Starting /dee2/code/volunteer_pipeline.sh SRR7171079 current disk space = 3089055072256 free memory = 1557100724 SRR7171079 SRAfilesize 48bc1b2d4cc7e33b5eb8b88dc341d4d9 SRR7171079.sra SRR7171079.sra file validated SRR7171079 is paired end SRR7171079 is conventional basespace SRR7171079 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.606 18.0 18.0 18.0 18.0 32.0 2 27.59075 27.0 27.0 29.0 25.0 30.0 3 29.44 30.0 29.0 31.0 27.0 33.0 4 31.831 33.0 31.0 33.0 29.0 33.0 5 32.5745 33.0 33.0 33.0 32.0 33.0 6 36.64225 38.0 37.0 38.0 34.0 38.0 7 37.205 38.0 38.0 38.0 36.0 38.0 8 37.40075 38.0 38.0 38.0 37.0 38.0 9 37.511 38.0 38.0 38.0 37.0 38.0 10-14 37.546350000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.57695 38.0 38.0 38.0 37.4 38.0 20-24 37.606550000000006 38.0 38.0 38.0 37.8 38.0 25-29 37.5213 38.0 38.0 38.0 37.6 38.0 30-34 37.57965 38.0 38.0 38.0 38.0 38.0 35-39 37.4508 38.0 38.0 38.0 37.4 38.0 40-44 37.460899999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.48195 38.0 38.0 38.0 37.2 38.0 50-54 36.8921 38.0 38.0 38.0 35.2 38.0 55-59 37.183550000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.14535 38.0 38.0 38.0 36.0 38.0 65-69 37.0955 38.0 38.0 38.0 36.0 38.0 70-74 36.9567 38.0 38.0 38.0 35.8 38.0 75-79 36.8163 38.0 38.0 38.0 35.4 38.0 80-84 36.7461 38.0 38.0 38.0 35.0 38.0 85-89 36.55795 38.0 38.0 38.0 34.4 38.0 90-94 36.31349999999999 38.0 37.6 38.0 33.8 38.0 95-99 36.281549999999996 38.0 37.6 38.0 34.0 38.0 100-104 36.2932 38.0 37.2 38.0 34.0 38.0 105-109 36.070100000000004 38.0 37.0 38.0 33.4 38.0 110-114 35.7917 38.0 36.8 38.0 32.2 38.0 115-119 35.445049999999995 38.0 36.0 38.0 30.2 38.0 120-124 35.42755 38.0 36.0 38.0 31.0 38.0 125-129 35.1248 38.0 35.6 38.0 29.0 38.0 130-134 32.35 36.2 28.8 38.0 21.0 38.0 135-139 34.19605 38.0 33.8 38.0 25.0 38.0 140-144 33.5627 38.0 33.6 38.0 21.8 38.0 145-149 32.6009 38.0 32.8 38.0 15.8 38.0 150-151 27.908 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 2.0 18 5.0 19 11.0 20 4.0 21 8.0 22 2.0 23 5.0 24 7.0 25 13.0 26 14.0 27 16.0 28 19.0 29 19.0 30 44.0 31 48.0 32 78.0 33 130.0 34 236.0 35 473.0 36 1383.0 37 1474.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 12.928427419354838 33.71975806451613 16.58266129032258 36.76915322580645 2 19.05476369092273 18.929732433108278 36.25906476619154 25.756439109777446 3 20.925 24.2 25.3 29.575000000000003 4 21.65 31.55 21.349999999999998 25.45 5 20.525 38.224999999999994 23.150000000000002 18.099999999999998 6 18.8 37.85 24.9 18.45 7 13.200000000000001 25.474999999999998 43.824999999999996 17.5 8 16.825000000000003 25.45 31.974999999999998 25.75 9 17.325 23.25 34.050000000000004 25.374999999999996 10-14 18.7 31.705 26.419999999999998 23.175 15-19 19.145 30.009999999999998 27.689999999999998 23.155 20-24 19.09 30.064999999999998 27.495000000000005 23.35 25-29 19.220000000000002 30.445 26.86 23.474999999999998 30-34 19.165 30.220000000000002 27.96 22.655 35-39 19.900000000000002 29.525000000000002 27.595 22.98 40-44 19.45 29.94 27.589999999999996 23.02 45-49 19.845 29.520000000000003 27.435 23.200000000000003 50-54 19.885 29.854999999999997 27.32 22.939999999999998 55-59 19.505 29.310000000000002 28.275 22.91 60-64 19.79 28.82 28.685 