Starting /dee2/code/volunteer_pipeline.sh SRR7171081 current disk space = 3089062969344 free memory = 1554068008 SRR7171081 SRAfilesize 20d25969245f4e78aea230a9c1c0f388 SRR7171081.sra SRR7171081.sra file validated SRR7171081 is paired end SRR7171081 is conventional basespace SRR7171081 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.86625 18.0 18.0 25.0 18.0 32.0 2 28.00725 29.0 27.0 31.0 18.0 33.0 3 30.2835 31.0 29.0 33.0 27.0 33.0 4 31.96825 33.0 31.0 33.0 29.0 33.0 5 32.423 33.0 33.0 33.0 31.0 34.0 6 36.32 38.0 36.0 38.0 34.0 38.0 7 36.91025 38.0 37.0 38.0 35.0 38.0 8 37.3305 38.0 38.0 38.0 37.0 38.0 9 35.758 38.0 38.0 38.0 29.0 38.0 10-14 37.38275 38.0 38.0 38.0 36.6 38.0 15-19 37.54965 38.0 38.0 38.0 38.0 38.0 20-24 37.61925 38.0 38.0 38.0 38.0 38.0 25-29 37.581399999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5614 38.0 38.0 38.0 38.0 38.0 35-39 37.52325 38.0 38.0 38.0 38.0 38.0 40-44 37.50665 38.0 38.0 38.0 37.6 38.0 45-49 37.40495 38.0 38.0 38.0 37.4 38.0 50-54 36.14469999999999 38.0 36.4 38.0 31.0 38.0 55-59 37.225849999999994 38.0 38.0 38.0 36.8 38.0 60-64 37.27845 38.0 38.0 38.0 37.0 38.0 65-69 37.2381 38.0 38.0 38.0 36.6 38.0 70-74 37.24305 38.0 38.0 38.0 37.0 38.0 75-79 37.13725 38.0 38.0 38.0 36.4 38.0 80-84 36.42895 38.0 37.8 38.0 33.4 38.0 85-89 36.800349999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.7676 38.0 38.0 38.0 35.4 38.0 95-99 36.81045 38.0 38.0 38.0 35.2 38.0 100-104 36.716899999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.6988 38.0 38.0 38.0 34.8 38.0 110-114 36.322050000000004 38.0 37.8 38.0 34.0 38.0 115-119 36.15464999999999 38.0 37.4 38.0 33.6 38.0 120-124 36.058600000000006 38.0 37.4 38.0 33.4 38.0 125-129 35.7769 38.0 36.8 38.0 31.4 38.0 130-134 34.08435 38.0 33.6 38.0 24.4 38.0 135-139 34.989799999999995 38.0 36.0 38.0 30.4 38.0 140-144 34.5771 38.0 35.6 38.0 27.4 38.0 145-149 33.716750000000005 38.0 33.4 38.0 22.8 38.0 150-151 28.131999999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 3.0 14 2.0 15 0.0 16 0.0 17 1.0 18 2.0 19 5.0 20 4.0 21 6.0 22 5.0 23 5.0 24 4.0 25 10.0 26 14.0 27 17.0 28 18.0 29 29.0 30 41.0 31 29.0 32 73.0 33 95.0 34 191.0 35 307.0 36 1071.0 37 2064.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.1889035667107 16.697490092470275 9.431968295904888 32.68163804491414 2 18.925 19.125 36.375 25.575 3 18.575 25.25 29.325000000000003 26.85 4 23.3 31.674999999999997 22.400000000000002 22.625 5 20.005001250312578 37.109277319329834 24.656164041010253 18.229557389347338 6 17.724999999999998 37.525 25.474999999999998 19.275000000000002 7 14.95 21.95 44.925 18.175 8 16.475 22.625 32.775 28.125 9 16.975 25.4 31.0 26.625 10-14 20.66 29.709999999999997 26.355 23.275000000000002 15-19 19.759999999999998 28.689999999999998 27.810000000000002 23.74 20-24 20.485 28.93 27.725 22.86 25-29 20.119999999999997 29.015 27.6 23.265 30-34 19.545 29.125 28.07 23.26 35-39 20.8 28.365000000000002 27.71 23.125 40-44 20.075000000000003 29.56 27.275 23.09 45-49 20.315 28.610000000000003 27.825 23.25 50-54 20.52 28.93 27.33 23.22 55-59 20.46 28.015 27.810000000000002 23.715 60-64 20.235 28.999999999999996 27.089999999999996 23.674999999999997 65-69 20.195 28.84 27.589999999999996 