580000000000002 100-104 24.035 27.950000000000003 28.139999999999997 19.875 105-109 23.830000000000002 27.96 27.62 20.59 110-114 23.95 28.365000000000002 27.07 20.615 115-119 24.635 28.050000000000004 27.195000000000004 20.119999999999997 120-124 24.104999999999997 27.73 27.655 20.51 125-129 23.89 27.805000000000003 27.265 21.04 130-134 24.834999999999997 27.85 27.095000000000002 20.22 135-139 24.82 27.74 27.439999999999998 20.0 140-144 25.055 27.825 27.295 19.825 145-149 25.185000000000002 28.13 26.875 19.81 150-151 26.186005757917137 26.448867192389535 27.049693328326445 20.31543372136688 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 1.0 25 2.0 26 4.0 27 5.5 28 10.5 29 13.5 30 16.0 31 24.0 32 33.0 33 48.0 34 58.5 35 66.0 36 88.5 37 113.0 38 133.5 39 156.0 40 194.0 41 230.5 42 243.0 43 254.5 44 267.0 45 263.5 46 256.5 47 241.5 48 218.0 49 193.0 50 160.0 51 129.5 52 108.0 53 100.0 54 96.0 55 71.0 56 48.0 57 39.0 58 28.5 59 21.0 60 16.0 61 11.0 62 5.5 63 6.5 64 6.0 65 1.5 66 0.0 67 1.0 68 1.0 69 1.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 2.9625 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.512499999999999 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.3375 0.0 0.0 0.0 0.0 122-123 5.862500000000001 0.0 0.0 0.0 0.0 124-125 6.4625 0.0 0.0 0.0 0.0 126-127 6.887499999999999 0.0 0.0 0.0 0.0 128-129 7.525 0.0 0.0 0.0 0.0 130-131 8.0875 0.0 0.0 0.0 0.0 132-133 8.837499999999999 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.100000000000001 0.0 0.0 0.0 0.0 138-139 10.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGTGG 10 0.006830828 145.0 8 >>END_MODULE Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859400 spots for SRR7171077.sra Written 859400 spots for SRR7171077.sra Read 859414 spots for SRR7171077.sra Written 859414 spots for SRR7171077.sra SRR ids: ['SRR7171077.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yrkv8kfa SRR7171077.sra spots: 17188014 blocks: [[1, 859400], [859401, 1718800], [1718801, 2578200], [2578201, 3437600], [3437601, 4297000], [4297001, 5156400], [5156401, 6015800], [6015801, 6875200], [6875201, 7734600], [7734601, 8594000], [8594001, 9453400], [9453401, 10312800], [10312801, 11172200], [11172201, 12031600], [12031601, 12891000], [12891001, 13750400], [13750401, 14609800], [14609801, 15469200], [15469201, 16328600], [16328601, 17188014]] SRR7171077 file size 5802753 SRR7171077 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171077 SRR7171077_1.fastq SRR7171077_2.fastq Input file: SRR7171077_1.fastq Paired file: SRR7171077_2.fastq trimmed: SRR7171077-trimmed-pair1.fastq, SRR7171077-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:11:15 2025 >> started Fri Feb 14 01:11:33 2025 >> done (18.671s) 17188014 read pairs processed; of these: 36838 ( 0.21%) short read pairs filtered out after trimming by size control 53234 ( 0.31%) empty read pairs filtered out after trimming by size control 17097942 (99.48%) read pairs available; of these: 10599095 (61.99%) trimmed read pairs available after processing 6498847 (38.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 14 0.00% 21 22 0.00% 22 20 0.00% 23 27 0.00% 24 30 0.00% 25 22 0.00% 26 30 0.00% 27 30 0.00% 28 34 0.00% 29 32 0.00% 30 31 0.00% 31 41 0.00% 32 34 0.00% 33 38 0.00% 34 41 0.00% 35 39 0.00% 36 44 0.00% 37 31 0.00% 38 51 0.00% 39 62 0.00% 40 63 0.00% 41 62 0.00% 42 74 0.00% 43 75 0.00% 44 93 0.00% 45 119 0.00% 46 113 0.00% 47 137 0.00% 48 151 0.00% 49 168 0.00% 50 186 0.00% 51 242 0.00% 52 248 0.00% 53 252 0.00% 54 304 0.00% 55 296 0.00% 56 340 0.00% 57 422 0.00% 58 463 0.00% 59 508 0.00% 60 615 0.00% 61 698 0.00% 62 763 0.00% 63 