22.705000000000002 65-69 19.355 29.18 28.025 23.44 70-74 19.295 29.365000000000002 27.49 23.849999999999998 75-79 19.675 29.585 27.865000000000002 22.875 80-84 19.77 29.845 27.11 23.275000000000002 85-89 19.885 29.34 26.87 23.905 90-94 19.305 29.4 27.55 23.745 95-99 20.31 29.14 27.13 23.419999999999998 100-104 19.885 29.555 26.779999999999998 23.78 105-109 20.630000000000003 28.775000000000002 27.08 23.515 110-114 20.25 28.444999999999997 27.57 23.735 115-119 20.26 29.015 27.224999999999998 23.5 120-124 20.43 28.68 26.965 23.925 125-129 20.145 29.65 26.755000000000003 23.45 130-134 20.77 28.655 26.545 24.03 135-139 20.335 28.425 27.24 24.0 140-144 19.925 29.04 27.334999999999997 23.7 145-149 20.055 28.415000000000003 27.134999999999998 24.395 150-151 19.875 29.1625 26.75 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 2.5 3 1.5 4 0.0 5 0.0 6 0.0 7 0.5 8 2.0 9 1.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.5 22 3.0 23 3.5 24 3.5 25 8.5 26 10.5 27 10.0 28 18.0 29 30.5 30 36.5 31 41.5 32 61.0 33 79.0 34 88.0 35 112.5 36 131.0 37 147.5 38 180.0 39 194.5 40 195.5 41 217.5 42 242.0 43 231.0 44 225.5 45 220.5 46 214.5 47 205.5 48 183.5 49 161.5 50 137.0 51 121.0 52 96.0 53 78.5 54 68.0 55 52.0 56 47.0 57 42.5 58 29.5 59 20.0 60 11.0 61 7.0 62 7.0 63 4.5 64 3.5 65 1.5 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1632860040568 97.775 2 0.6592292089249493 1.3 3 0.07606490872210953 0.22499999999999998 4 0.02535496957403651 0.1 5 0.02535496957403651 0.125 6 0.0 0.0 7 0.0 0.0 8 0.02535496957403651 0.2 9 0.0 0.0 >10 0.02535496957403651 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 27 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 8 0.2 TruSeq Adapter, Index 27 (97% over 39bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.6 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.8125 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 4.012499999999999 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTTT 10 0.0068343505 144.975 2 CTTTTTC 10 0.0068343505 144.975 4 >>END_MODULE SRR7171079 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77725 33.0 33.0 34.0 32.0 34.0 2 32.60475 34.0 33.0 34.0 32.0 34.0 3 32.91275 34.0 33.0 34.0 32.0 34.0 4 32.87375 34.0 33.0 34.0 32.0 34.0 5 32.89225 34.0 33.0 34.0 33.0 34.0 6 37.09475 38.0 38.0 38.0 37.0 38.0 7 37.17325 38.0 38.0 38.0 37.0 38.0 8 37.101 38.0 38.0 38.0 37.0 38.0 9 37.1525 38.0 38.0 38.0 37.0 38.0 10-14 37.1318 38.0 38.0 38.0 37.0 38.0 15-19 37.053650000000005 38.0 38.0 38.0 37.0 38.0 20-24 36.0441 38.0 37.4 38.0 30.2 38.0 25-29 36.46785 38.0 38.0 38.0 34.4 38.0 30-34 36.9431 38.0 38.0 38.0 36.8 38.0 35-39 37.0017 38.0 38.0 38.0 37.0 38.0 40-44 36.995349999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.0298 38.0 38.0 38.0 37.0 38.0 50-54 37.02335 38.0 38.0 38.0 37.0 38.0 55-59 36.92515 38.0 38.0 38.0 36.2 38.0 60-64 36.8556 38.0 38.0 38.0 36.0 38.0 65-69 36.865300000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.7795 38.0 38.0 38.0 36.0 38.0 75-79 36.483700000000006 38.0 38.0 38.0 34.6 38.0 80-84 35.023799999999994 38.0 35.4 38.0 28.6 38.0 85-89 36.4107 38.0 38.0 38.0 34.8 38.0 90-94 36.3678 38.0 38.0 38.0 35.0 38.0 95-99 36.1948 38.0 38.0 38.0 34.0 38.0 