23.375 70-74 21.205 28.23 27.255000000000003 23.31 75-79 20.655 28.93 27.439999999999998 22.975 80-84 21.065 28.555000000000003 27.175 23.205000000000002 85-89 21.015 28.015 27.48 23.49 90-94 21.38 28.000000000000004 27.334999999999997 23.285 95-99 21.68 28.515 26.765 23.04 100-104 21.205 28.985 27.015 22.795 105-109 21.18 28.544999999999998 27.065 23.21 110-114 21.015 28.455000000000002 26.765 23.765 115-119 21.5 28.99 26.235000000000003 23.275000000000002 120-124 21.25 29.060000000000002 26.58 23.11 125-129 21.335 28.335 26.650000000000002 23.68 130-134 21.365000000000002 28.54 26.25 23.845 135-139 20.945 28.945 26.5 23.61 140-144 21.245 28.375 26.275 24.104999999999997 145-149 21.285 28.87 25.905 23.94 150-151 21.277395115842204 28.152786474639953 26.574827802128993 23.994990607388857 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 2.0 25 2.5 26 5.0 27 7.0 28 12.0 29 20.5 30 28.5 31 33.0 32 38.0 33 46.5 34 61.5 35 80.0 36 90.5 37 117.5 38 149.0 39 173.0 40 201.5 41 206.5 42 217.0 43 232.5 44 239.5 45 248.5 46 249.0 47 245.5 48 224.0 49 207.5 50 186.0 51 142.5 52 111.5 53 93.5 54 83.0 55 68.5 56 48.5 57 37.5 58 28.5 59 20.5 60 15.0 61 7.5 62 4.5 63 3.0 64 1.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.375 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.6375 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.3375 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.25 0.0 0.0 0.0 0.0 108-109 3.6625 0.0 0.0 0.0 0.0 110-111 4.075 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 4.987500000000001 0.0 0.0 0.0 0.0 116-117 5.45 0.0 0.0 0.0 0.0 118-119 5.9875 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.125 0.0 0.0 0.0 0.0 124-125 7.675000000000001 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.8 0.0 0.0 0.0 0.0 130-131 9.525 0.0 0.0 0.0 0.0 132-133 10.175 0.0 0.0 0.0 0.0 134-135 10.7375 0.0 0.0 0.0 0.0 136-137 11.225 0.0 0.0 0.0 0.0 138-139 11.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGCGA 10 0.0068378756 144.95 145 CTTTAAA 10 0.0068378756 144.95 5 >>END_MODULE SRR7171081 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.25075 33.0 32.0 34.0 28.0 34.0 2 29.949 33.0 27.0 34.0 18.0 34.0 3 31.8815 33.0 32.0 34.0 27.0 34.0 4 32.4215 33.0 33.0 34.0 32.0 34.0 5 32.69775 33.0 33.0 34.0 32.0 34.0 6 36.8985 38.0 38.0 38.0 36.0 38.0 7 37.01375 38.0 38.0 38.0 37.0 38.0 8 37.08125 38.0 38.0 38.0 37.0 38.0 9 37.1155 38.0 38.0 38.0 37.0 38.0 10-14 37.00875 38.0 38.0 38.0 36.8 38.0 15-19 37.02285 38.0 38.0 38.0 37.0 38.0 20-24 36.069500000000005 38.0 37.6 38.0 30.4 38.0 25-29 36.741949999999996 38.0 37.8 38.0 35.0 38.0 30-34 37.00635 38.0 38.0 38.0 37.0 38.0 35-39 37.0175 38.0 38.0 38.0 37.0 38.0 40-44 36.8745 38.0 38.0 38.0 36.8 38.0 45-49 36.4111 38.0 38.0 38.0 34.2 38.0 50-54 36.8018 38.0 38.0 38.0 36.2 38.0 55-59 36.716300000000004 38.0 38.0 38.0 36.0 38.0 60-64 35.8225 38.0 37.0 38.0 30.2 38.0 65-69 36.63875 38.0 38.0 38.0 35.6 38.0 70-74 36.565549999999995 38.0 38.0 38.0 35.4 38.0 75-79 36.5381 38.0 38.0 38.0 35.0 38.0 80-84 34.7635 37.8 34.2 38.0 28.8 38.0 85-89 36.147299999999994 38.0 37.8 38.0 33.8 38.0 90-94 36.2876 38.0 38.0 38.0 34.0 38.0 95-99 36.19675 38.0 38.0 38.0 34.4 38.0 100-104 35.979499999999994 