Starting /dee2/code/volunteer_pipeline.sh SRR7171080 current disk space = 3088990801920 free memory = 1578201084 SRR7171080 SRAfilesize f4184e41b9860f113d9b35705548a83f SRR7171080.sra SRR7171080.sra file validated SRR7171080 is paired end SRR7171080 is conventional basespace SRR7171080 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171080_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.5 18.0 18.0 25.0 18.0 32.0 2 29.74675 30.0 28.0 31.0 27.0 33.0 3 31.35475 33.0 31.0 33.0 29.0 33.0 4 32.17375 33.0 33.0 33.0 31.0 33.0 5 32.96925 33.0 33.0 34.0 32.0 34.0 6 37.01175 38.0 37.0 38.0 35.0 38.0 7 37.34075 38.0 38.0 38.0 37.0 38.0 8 37.51375 38.0 38.0 38.0 37.0 38.0 9 37.55375 38.0 38.0 38.0 37.0 38.0 10-14 37.4876 38.0 38.0 38.0 37.0 38.0 15-19 37.50260000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.3254 38.0 38.0 38.0 36.8 38.0 25-29 37.342349999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.3571 38.0 38.0 38.0 37.0 38.0 35-39 37.345800000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.26505 38.0 38.0 38.0 36.4 38.0 45-49 37.210350000000005 38.0 38.0 38.0 36.4 38.0 50-54 36.567750000000004 38.0 37.6 38.0 34.0 38.0 55-59 35.5933 38.0 35.6 38.0 29.2 38.0 60-64 36.83755 38.0 37.8 38.0 34.8 38.0 65-69 36.81685 38.0 38.0 38.0 35.0 38.0 70-74 36.623850000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.5745 38.0 38.0 38.0 34.0 38.0 80-84 36.4371 38.0 37.6 38.0 34.0 38.0 85-89 36.203250000000004 38.0 37.0 38.0 33.6 38.0 90-94 36.0575 38.0 37.0 38.0 33.2 38.0 95-99 35.977000000000004 38.0 37.0 38.0 32.6 38.0 100-104 35.934749999999994 38.0 37.0 38.0 32.6 38.0 105-109 35.7769 38.0 36.6 38.0 31.6 38.0 110-114 35.61415000000001 38.0 36.0 38.0 31.0 38.0 115-119 34.9245 38.0 35.4 38.0 27.8 38.0 120-124 34.91745 38.0 35.0 38.0 27.8 38.0 125-129 34.6861 38.0 35.0 38.0 27.4 38.0 130-134 31.99445 36.0 28.2 38.0 19.6 38.0 135-139 33.364850000000004 37.6 33.6 38.0 19.4 38.0 140-144 32.96205 37.6 33.0 38.0 15.0 38.0 145-149 31.83225 36.4 31.8 38.0 13.8 38.0 150-151 27.261499999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 4.0 16 2.0 17 0.0 18 2.0 19 10.0 20 1.0 21 5.0 22 7.0 23 15.0 24 11.0 25 15.0 26 18.0 27 27.0 28 34.0 29 37.0 30 45.0 31 77.0 32 109.0 33 160.0 34 308.0 35 593.0 36 1296.0 37 1221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.94784876140808 12.803129074315514 13.35071707953064 33.89830508474576 2 19.400000000000002 18.375 37.375 24.85 3 17.275 24.6 30.125 28.000000000000004 4 21.975 31.75 24.3 21.975 5 21.5 35.099999999999994 24.9 18.5 6 17.474999999999998 35.175 26.400000000000002 20.95 7 13.200000000000001 21.675 46.85 18.275 8 17.5 22.825 32.85 26.825 9 16.8 24.05 33.1 26.05 10-14 20.3 29.805 26.455000000000002 23.44 15-19 19.915 28.165000000000003 28.84 23.080000000000002 20-24 19.715 28.139999999999997 28.505000000000003 23.64 25-29 19.61 28.87 28.02 23.5 30-34 19.79 28.555000000000003 28.43 23.225 35-39 20.16 28.425 28.02 23.395 40-44 20.28 28.735 28.115000000000002 22.869999999999997 45-49 19.580000000000002 28.475 28.315 23.630000000000003 50-54 19.715 28.360000000000003 28.675 23.25 55-59 19.375 28.744999999999997 28.24 23.64 60-64 20.13 28.535 28.044999999999998 23.29 65-69 19.785 28.815 28.375 23.025000000000002 70-74 19.545 29.175 28.42 22.86 75-79 19.939999999999998 28.57 28.43 23.06 80-84 19.66 28.48 27.845 24.015 85-89 20.25 28.935 28.444999999999997 22.37 90-94 20.424999999999997 28.18 28.28 23.115 95-99 20.595 27.634999999999998 28.775000000000002 22.994999999999997 100-104 19.845 28.925 27.665 23.565 105-109 20.02 28.549999999999997 28.07 23.36 110-114 20.419999999999998 28.655 28.725 22.2 115-119 21.029999999999998 28.735 27.505000000000003 22.73 120-124 20.255000000000003 28.26 28.144999999999996 23.34 125-129 20.635 28.645 