Starting /dee2/code/volunteer_pipeline.sh SRR7171078 current disk space = 3088951480320 free memory = 1581003204 SRR7171078 SRAfilesize 28aa04363e935b02a086113808504db3 SRR7171078.sra SRR7171078.sra file validated SRR7171078 is paired end SRR7171078 is conventional basespace SRR7171078 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171078_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.102 28.0 18.0 33.0 18.0 33.0 2 28.28975 29.0 27.0 33.0 18.0 33.0 3 30.802 31.0 29.0 33.0 27.0 33.0 4 31.01875 33.0 31.0 33.0 29.0 33.0 5 32.2985 33.0 32.0 33.0 32.0 33.0 6 33.305 37.0 33.0 38.0 16.0 38.0 7 36.322 38.0 36.0 38.0 31.0 38.0 8 37.215 38.0 38.0 38.0 36.0 38.0 9 37.4045 38.0 38.0 38.0 37.0 38.0 10-14 37.466300000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.498599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.49975 38.0 38.0 38.0 37.8 38.0 25-29 37.3314 38.0 38.0 38.0 37.0 38.0 30-34 37.2599 38.0 38.0 38.0 37.0 38.0 35-39 36.7694 38.0 38.0 38.0 34.8 38.0 40-44 37.09495 38.0 38.0 38.0 36.8 38.0 45-49 37.012600000000006 38.0 38.0 38.0 36.4 38.0 50-54 34.9938 37.8 34.0 38.0 28.0 38.0 55-59 36.1744 38.0 36.8 38.0 32.6 38.0 60-64 36.838 38.0 38.0 38.0 35.6 38.0 65-69 36.76905 38.0 38.0 38.0 35.4 38.0 70-74 36.642849999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.37065 38.0 38.0 38.0 34.0 38.0 80-84 36.242399999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.2302 38.0 38.0 38.0 34.0 38.0 90-94 35.9869 38.0 37.4 38.0 33.4 38.0 95-99 35.883050000000004 38.0 37.4 38.0 33.0 38.0 100-104 35.756949999999996 38.0 37.0 38.0 33.2 38.0 105-109 35.62585 38.0 37.0 38.0 32.6 38.0 110-114 35.3078 38.0 36.6 38.0 30.6 38.0 115-119 35.0108 38.0 36.0 38.0 28.8 38.0 120-124 34.849849999999996 38.0 36.0 38.0 28.0 38.0 125-129 34.686350000000004 38.0 35.6 38.0 27.6 38.0 130-134 30.29405 35.2 22.8 38.0 16.0 38.0 135-139 33.390150000000006 37.6 34.0 38.0 19.8 38.0 140-144 33.3469 38.0 34.0 38.0 19.0 38.0 145-149 32.0812 37.8 32.0 38.0 13.0 38.0 150-151 28.161875000000002 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 3.0 7 6.0 8 2.0 9 1.0 10 1.0 11 2.0 12 3.0 13 10.0 14 1.0 15 3.0 16 4.0 17 7.0 18 13.0 19 15.0 20 9.0 21 11.0 22 8.0 23 14.0 24 7.0 25 10.0 26 18.0 27 17.0 28 23.0 29 34.0 30 48.0 31 65.0 32 85.0 33 161.0 34 273.0 35 466.0 36 1311.0 37 1367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.776668418286913 11.008933263268524 19.153967419863374 45.06043089858119 2 18.534267133566786 16.883441720860432 37.543771885942974 27.03851925962982 3 18.2 22.825 28.175 30.8 4 22.725 30.7 22.875 23.7 5 21.675 34.75 25.575 18.0 6 16.85 36.4 26.375 20.375 7 13.125 23.275000000000002 46.525 17.075000000000003 8 17.424999999999997 24.85 31.55 26.174999999999997 9 16.125 26.05 34.35 23.474999999999998 10-14 18.765 30.285 27.97 22.98 15-19 18.475 29.330000000000002 28.815 23.380000000000003 20-24 18.34 30.005 28.904999999999998 22.75 25-29 19.17 29.404999999999998 28.48 22.945 30-34 19.12 29.465000000000003 28.42 22.994999999999997 35-39 18.404999999999998 29.395 28.465 23.735 40-44 18.65 29.854999999999997 28.265 23.23 45-49 19.11 29.43 27.83 23.630000000000003 50-54 19.81 28.835 28.21 23.145 55-59 19.23 28.76 28.345 23.665 60-64 19.435 28.59 28.645 23.330000000000002 65-69 18.915000000000003 29.299999999999997 28.854999999999997 22.93 70-74 19.115 29.854999999999997 28.08 22.95 75-79 19.155 29.599999999999998 