38.0 38.0 38.0 33.6 38.0 105-109 35.1072 38.0 36.6 38.0 28.4 38.0 110-114 34.380849999999995 38.0 35.0 38.0 24.4 38.0 115-119 35.3369 38.0 37.0 38.0 31.0 38.0 120-124 35.09425 38.0 36.4 38.0 29.8 38.0 125-129 34.78465 38.0 36.0 38.0 28.2 38.0 130-134 34.37375 38.0 35.8 38.0 26.6 38.0 135-139 33.7148 38.0 33.8 38.0 22.0 38.0 140-144 32.831100000000006 38.0 33.0 38.0 16.0 38.0 145-149 31.676849999999995 38.0 32.6 38.0 8.2 38.0 150-151 25.105375 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 11.0 4 4.0 5 4.0 6 1.0 7 3.0 8 0.0 9 2.0 10 4.0 11 3.0 12 3.0 13 1.0 14 3.0 15 4.0 16 4.0 17 6.0 18 4.0 19 6.0 20 11.0 21 9.0 22 6.0 23 11.0 24 16.0 25 16.0 26 19.0 27 31.0 28 17.0 29 30.0 30 51.0 31 83.0 32 95.0 33 107.0 34 225.0 35 362.0 36 922.0 37 1913.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.15 18.85 12.25 25.75 2 24.0 24.0 35.4 16.6 3 20.4352176088044 27.213606803401703 31.94097048524262 20.410205102551277 4 24.125 33.925 21.575 20.375 5 24.474999999999998 37.15 22.125 16.25 6 19.650000000000002 37.05 23.549999999999997 19.75 7 18.9 19.0 39.95 22.15 8 20.349999999999998 24.65 28.675 26.325 9 22.35 22.95 30.0 24.7 10-14 23.52 28.27 26.88 21.33 15-19 22.79 28.18 28.000000000000004 21.029999999999998 20-24 22.685 28.165000000000003 28.04 21.11 25-29 23.225 28.405 27.765 20.605 30-34 22.93 27.755000000000003 28.035 21.279999999999998 35-39 22.435 28.055000000000003 28.235 21.275 40-44 23.135 27.474999999999998 28.43 20.96 45-49 23.285 27.675 27.93 21.11 50-54 22.925 28.285 27.615000000000002 21.175 55-59 23.03 27.169999999999998 28.060000000000002 21.740000000000002 60-64 23.244999999999997 27.575 28.02 21.16 65-69 23.305 27.200000000000003 27.98 21.515 70-74 23.365 27.73 27.87 21.035 75-79 23.075000000000003 28.025 27.68 21.22 80-84 23.189999999999998 27.79 27.93 21.09 85-89 23.61 27.765 27.639999999999997 20.985 90-94 23.185 27.91 27.88 21.025 95-99 23.400000000000002 27.689999999999998 28.175 20.735 100-104 23.61 27.889999999999997 27.325 21.175 105-109 23.189999999999998 28.57 27.52 20.72 110-114 23.305 28.605000000000004 27.785 20.305 115-119 24.46 27.750000000000004 27.1 20.69 120-124 24.81 27.560000000000002 27.305 20.325 125-129 24.255 27.67 27.72 20.355 130-134 25.085 27.339999999999996 27.435 20.14 135-139 24.955 26.735 27.63 20.68 140-144 24.87 27.79 27.474999999999998 19.865 145-149 25.885 26.805 27.375 19.935 150-151 26.424546023794615 27.889793362554787 26.66249217282404 19.02316844082655 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 3.0 24 2.5 25 2.5 26 5.0 27 7.0 28 10.0 29 15.5 30 19.0 31 22.5 32 30.5 33 43.5 34 51.5 35 63.0 36 82.5 37 110.0 38 149.0 39 168.0 40 180.0 41 197.0 42 228.0 43 247.5 44 245.5 45 245.0 46 253.5 47 269.5 48 239.5 49 205.0 50 179.5 51 139.0 52 117.0 53 113.5 54 94.5 55 68.5 56 54.0 57 35.5 58 21.5 59 19.5 60 16.0 61 10.0 62 10.5 63 8.5 64 5.5 65 3.0 66 0.