796 0.00% 64 944 0.01% 65 1013 0.01% 66 1095 0.01% 67 1132 0.01% 68 1389 0.01% 69 1469 0.01% 70 1701 0.01% 71 1956 0.01% 72 2360 0.01% 73 2570 0.02% 74 2837 0.02% 75 3432 0.02% 76 4788 0.03% 77 4732 0.03% 78 4190 0.02% 79 4661 0.03% 80 5149 0.03% 81 5756 0.03% 82 6629 0.04% 83 7537 0.04% 84 9701 0.06% 85 10986 0.06% 86 11767 0.07% 87 12859 0.08% 88 13790 0.08% 89 14354 0.08% 90 15678 0.09% 91 16539 0.10% 92 17519 0.10% 93 18560 0.11% 94 19618 0.11% 95 20944 0.12% 96 21865 0.13% 97 22195 0.13% 98 23089 0.14% 99 24355 0.14% 100 26020 0.15% 101 26692 0.16% 102 28656 0.17% 103 30548 0.18% 104 31441 0.18% 105 33398 0.20% 106 34645 0.20% 107 35640 0.21% 108 36274 0.21% 109 38238 0.22% 110 39190 0.23% 111 40257 0.24% 112 41964 0.25% 113 44156 0.26% 114 45690 0.27% 115 47095 0.28% 116 48652 0.28% 117 49741 0.29% 118 50245 0.29% 119 51709 0.30% 120 53118 0.31% 121 54832 0.32% 122 56830 0.33% 123 59040 0.35% 124 61194 0.36% 125 63163 0.37% 126 66175 0.39% 127 68008 0.40% 128 70005 0.41% 129 72510 0.42% 130 74328 0.43% 131 76701 0.45% 132 80492 0.47% 133 85395 0.50% 134 90573 0.53% 135 96648 0.57% 136 101084 0.59% 137 108732 0.64% 138 115717 0.68% 139 124008 0.73% 140 133335 0.78% 141 145357 0.85% 142 158842 0.93% 143 175892 1.03% 144 201526 1.18% 145 234921 1.37% 146 290184 1.70% 147 381471 2.23% 148 563771 3.30% 149 1080371 6.32% 150 4527575 26.48% 151 6498847 38.01% 17097942 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.54 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=301.96 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=30.81 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR7171077 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:12:17 Started mapping on | Feb 14 01:12:17 Finished on | Feb 14 01:14:20 Mapping speed, Million of reads per hour | 500.43 Number of input reads | 17097942 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 15767354 Uniquely mapped reads % | 92.22% Average mapped length | 289.22 Number of splices: Total | 14741082 Number of splices: Annotated (sjdb) | 14422134 Number of splices: GT/AG | 14467759 Number of splices: GC/AG | 216145 Number of splices: AT/AC | 9161 Number of splices: Non-canonical | 48017 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483356 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 169250 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 888472 888472 888472 N_multimapping 483356 483356 483356 N_noFeature 658781 15502508 761905 N_ambiguous 270939 1361 108283 UnstrandedReadsAssigned:14837634 PositiveStrandReadsAssigned:263485 NegativeStrandReadsAssigned:14897166 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171077 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171077-trimmed-pair1.fastq SRR7171077-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,097,942 reads, 14,935,762 reads pseudoaligned [quant] estimated average fragment length: 225.191 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7171077.ke.tsv 34699 SRR7171077.se.tsv 87100 total ==> SRR7171077.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.81 739 24.1134 Potri.005G024800.1.v4.1 1035 810.809 278 20.0685 Potri.004G059700.1.v4.1 961 736.847 8 0.635481 Potri.007G009000.2.v4.1 1416 1191.81 0 0 Potri.003G141000.2.v4.1 2943 2718.81 887.141 19.0987 Potri.016G087400.1.v4.1 270 89.3728 959 628.063 Potri.015G069301.1.v4.1 564 344.168 0 0 Potri.010G195200.1.v4.1 1773 1548.81 209 7.89838 Potri.012G127500.1.v4.1 977 752.828 380 29.5446 ==> SRR7171077.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 965 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR7171077 completed mapping pipeline successfully