100-104 36.1826 38.0 38.0 38.0 34.0 38.0 105-109 34.842 38.0 35.4 38.0 28.2 38.0 110-114 35.568349999999995 38.0 37.0 38.0 31.4 38.0 115-119 34.7381 38.0 35.6 38.0 27.2 38.0 120-124 35.105399999999996 38.0 36.2 38.0 29.2 38.0 125-129 34.954499999999996 38.0 36.0 38.0 28.2 38.0 130-134 34.7812 38.0 35.4 38.0 27.8 38.0 135-139 34.484049999999996 38.0 35.0 38.0 27.2 38.0 140-144 32.62555 37.0 29.6 38.0 21.4 38.0 145-149 31.376150000000003 36.2 30.0 38.0 10.8 38.0 150-151 27.4655 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 2.0 4 3.0 5 1.0 6 3.0 7 2.0 8 2.0 9 2.0 10 1.0 11 1.0 12 0.0 13 3.0 14 1.0 15 4.0 16 2.0 17 10.0 18 2.0 19 4.0 20 17.0 21 8.0 22 9.0 23 9.0 24 4.0 25 12.0 26 11.0 27 20.0 28 22.0 29 33.0 30 42.0 31 47.0 32 88.0 33 109.0 34 175.0 35 348.0 36 1034.0 37 1946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.425 15.525 25.374999999999996 31.674999999999997 2 26.650000000000002 22.275 32.25 18.825 3 23.9 25.1 30.775000000000002 20.225 4 24.256064016004 32.93323330832708 23.1807951987997 19.629907476869217 5 27.406851712928233 34.25856464116029 21.780445111277817 16.55413853463366 6 21.775 37.574999999999996 22.25 18.4 7 20.025000000000002 19.875 40.275 19.825 8 22.900000000000002 24.975 26.650000000000002 25.474999999999998 9 22.825 24.7 29.225 23.25 10-14 23.73 28.48 25.88 21.91 15-19 24.099999999999998 28.035 27.800000000000004 20.064999999999998 20-24 23.974999999999998 28.02 27.310000000000002 20.695 25-29 23.830000000000002 28.175 27.735 20.26 30-34 23.5 28.275 27.88 20.345 35-39 23.544999999999998 28.410000000000004 26.97 21.075 40-44 23.69 27.275 28.655 20.380000000000003 45-49 23.22 27.415 28.294999999999998 21.07 50-54 24.125 27.575 28.035 20.265 55-59 23.895 27.35 27.97 20.785 60-64 23.535 27.125 28.525 20.815 65-69 23.830000000000002 27.0 28.415000000000003 20.755000000000003 70-74 24.154999999999998 28.655 27.205000000000002 19.985 75-79 23.849999999999998 27.79 27.925 20.435 80-84 24.07 28.01 27.41 20.51 85-89 23.685000000000002 28.000000000000004 28.115000000000002 20.200000000000003 90-94 23.674999999999997 27.800000000000004 28.32 20.205000000000002 95-99 24.02 27.445000000000004 28.235 20.3 100-104 24.41 27.589999999999996 28.26 19.74 105-109 23.294999999999998 27.98 28.075 20.65 110-114 24.525 27.765 27.965 19.744999999999997 115-119 24.135 27.644999999999996 28.49 19.73 120-124 24.610000000000003 27.41 27.865000000000002 20.115 125-129 24.305 27.43 28.044999999999998 20.22 130-134 24.295 27.265 28.52 19.919999999999998 135-139 24.58 27.99 27.915 19.515 140-144 24.375 28.03 27.794999999999998 19.8 145-149 24.709999999999997 27.625 28.095 19.57 150-151 24.9375 27.125 27.8875 20.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 3.0 23 3.5 24 3.0 25 1.5 26 4.0 27 8.0 28 8.0 29 13.5 30 16.0 31 19.0 32 31.0 33 38.5 34 51.5 35 63.5 36 78.0 37 96.5 38 132.5 39 162.5 40 188.5 41 216.0 42 231.0 43 243.0 44 253.5 45 247.5 46 254.5 47 270.5 48 243.5 49 203.5 50 163.0 51 141.0 52 124.0 53 105.5 54 93.0 55 76.0 56 58.0 57 44.5 58 32.0 59 23.5 60 14.0 61 9.5 62 10.0 63 6.0 64 2.5 65 0.