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6547469151347267 1.3 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.6375 0.0 0.0 0.0 0.0 98-99 1.9249999999999998 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.7125000000000004 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.5875 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 4.95 0.0 0.0 0.0 0.0 116-117 5.375 0.0 0.0 0.0 0.0 118-119 5.9 0.0 0.0 0.0 0.0 120-121 6.475 0.0 0.0 0.0 0.0 122-123 7.05 0.0 0.0 0.0 0.0 124-125 7.6125 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.8125 0.0 0.0 0.0 0.0 130-131 9.5875 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 10.787500000000001 0.0 0.0 0.0 0.0 136-137 11.275 0.0 0.0 0.0 0.0 138-139 11.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATGC 10 0.006830828 145.0 4 ATAGAGG 10 0.006830828 145.0 6 TATAGAG 10 0.006830828 145.0 5 >>END_MODULE Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969560 spots for SRR7171081.sra Written 969560 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra Read 969552 spots for SRR7171081.sra Written 969552 spots for SRR7171081.sra SRR ids: ['SRR7171081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k0hlj5_u SRR7171081.sra spots: 19391048 blocks: [[1, 969552], [969553, 1939104], [1939105, 2908656], [2908657, 3878208], [3878209, 4847760], [4847761, 5817312], [5817313, 6786864], [6786865, 7756416], [7756417, 8725968], [8725969, 9695520], [9695521, 10665072], [10665073, 11634624], [11634625, 12604176], [12604177, 13573728], [13573729, 14543280], [14543281, 15512832], [15512833, 16482384], [16482385, 17451936], [17451937, 18421488], [18421489, 19391048]] SRR7171081 file size 6549289 SRR7171081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171081 SRR7171081_1.fastq SRR7171081_2.fastq Input file: SRR7171081_1.fastq Paired file: SRR7171081_2.fastq trimmed: SRR7171081-trimmed-pair1.fastq, SRR7171081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:08:01 2025 >> started Fri Feb 14 01:08:33 2025 >> done (31.802s) 19391048 read pairs processed; of these: 26162 ( 0.13%) short read pairs filtered out after trimming by size control 49949 ( 0.26%) empty read pairs filtered out after trimming by size control 19314937 (99.61%) read pairs available; of these: 11724904 (60.70%) trimmed read pairs available after processing 7590033 (39.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 16 0.00% 21 13 0.00% 22 20 0.00% 23 15 0.00% 24 19 0.00% 25 13 0.00% 26 18 0.00% 27 23 0.00% 28 24 0.00% 29 23 0.00% 30 26 0.00% 31 35 0.00% 32 38 0.00% 33 44 0.00% 34 46 0.00% 35 47 0.00% 36 40 0.00% 37 48 0.00% 38 50 0.00% 39 73 0.00% 40 80 0.00% 41 99 0.00% 42 93 0.00% 43 132 0.00% 44 118 0.00% 45 151 0.00% 46 156 0.00% 47 191 0.00% 48 212 0.00% 49 236 0.00% 50 302 0.00% 51 337 0.00% 52 354 0.00% 53 378 0.00% 54 406 0.00% 55 499 0.00% 56 515 0.00% 57 582 0.00% 58 661 0.00% 59 778 0.00% 60 860 0.00% 61 1017 0.01% 62 1124 0.01% 63 1247 0.01% 64 1339 0.01% 65 1519 0.01% 66 1627 0.01% 67 1710 0.01% 68 1887 0.01% 69 2276 0.01% 70 2584 0.01% 71 2938 0.02% 72 3427 0.02% 73 3792 0.02% 74 4244 0.02% 75 5022 0.03% 76 7090 0.04% 77 7300 0.04% 78 6193 0.03% 79 6661 0.03% 80 7280 0.04% 81 8296 0.04% 82 9311 0.05% 83 10391 0.05% 84 12781 0.07% 85 13957 0.07% 86 14730 0.08% 87 15555 0.08% 88 16817 0.09% 89 17522 0.09% 90 18920 0.10% 91 20327 0.11% 92 21735 0.11% 93 23537 0.12% 94 25271 0.13% 95 26540 0.14% 96 27296 0.14% 97 28106 0.15% 98 29101 0.15% 99 30339 0.16% 100 32073 0.17% 101 33461 0.17% 102 35486 0.18% 103 37463 0.19% 104 39309 0.20% 