27.97 23.275000000000002 80-84 19.365 28.585 29.03 23.02 85-89 19.33 28.79 28.785 23.095 90-94 19.21 28.33 28.835 23.625 95-99 19.475 28.93 27.839999999999996 23.755000000000003 100-104 20.0 28.485 28.015 23.5 105-109 20.115 28.73 28.055000000000003 23.1 110-114 20.630000000000003 28.810000000000002 27.55 23.01 115-119 19.89 29.060000000000002 27.384999999999998 23.665 120-124 19.99 28.78 28.07 23.16 125-129 19.955000000000002 28.605000000000004 28.08 23.36 130-134 20.330000000000002 28.615000000000002 27.76 23.294999999999998 135-139 20.265 29.075 27.644999999999996 23.015 140-144 20.715 28.615000000000002 27.305 23.365 145-149 20.615 28.285 27.450000000000003 23.65 150-151 19.725 28.537499999999998 27.8125 23.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 19.0 1 16.5 2 9.0 3 7.0 4 6.5 5 2.5 6 2.0 7 2.5 8 2.5 9 1.0 10 1.5 11 1.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.5 20 1.5 21 0.5 22 2.5 23 3.5 24 4.0 25 6.0 26 9.5 27 13.5 28 14.5 29 21.5 30 28.0 31 42.0 32 66.5 33 75.5 34 86.0 35 110.0 36 120.0 37 120.5 38 150.0 39 169.5 40 176.5 41 215.0 42 219.5 43 229.0 44 241.0 45 224.5 46 238.0 47 230.0 48 198.0 49 172.5 50 149.5 51 122.0 52 103.5 53 89.5 54 66.0 55 48.0 56 42.5 57 38.5 58 24.5 59 18.5 60 13.5 61 9.5 62 7.5 63 2.5 64 1.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8500000000000005 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9025012761613 96.875 2 0.8167432363450741 1.6 3 0.1531393568147014 0.44999999999999996 4 0.025523226135783564 0.1 5 0.025523226135783564 0.125 6 0.025523226135783564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05104645227156713 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 16 0.4 TruSeq Adapter, Index 7 (97% over 35bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit TCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.1 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.975 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTAG 10 0.0068343505 144.975 8 AAGGTTT 10 0.0068343505 144.975 5 GAAGGTT 10 0.0068343505 144.975 4 >>END_MODULE SRR7171078 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171078_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6715 33.0 33.0 34.0 32.0 34.0 2 32.7745 34.0 33.0 34.0 32.0 34.0 3 32.67175 34.0 33.0 34.0 32.0 34.0 4 32.6745 34.0 33.0 34.0 32.0 34.0 5 32.7065 34.0 33.0 34.0 32.0 34.0 6 36.63475 38.0 38.0 38.0 36.0 38.0 7 34.79075 38.0 37.0 38.0 16.0 38.0 8 36.21075 38.0 38.0 38.0 31.0 38.0 9 36.534 38.0 38.0 38.0 35.0 38.0 10-14 36.655649999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.59995 38.0 38.0 38.0 36.0 38.0 20-24 36.490750000000006 38.0 38.0 38.0 35.8 38.0 25-29 36.28525 38.0 38.0 38.0 34.6 38.0 30-34 36.49159999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.488350000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.476350000000004 38.0 38.0 38.0 36.0 38.0 45-49 35.2335 38.0 35.6 38.0 29.6 38.0 50-54 36.40845 38.0 38.0 38.0 35.4 38.0 55-59 36.3939 38.0 38.0 38.0 35.4 38.0 60-64 36.41965 38.0 38.0 38.0 35.2 38.0 65-69 36.40745 38.0 38.0 38.0 35.0 38.0 70-74 36.30645 38.0 38.0 38.0 34.8 38.0 75-79 36.3401 38.0 38.0 38.0 35.0 38.0 80-84 36.07075 38.0 38.0 38.0 34.0 38.0 85-89 35.9885 38.0 38.0 38.0 34.0 38.0 90-94 35.8635 38.0 38.0 38.0 33.8 38.0 95-99 35.8395 38.0 38.0 38.0 34.0 38.0 100-104 35.68745 38.0 38.0 38.0 33.0 38.0 105-109 35.4375 38.0 37.6 