28.04 22.68 130-134 20.52 28.7 27.845 22.935 135-139 20.41 28.305000000000003 28.01 23.275000000000002 140-144 20.78 27.92 28.13 23.169999999999998 145-149 20.145 28.29 28.105000000000004 23.46 150-151 20.6875 29.099999999999998 27.3375 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.5 22 2.0 23 1.0 24 3.5 25 4.5 26 4.5 27 8.5 28 15.0 29 25.5 30 32.5 31 34.5 32 42.0 33 57.0 34 68.0 35 76.5 36 101.5 37 124.0 38 153.0 39 176.5 40 186.0 41 230.0 42 254.5 43 265.0 44 280.0 45 269.0 46 238.5 47 220.0 48 224.0 49 195.5 50 161.5 51 134.5 52 97.0 53 78.0 54 59.0 55 40.0 56 41.0 57 30.5 58 16.0 59 13.0 60 8.0 61 6.5 62 6.5 63 3.0 64 1.5 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39561823218332 98.675 2 0.528834046839587 1.05 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.3875 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATATCA 10 0.0068378756 144.95 9 >>END_MODULE SRR7171080 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171080_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.491 33.0 33.0 34.0 32.0 34.0 2 32.807 33.0 33.0 34.0 32.0 34.0 3 30.635 33.0 31.0 34.0 18.0 34.0 4 32.14675 33.0 32.0 34.0 28.0 34.0 5 32.69425 33.0 33.0 34.0 32.0 34.0 6 37.12725 38.0 38.0 38.0 36.0 38.0 7 37.09825 38.0 38.0 38.0 37.0 38.0 8 37.24425 38.0 38.0 38.0 37.0 38.0 9 37.35825 38.0 38.0 38.0 37.0 38.0 10-14 37.24055 38.0 38.0 38.0 37.0 38.0 15-19 37.2126 38.0 38.0 38.0 37.0 38.0 20-24 36.9754 38.0 38.0 38.0 36.4 38.0 25-29 36.84905 38.0 38.0 38.0 36.0 38.0 30-34 37.03035 38.0 38.0 38.0 37.0 38.0 35-39 37.1152 38.0 38.0 38.0 37.0 38.0 40-44 37.141000000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.097699999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.04075 38.0 38.0 38.0 36.8 38.0 55-59 37.0385 38.0 38.0 38.0 36.6 38.0 60-64 36.94935 38.0 38.0 38.0 36.0 38.0 65-69 36.961400000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.90585 38.0 38.0 38.0 36.0 38.0 75-79 36.81855 38.0 38.0 38.0 36.0 38.0 80-84 36.6252 38.0 38.0 38.0 35.4 38.0 85-89 36.56015 38.0 38.0 38.0 34.8 38.0 90-94 36.6049 38.0 38.0 38.0 35.0 38.0 95-99 36.54535 38.0 38.0 38.0 34.8 38.0 100-104 36.28745 38.0 38.0 38.0 34.0 38.0 105-109 36.0674 38.0 37.6 38.0 33.8 38.0 110-114 34.483999999999995 37.8 33.8 38.0 25.8 38.0 115-119 35.3674 38.0 36.2 38.0 29.8 38.0 120-124 35.573 38.0 36.8 38.0 31.0 38.0 125-129 35.326800000000006 38.0 36.0 38.0 30.6 38.0 130-134 35.117650000000005 38.0 35.8 38.0 29.4 38.0 135-139 34.78145 38.0 35.6 38.0 28.2 38.0 140-144 34.12865 38.0 33.4 38.0 24.8 38.0 145-149 33.346700000000006 38.0 33.0 38.0 21.0 38.0 150-151 28.085625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 2.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 4.0 15 1.0 16 4.0 17 4.0 18 3.0 19 3.0 20 8.0 21 4.0 22 2.0 23 6.0 24 9.0 25 17.0 26 15.0 27 27.0 28 21.0 29 32.0 30 38.0 31 66.0 32 80.0 33 80.0 34 174.0 35 310.0 36 748.0 37 2322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.25 20.525 11.700000000000001 25.525 2 24.275 26.825 32.775 16.125 3 20.200000000000003 29.349999999999998 31.275 19.175 4 22.925 35.025 23.45 18.6 5 23.45 37.225 22.5 16.825000000000003 6 19.5 38.5 24.55 17.45 7 19.2 18.95 41.525 20.325 8 19.900000000000002 25.974999999999998 29.075 25.05 9 22.975 24.85 28.275 23.9 10-14 22.770000000000003 29.445 26.905 20.880000000000003 15-19 22.375 28.565 28.49 20.57 20-24 22.994999999999997 28.860000000000003 28.07 20.075000000000003 25-29 22.384999999999998 28.854999999999997 28.015 20.745 30-34 22.900000000000002 27.800000000000004 28.265 21.035 35-39 22.485 28.63 28.185 20.7 40-44 22.61 28.310000000000002 28.115000000000002 20.965 45-49 22.185 28.73 28.175 20.91 50-54 22.35 28.235 28.599999999999998 20.815 55-59 22.85 27.66 28.46 21.029999999999998 60-64 22.759999999999998 