105 41429 0.21% 106 42165 0.22% 107 43556 0.23% 108 44377 0.23% 109 45429 0.24% 110 46054 0.24% 111 47905 0.25% 112 49866 0.26% 113 52254 0.27% 114 53864 0.28% 115 56278 0.29% 116 57189 0.30% 117 58172 0.30% 118 59236 0.31% 119 59708 0.31% 120 61386 0.32% 121 63296 0.33% 122 65280 0.34% 123 68112 0.35% 124 70587 0.37% 125 72003 0.37% 126 75313 0.39% 127 77150 0.40% 128 78644 0.41% 129 81341 0.42% 130 83088 0.43% 131 84554 0.44% 132 88738 0.46% 133 93636 0.48% 134 98060 0.51% 135 105082 0.54% 136 110946 0.57% 137 116845 0.60% 138 123062 0.64% 139 131341 0.68% 140 139300 0.72% 141 150269 0.78% 142 165202 0.86% 143 182315 0.94% 144 206605 1.07% 145 241619 1.25% 146 297368 1.54% 147 391119 2.02% 148 579377 3.00% 149 1130100 5.85% 150 5109288 26.45% 151 7590033 39.30% 19314937 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=14 prefix-density=0.62 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=24 fanout-score=31.62 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=11.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.71 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=54.70 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7171081 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:09:15 Started mapping on | Feb 14 01:09:16 Finished on | Feb 14 01:11:25 Mapping speed, Million of reads per hour | 539.02 Number of input reads | 19314937 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17984527 Uniquely mapped reads % | 93.11% Average mapped length | 288.83 Number of splices: Total | 16351824 Number of splices: Annotated (sjdb) | 15995621 Number of splices: GT/AG | 16011776 Number of splices: GC/AG | 280603 Number of splices: AT/AC | 10212 Number of splices: Non-canonical | 49233 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525003 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 148952 % of reads mapped to too many loci | 0.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 834268 834268 834268 N_multimapping 525003 525003 525003 N_noFeature 754524 17685730 875817 N_ambiguous 301570 1331 123250 UnstrandedReadsAssigned:16928433 PositiveStrandReadsAssigned:297466 NegativeStrandReadsAssigned:16985460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171081-trimmed-pair1.fastq SRR7171081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,314,937 reads, 17,079,449 reads pseudoaligned [quant] estimated average fragment length: 218.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7171081.ke.tsv 34699 SRR7171081.se.tsv 87100 total ==> SRR7171081.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.57 694 21.1285 Potri.005G024800.1.v4.1 1035 817.569 161 10.7949 Potri.004G059700.1.v4.1 961 743.58 16 1.17954 Potri.007G009000.2.v4.1 1416 1198.57 1 0.0457357 Potri.003G141000.2.v4.1 2943 2725.57 980.038 19.7108 Potri.016G087400.1.v4.1 270 91.4699 1042 624.465 Potri.015G069301.1.v4.1 564 349.97 0 0 Potri.010G195200.1.v4.1 1773 1555.57 8 0.281916 Potri.012G127500.1.v4.1 977 759.58 72 5.1961 ==> SRR7171081.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1115 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 372 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171081 completed mapping pipeline successfully