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13639827279654 97.575 2 0.6604013208026416 1.3 3 0.10160020320040639 0.3 4 0.05080010160020319 0.2 5 0.0 0.0 6 0.025400050800101596 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025400050800101596 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1375 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.3625 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.7 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGACAC 10 0.006830828 145.0 1 CCTTTAT 10 0.006830828 145.0 145 >>END_MODULE Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra Read 567581 spots for SRR7171079.sra Written 567581 spots for SRR7171079.sra Read 567570 spots for SRR7171079.sra Written 567570 spots for SRR7171079.sra SRR ids: ['SRR7171079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_62fsu800 SRR7171079.sra spots: 11351411 blocks: [[1, 567570], [567571, 1135140], [1135141, 1702710], [1702711, 2270280], [2270281, 2837850], [2837851, 3405420], [3405421, 3972990], [3972991, 4540560], [4540561, 5108130], [5108131, 5675700], [5675701, 6243270], [6243271, 6810840], [6810841, 7378410], [7378411, 7945980], [7945981, 8513550], [8513551, 9081120], [9081121, 9648690], [9648691, 10216260], [10216261, 10783830], [10783831, 11351411]] SRR7171079 file size 3824920 SRR7171079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171079 SRR7171079_1.fastq SRR7171079_2.fastq Input file: SRR7171079_1.fastq Paired file: SRR7171079_2.fastq trimmed: SRR7171079-trimmed-pair1.fastq, SRR7171079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 00:59:16 2025 >> started Fri Feb 14 00:59:29 2025 >> done (12.580s) 11351411 read pairs processed; of these: 20250 ( 0.18%) short read pairs filtered out after trimming by size control 105443 ( 0.93%) empty read pairs filtered out after trimming by size control 11225718 (98.89%) read pairs available; of these: 6776536 (60.37%) trimmed read pairs available after processing 4449182 (39.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 21 0.00% 20 12 0.00% 21 7 0.00% 22 14 0.00% 23 18 0.00% 24 17 0.00% 25 27 0.00% 26 32 0.00% 27 28 0.00% 28 17 0.00% 29 21 0.00% 30 20 0.00% 31 12 0.00% 32 14 0.00% 33 11 0.00% 34 10 0.00% 35 19 0.00% 36 18 0.00% 37 28 0.00% 38 18 0.00% 39 21 0.00% 40 19 0.00% 41 30 0.00% 42 41 0.00% 43 33 0.00% 44 46 0.00% 45 75 0.00% 46 59 0.00% 47 67 0.00% 48 71 0.00% 49 87 0.00% 50 116 0.00% 51 111 0.00% 52 136 0.00% 53 161 0.00% 54 141 0.00% 55 172 0.00% 56 142 0.00% 57 180 0.00% 58 201 0.00% 59 252 0.00% 60 292 0.00% 61 366 0.00% 62 350 0.00% 63 552 0.00% 64 298 0.00% 65 330 0.00% 66 372 0.00% 67 339 0.00% 68 397 0.00% 69 391 0.00% 70 499 0.00% 71 533 0.00% 72 676 0.01% 73 833 0.01% 74 978 0.01% 75 1489 0.01% 76 2744 0.02% 77 3255 0.03% 78 1789 0.02% 79 1458 0.01% 80 1532 0.01% 81 1715 0.02% 82 1889 0.02% 83 2146 0.02% 84 2993 0.03% 85 3477 0.03% 86 3561 0.03% 87 4014 0.04% 88 4251 0.04% 89 4355 0.04% 90 4434 0.04% 91 4687 0.04% 92 4807 0.04% 93 5281 0.05% 94 5543 0.05% 95 5902 0.05% 96 6086 0.05% 97 6421 0.06% 98 6777 0.06% 99 6941 0.06% 100 7367 0.07% 101 7889 0.07% 102 8518 0.08% 103 8961 0.08% 104 9545 0.09% 105 10031 0.09% 106 10784 0.10% 107 11229 0.10% 108 11728 0.10% 109 12467 0.11% 110 13049 0.12% 111 13521 0.12% 112 14178 0.13% 113 14846 0.13% 114 15446 0.14% 115 16773 0.15% 116 17065 0.15% 117 