38.0 31.4 38.0 110-114 33.8037 38.0 34.2 38.0 22.4 38.0 115-119 35.0868 38.0 36.8 38.0 29.8 38.0 120-124 34.98115 38.0 36.4 38.0 29.4 38.0 125-129 34.656400000000005 38.0 36.0 38.0 27.4 38.0 130-134 34.5342 38.0 35.8 38.0 27.4 38.0 135-139 33.7759 38.0 33.6 38.0 22.4 38.0 140-144 33.29045000000001 38.0 33.0 38.0 20.0 38.0 145-149 32.550650000000005 38.0 33.0 38.0 12.8 38.0 150-151 27.4025 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 9.0 4 10.0 5 3.0 6 5.0 7 4.0 8 1.0 9 1.0 10 2.0 11 6.0 12 2.0 13 3.0 14 5.0 15 1.0 16 3.0 17 6.0 18 8.0 19 7.0 20 21.0 21 8.0 22 8.0 23 14.0 24 15.0 25 11.0 26 21.0 27 26.0 28 26.0 29 47.0 30 56.0 31 55.0 32 69.0 33 111.0 34 140.0 35 302.0 36 743.0 37 2223.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.725 17.25 23.474999999999998 30.55 2 25.55 23.200000000000003 33.45 17.8 3 23.05 26.6 31.6 18.75 4 23.71185592796398 32.24112056028014 23.28664332166083 20.76038019009505 5 26.125 34.949999999999996 22.525000000000002 16.400000000000002 6 20.95 36.85 24.349999999999998 17.849999999999998 7 19.950000000000003 21.125 39.7 19.225 8 21.425 25.074999999999996 27.975 25.525 9 22.15 26.450000000000003 28.849999999999998 22.55 10-14 23.27 29.705 26.045 20.979999999999997 15-19 22.805 28.09 28.32 20.785 20-24 23.775 28.76 27.284999999999997 20.18 25-29 22.57 28.765 27.565 21.099999999999998 30-34 23.02 28.910000000000004 27.87 20.200000000000003 35-39 23.51 27.465 28.22 20.805 40-44 23.425 27.644999999999996 27.675 21.255 45-49 22.63 28.599999999999998 27.965 20.805 50-54 23.39 27.41 28.615000000000002 20.585 55-59 23.799999999999997 27.055 28.07 21.075 60-64 23.525 27.655 27.71 21.11 65-69 23.785 27.365000000000002 28.325 20.525 70-74 24.055 27.439999999999998 27.134999999999998 21.37 75-79 23.919999999999998 27.98 27.779999999999998 20.32 80-84 23.47 28.305000000000003 27.265 20.96 85-89 23.53 27.985 27.915 20.57 90-94 24.125 27.965 27.51 20.4 95-99 23.965 27.905 28.155 19.975 100-104 23.875 27.644999999999996 28.125 20.355 105-109 23.31 27.884999999999998 28.499999999999996 20.305 110-114 23.565 27.744999999999997 27.755000000000003 20.935000000000002 115-119 24.21 27.775 27.92 20.095 120-124 23.785 28.07 28.000000000000004 20.145 125-129 23.72 28.59 27.985 19.705000000000002 130-134 24.21 28.22 27.894999999999996 19.675 135-139 23.905 28.555000000000003 28.065 19.475 140-144 23.885 28.37 28.665000000000003 19.08 145-149 23.79 28.02 28.37 19.82 150-151 25.9625 27.05 28.249999999999996 18.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 1.0 5 1.5 6 1.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 1.0 14 0.5 15 0.0 16 1.0 17 2.0 18 3.5 19 5.0 20 3.5 21 2.0 22 2.0 23 3.5 24 3.0 25 4.5 26 6.0 27 6.0 28 9.0 29 13.0 30 15.5 31 19.0 32 29.5 33 39.5 34 52.0 35 70.5 36 86.0 37 99.0 38 117.0 39 151.0 40 191.0 41 205.5 42 237.0 43 276.0 44 274.5 45 258.5 46 248.0 47 225.0 48 207.0 49 203.0 50 183.5 51 145.5 52 107.0 53 99.0 54 87.5 55 75.0 56 64.5 57 50.0 58 37.0 59 24.5 60 17.0 61 8.5 62 7.5 63 6.5 64 3.