28.665000000000003 27.96 20.615 65-69 22.765 27.525 28.58 21.13 70-74 22.45 28.544999999999998 28.144999999999996 20.86 75-79 22.830000000000002 28.4 27.650000000000002 21.12 80-84 22.305 28.485 28.425 20.785 85-89 23.26 27.589999999999996 28.835 20.315 90-94 22.63 28.12 28.48 20.77 95-99 22.875 28.23 28.189999999999998 20.705000000000002 100-104 23.125 27.985 28.34 20.549999999999997 105-109 23.275000000000002 28.32 28.065 20.34 110-114 22.95 28.34 28.435 20.275000000000002 115-119 23.605 27.765 28.749999999999996 19.88 120-124 22.84 27.915 28.28 20.965 125-129 22.93 27.96 28.610000000000003 20.5 130-134 23.13 28.49 28.139999999999997 20.24 135-139 23.205000000000002 28.310000000000002 28.63 19.855 140-144 22.745 28.384999999999998 28.044999999999998 20.825 145-149 23.965 27.98 27.975 20.080000000000002 150-151 23.625 28.1125 28.0625 20.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 4.0 25 4.5 26 5.0 27 8.5 28 13.5 29 17.0 30 17.0 31 16.5 32 26.0 33 45.5 34 61.5 35 76.5 36 99.0 37 116.5 38 142.0 39 178.5 40 210.0 41 234.5 42 273.5 43 291.5 44 288.5 45 289.5 46 279.5 47 246.5 48 203.5 49 177.0 50 153.5 51 122.0 52 91.5 53 74.0 54 60.5 55 46.0 56 34.5 57 25.5 58 15.5 59 12.5 60 9.5 61 7.5 62 6.0 63 4.5 64 2.0 65 0.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.4028197381671702 0.8 3 0.050352467270896276 0.15 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.5249999999999999 0.0 0.0 0.0 0.0 116-117 0.6625 0.0 0.0 0.0 0.0 118-119 0.7875 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 0.9125 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.1125 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.5 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138-139 1.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTTG 10 0.006830828 145.0 2 AGACCTT 10 0.006830828 145.0 3 >>END_MODULE Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622985 spots for SRR7171080.sra Written 622985 spots for SRR7171080.sra Read 622988 spots for SRR7171080.sra Written 622988 spots for SRR7171080.sra SRR ids: ['SRR7171080.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qgi0iqdo SRR7171080.sra spots: 12459703 blocks: [[1, 622985], [622986, 1245970], [1245971, 1868955], [1868956, 2491940], [2491941, 3114925], [3114926, 3737910], [3737911, 4360895], [4360896, 4983880], [4983881, 5606865], [5606866, 6229850], [6229851, 6852835], [6852836, 7475820], [7475821, 8098805], [8098806, 8721790], [8721791, 9344775], [9344776, 9967760], [9967761, 10590745], [10590746, 11213730], [11213731, 11836715], [11836716, 12459703]] SRR7171080 file size 4200484 SRR7171080 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171080 SRR7171080_1.fastq SRR7171080_2.fastq Input file: SRR7171080_1.fastq Paired file: SRR7171080_2.fastq trimmed: SRR7171080-trimmed-pair1.fastq, SRR7171080-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:21:30 2025 >> started Fri Feb 14 01:21:43 2025 >> done (13.601s) 12459703 read pairs processed; of these: 11666 ( 0.09%) short read pairs filtered out after trimming by size control 22290 ( 0.18%) empty read pairs filtered out after trimming by size control 12425747 (99.73%) read pairs available; of these: 6792365 (54.66%) trimmed read pairs available after processing 5633382 (45.