17650 0.16% 118 18778 0.17% 119 19506 0.17% 120 19895 0.18% 121 20877 0.19% 122 21725 0.19% 123 23267 0.21% 124 23804 0.21% 125 24787 0.22% 126 26533 0.24% 127 28104 0.25% 128 29539 0.26% 129 31088 0.28% 130 32717 0.29% 131 34474 0.31% 132 36501 0.33% 133 39228 0.35% 134 41609 0.37% 135 45589 0.41% 136 49380 0.44% 137 54406 0.48% 138 59568 0.53% 139 66195 0.59% 140 72559 0.65% 141 82524 0.74% 142 93655 0.83% 143 110625 0.99% 144 132079 1.18% 145 164738 1.47% 146 212504 1.89% 147 297623 2.65% 148 461292 4.11% 149 889745 7.93% 150 3183291 28.36% 151 4449182 39.63% 11225718 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=36 prefix-density=0.34 prefix-fanout=2.2 sequence=CCCTAACAGATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=81.35 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=TCAACAATTCTCGCCCGATTCAGCATCCGAATCCAGAAGCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=2.0 sequence=CGTCAAGTGCAGTGCATCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=43.65 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171079 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:00:15 Started mapping on | Feb 14 01:00:15 Finished on | Feb 14 01:01:41 Mapping speed, Million of reads per hour | 469.91 Number of input reads | 11225718 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10441466 Uniquely mapped reads % | 93.01% Average mapped length | 293.69 Number of splices: Total | 8687311 Number of splices: Annotated (sjdb) | 8492384 Number of splices: GT/AG | 8514064 Number of splices: GC/AG | 137608 Number of splices: AT/AC | 6631 Number of splices: Non-canonical | 29008 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.03% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285282 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 26624 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.11% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 514427 514427 514427 N_multimapping 285282 285282 285282 N_noFeature 342835 10175687 411676 N_ambiguous 263568 959 66356 UnstrandedReadsAssigned:9835063 PositiveStrandReadsAssigned:264820 NegativeStrandReadsAssigned:9963434 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171079-trimmed-pair1.fastq SRR7171079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,225,718 reads, 9,904,957 reads pseudoaligned [quant] estimated average fragment length: 234.254 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7171079.ke.tsv 34699 SRR7171079.se.tsv 87100 total ==> SRR7171079.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.75 363 15.2085 Potri.005G024800.1.v4.1 1035 801.746 208 19.3992 Potri.004G059700.1.v4.1 961 727.755 6 0.616486 Potri.007G009000.2.v4.1 1416 1182.75 0 0 Potri.003G141000.2.v4.1 2943 2709.75 469 12.942 Potri.016G087400.1.v4.1 270 75.8913 516 508.411 Potri.015G069301.1.v4.1 564 332.481 0 0 Potri.010G195200.1.v4.1 1773 1539.75 117 5.68191 Potri.012G127500.1.v4.1 977 743.755 196 19.7053 ==> SRR7171079.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 404 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 81 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 44 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7171079 completed mapping pipeline successfully