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2115971515768 97.52499999999999 2 0.5595116988809765 1.0999999999999999 3 0.0762970498474059 0.22499999999999998 4 0.025432349949135298 0.1 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.050864699898270596 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.025432349949135298 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 17 0.42500000000000004 Illumina Single End PCR Primer 1 (96% over 33bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.8875 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.2 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.8 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCCAAT 10 0.006830828 145.0 5 TTAATCC 10 0.006830828 145.0 4 >>END_MODULE Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra Read 593971 spots for SRR7171078.sra Written 593971 spots for SRR7171078.sra Read 593955 spots for SRR7171078.sra Written 593955 spots for SRR7171078.sra SRR ids: ['SRR7171078.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4xy8jb6p SRR7171078.sra spots: 11879116 blocks: [[1, 593955], [593956, 1187910], [1187911, 1781865], [1781866, 2375820], [2375821, 2969775], [2969776, 3563730], [3563731, 4157685], [4157686, 4751640], [4751641, 5345595], [5345596, 5939550], [5939551, 6533505], [6533506, 7127460], [7127461, 7721415], [7721416, 8315370], [8315371, 8909325], [8909326, 9503280], [9503281, 10097235], [10097236, 10691190], [10691191, 11285145], [11285146, 11879116]] SRR7171078 file size 4003742 SRR7171078 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171078 SRR7171078_1.fastq SRR7171078_2.fastq Input file: SRR7171078_1.fastq Paired file: SRR7171078_2.fastq trimmed: SRR7171078-trimmed-pair1.fastq, SRR7171078-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:26:10 2025 >> started Fri Feb 14 01:26:22 2025 >> done (12.107s) 11879116 read pairs processed; of these: 42962 ( 0.36%) short read pairs filtered out after trimming by size control 108923 ( 0.92%) empty read pairs filtered out after trimming by size control 11727231 (98.72%) read pairs available; of these: 6260370 (53.38%) trimmed read pairs available after processing 5466861 (46.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 15 0.00% 20 24 0.00% 21 33 0.00% 22 62 0.00% 23 73 0.00% 24 76 0.00% 25 90 0.00% 26 91 0.00% 27 71 0.00% 28 73 0.00% 29 71 0.00% 30 73 0.00% 31 60 0.00% 32 59 0.00% 33 75 0.00% 34 47 0.00% 35 51 0.00% 36 54 0.00% 37 63 0.00% 38 66 0.00% 39 69 0.00% 40 90 0.00% 41 93 0.00% 42 79 0.00% 43 93 0.00% 44 98 0.00% 45 132 0.00% 46 135 0.00% 47 182 0.00% 48 158 0.00% 49 191 0.00% 50 217 0.00% 51 257 0.00% 52 269 0.00% 53 296 0.00% 54 292 0.00% 55 307 0.00% 56 331 0.00% 57 357 0.00% 58 393 0.00% 59 435 0.00% 60 452 0.00% 61 557 0.00% 62 518 0.00% 63 547 0.00% 64 524 0.00% 65 534 0.00% 66 549 0.00% 67 516 0.00% 68 591 0.01% 69 607 0.01% 70 691 0.01% 71 692 0.01% 72 892 0.01% 73 950 0.01% 74 985 0.01% 75 1327 0.01% 76 2104 0.02% 77 2527 0.02% 78 1506 0.01% 79 1361 0.01% 80 1554 0.01% 81 1740 0.01% 82 1941 0.02% 83 2310 0.02% 84 4054 0.03% 85 5362 0.05% 86 6230 0.05% 87 7477 0.06% 88 8085 0.07% 89 7707 0.07% 90 7163 0.06% 91 6915 0.06% 92 6669 0.06% 93 6255 0.05% 94 6249 0.05% 95 6381 0.05% 96 6429 0.05% 97 6824 0.06% 98 6999 0.06% 99 7215 0.06% 100 7663 0.07% 101 8056 0.07% 102 8462 0.07% 103 9231 0.08% 104 9892 0.08% 105 10702 0.09% 106 11359 0.10% 107 12078 0.10% 108 12845 0.11% 109 13486 0.11% 110 14697 0.13% 111 14859 0.13% 112 15805 0.13% 113 16883 0.14% 114 17595 0.15% 115 18410 0.16% 116 18833 0.16% 117 19698 0.17% 118 20346 0.17% 119 21068 0.18% 120 21447 0.18% 121 21700 0.19% 122 22193 0.19% 123 22785 0.19% 124 23764 0.20% 125 24169 0.21% 126 25063 0.21% 127 25978 0.22% 128 27226 0.23% 129 28581 0.24% 