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 6 0.00% 21 9 0.00% 22 5 0.00% 23 10 0.00% 24 6 0.00% 25 8 0.00% 26 13 0.00% 27 8 0.00% 28 4 0.00% 29 10 0.00% 30 9 0.00% 31 9 0.00% 32 7 0.00% 33 4 0.00% 34 11 0.00% 35 11 0.00% 36 5 0.00% 37 5 0.00% 38 7 0.00% 39 14 0.00% 40 16 0.00% 41 13 0.00% 42 5 0.00% 43 10 0.00% 44 15 0.00% 45 13 0.00% 46 21 0.00% 47 20 0.00% 48 24 0.00% 49 24 0.00% 50 33 0.00% 51 25 0.00% 52 32 0.00% 53 45 0.00% 54 31 0.00% 55 42 0.00% 56 36 0.00% 57 52 0.00% 58 67 0.00% 59 59 0.00% 60 69 0.00% 61 82 0.00% 62 83 0.00% 63 91 0.00% 64 102 0.00% 65 102 0.00% 66 94 0.00% 67 134 0.00% 68 157 0.00% 69 150 0.00% 70 197 0.00% 71 202 0.00% 72 228 0.00% 73 254 0.00% 74 278 0.00% 75 330 0.00% 76 369 0.00% 77 396 0.00% 78 411 0.00% 79 448 0.00% 80 543 0.00% 81 564 0.00% 82 676 0.01% 83 864 0.01% 84 1291 0.01% 85 1670 0.01% 86 1821 0.01% 87 1996 0.02% 88 2023 0.02% 89 2062 0.02% 90 2123 0.02% 91 2258 0.02% 92 2287 0.02% 93 2417 0.02% 94 2558 0.02% 95 2800 0.02% 96 2935 0.02% 97 3044 0.02% 98 3153 0.03% 99 3332 0.03% 100 3556 0.03% 101 3599 0.03% 102 4021 0.03% 103 4206 0.03% 104 4524 0.04% 105 4747 0.04% 106 5081 0.04% 107 5407 0.04% 108 5679 0.05% 109 6160 0.05% 110 6356 0.05% 111 6708 0.05% 112 7249 0.06% 113 7600 0.06% 114 8034 0.06% 115 8609 0.07% 116 9000 0.07% 117 9262 0.07% 118 9710 0.08% 119 10194 0.08% 120 10950 0.09% 121 11524 0.09% 122 12173 0.10% 123 13135 0.11% 124 13876 0.11% 125 14723 0.12% 126 15910 0.13% 127 16660 0.13% 128 17966 0.14% 129 19276 0.16% 130 20723 0.17% 131 22061 0.18% 132 24261 0.20% 133 26256 0.21% 134 28859 0.23% 135 32057 0.26% 136 35786 0.29% 137 40178 0.32% 138 45001 0.36% 139 51192 0.41% 140 58615 0.47% 141 68931 0.55% 142 82643 0.67% 143 100590 0.81% 144 126056 1.01% 145 162065 1.30% 146 213849 1.72% 147 309012 2.49% 148 492154 3.96% 149 978713 7.88% 150 3552120 28.59% 151 5633382 45.34% 12425747 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=16.50 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=23 prefix-density=0.48 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=101.33 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.6 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171080 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:22:27 Started mapping on | Feb 14 01:22:28 Finished on | Feb 14 01:23:46 Mapping speed, Million of reads per hour | 573.50 Number of input reads | 12425747 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 11615542 Uniquely mapped reads % | 93.48% Average mapped length | 296.20 Number of splices: Total | 11663972 Number of splices: Annotated (sjdb) | 11390345 Number of splices: GT/AG | 11449963 Number of splices: GC/AG | 169181 Number of splices: AT/AC | 6980 Number of splices: Non-canonical | 37848 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341459 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 58048 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 480995 480995 480995 N_multimapping 341459 341459 341459 N_noFeature 464635 11458747 509572 N_ambiguous 210999 691 98869 UnstrandedReadsAssigned:10939908 PositiveStrandReadsAssigned:156104 NegativeStrandReadsAssigned:11007101 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171080 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171080-trimmed-pair1.fastq SRR7171080-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,425,747 reads, 10,946,319 reads pseudoaligned [quant] estimated average fragment length: 278.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR7171080.ke.tsv 34699 SRR7171080.se.tsv 87100 total ==> SRR7171080.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.56 1126 52.0376 Potri.005G024800.1.v4.1 1035 757.556 254 26.9703 Potri.004G059700.1.v4.1 961 683.561 7 0.823734 Potri.007G009000.2.v4.1 1416 1138.56 0 0 Potri.003G141000.2.v4.1 2943 2665.56 692.906 20.9099 Potri.016G087400.1.v4.1 270 60.2931 718.797 958.971 Potri.015G069301.1.v4.1 564 291.782 0 0 Potri.010G195200.1.v4.1 1773 1495.56 202 10.8646 Potri.012G127500.1.v4.1 977 699.561 63 7.24405 ==> SRR7171080.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 353 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 92 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR7171080 completed mapping pipeline successfully