130 29873 0.25% 131 31391 0.27% 132 32737 0.28% 133 34627 0.30% 134 37146 0.32% 135 39552 0.34% 136 42487 0.36% 137 45604 0.39% 138 50175 0.43% 139 55078 0.47% 140 60843 0.52% 141 68617 0.59% 142 78081 0.67% 143 91651 0.78% 144 109602 0.93% 145 134110 1.14% 146 172420 1.47% 147 242756 2.07% 148 379223 3.23% 149 746592 6.37% 150 3115230 26.56% 151 5466861 46.62% 11727231 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.8 sequence=CCAATTCTCGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=91.07 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.5 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.57 prefix-fanout=2.1 sequence=GTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATTGGTCGACTATGGAAAAGATAGCGTTACCGTCAATATCCCATCAACTGGCGATGTATCATCTAGAAGCCAGCCTCCTACCTATGCCCCACGAACTGGCAGTGGATGTAGCATTTACCAACGAGATTGTCCTAAGAAAAAACCTTGTAATCCTTACAAGCGTAGCTGCCATCGCCCTTGAAAATGAAAGAGTAGTTTGATTTGGGTCCATTATCTAGTGGTAAAAGCTGTGAGCTCAAAGCACCAGGGCTATCTATTACTTTCATTTCCATTACCAATGTAATTATATGGTCGTTGGAAATTAAATAAAAGCTCCGAGTGAGCCATGGCAGATATGCATATGCTACAGGTTTCCTTTAGTACTATTGCAATCCTGTAAATGTTACCTATGAACGTTTTGTAGTCTTTTTATTCGGAGTTATGTAATCTCTGTATGCGCAATAAAATTCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=31.68 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=CCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171078 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:27:10 Started mapping on | Feb 14 01:27:10 Finished on | Feb 14 01:28:52 Mapping speed, Million of reads per hour | 413.90 Number of input reads | 11727231 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10704409 Uniquely mapped reads % | 91.28% Average mapped length | 294.52 Number of splices: Total | 10031109 Number of splices: Annotated (sjdb) | 9802662 Number of splices: GT/AG | 9852938 Number of splices: GC/AG | 136479 Number of splices: AT/AC | 8196 Number of splices: Non-canonical | 33496 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292542 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 28914 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.78% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 776155 776155 776155 N_multimapping 292542 292542 292542 N_noFeature 341070 10436196 392659 N_ambiguous 293620 764 76830 UnstrandedReadsAssigned:10069719 PositiveStrandReadsAssigned:267449 NegativeStrandReadsAssigned:10234920 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171078 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171078-trimmed-pair1.fastq SRR7171078-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,727,231 reads, 10,199,380 reads pseudoaligned [quant] estimated average fragment length: 246.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR7171078.ke.tsv 34699 SRR7171078.se.tsv 87100 total ==> SRR7171078.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.84 559 19.1306 Potri.005G024800.1.v4.1 1035 789.839 680 52.2344 Potri.004G059700.1.v4.1 961 715.854 0 0 Potri.007G009000.2.v4.1 1416 1170.84 0 0 Potri.003G141000.2.v4.1 2943 2697.84 495.396 11.1409 Potri.016G087400.1.v4.1 270 72.2822 1034 867.912 Potri.015G069301.1.v4.1 564 321.41 0 0 Potri.010G195200.1.v4.1 1773 1527.84 208 8.25984 Potri.012G127500.1.v4.1 977 731.849 111 9.20211 ==> SRR7171078.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 309 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7171078 completed mapping pipeline successfully