Starting /dee2/code/volunteer_pipeline.sh SRR7171082 current disk space = 3088881430528 free memory = 1581645504 SRR7171082 SRAfilesize 97d9c2668965c99d19e4fb26961df394 SRR7171082.sra SRR7171082.sra file validated SRR7171082 is paired end SRR7171082 is conventional basespace SRR7171082 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.01725 25.0 18.0 31.0 18.0 32.0 2 31.03075 31.0 30.0 33.0 27.0 33.0 3 31.8495 33.0 31.0 33.0 29.0 33.0 4 32.2275 33.0 33.0 33.0 31.0 34.0 5 32.84525 33.0 33.0 34.0 31.0 34.0 6 36.84175 38.0 37.0 38.0 35.0 38.0 7 37.1175 38.0 38.0 38.0 36.0 38.0 8 37.3605 38.0 38.0 38.0 37.0 38.0 9 36.47075 38.0 38.0 38.0 35.0 38.0 10-14 37.3435 38.0 38.0 38.0 36.6 38.0 15-19 37.464200000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.42845 38.0 38.0 38.0 37.4 38.0 25-29 37.4221 38.0 38.0 38.0 37.4 38.0 30-34 37.402 38.0 38.0 38.0 37.4 38.0 35-39 37.338 38.0 38.0 38.0 37.0 38.0 40-44 37.267900000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.892399999999995 38.0 37.8 38.0 35.4 38.0 50-54 35.95195 38.0 36.6 38.0 30.0 38.0 55-59 37.05965 38.0 38.0 38.0 36.2 38.0 60-64 37.035650000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.94785 38.0 38.0 38.0 36.0 38.0 70-74 36.924350000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.6782 38.0 38.0 38.0 35.6 38.0 80-84 36.015600000000006 38.0 37.8 38.0 32.4 38.0 85-89 36.231350000000006 38.0 37.8 38.0 34.0 38.0 90-94 36.3404 38.0 38.0 38.0 34.0 38.0 95-99 36.27645 38.0 38.0 38.0 34.0 38.0 100-104 36.136399999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.1346 38.0 38.0 38.0 34.0 38.0 110-114 35.7235 38.0 37.0 38.0 32.0 38.0 115-119 35.5266 38.0 37.0 38.0 31.0 38.0 120-124 35.31285 38.0 36.4 38.0 30.2 38.0 125-129 34.9849 38.0 36.0 38.0 28.6 38.0 130-134 33.924099999999996 38.0 33.4 38.0 22.8 38.0 135-139 34.2012 38.0 34.0 38.0 25.4 38.0 140-144 33.67529999999999 38.0 33.0 38.0 21.8 38.0 145-149 32.66245 38.0 33.0 38.0 14.0 38.0 150-151 26.823 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 2.0 10 4.0 11 1.0 12 1.0 13 2.0 14 0.0 15 2.0 16 3.0 17 6.0 18 9.0 19 18.0 20 3.0 21 5.0 22 8.0 23 7.0 24 11.0 25 14.0 26 11.0 27 14.0 28 23.0 29 28.0 30 36.0 31 59.0 32 70.0 33 115.0 34 203.0 35 348.0 36 1029.0 37 1957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.189863648057628 16.439413429379986 6.7404167738615905 50.6303061487008 2 13.053263315828959 16.90422605651413 52.288072018004506 17.75443860965241 3 12.45 21.5 33.074999999999996 32.975 4 18.25 29.525000000000002 27.200000000000003 25.025 5 19.294294294294296 34.18418418418418 28.07807807807808 18.443443443443446 6 15.85 36.55 28.349999999999998 19.25 7 12.425 25.15 44.775 17.65 8 13.725000000000001 26.450000000000003 35.825 24.0 9 14.45 23.575 35.875 26.1 10-14 18.435000000000002 30.580000000000002 27.750000000000004 23.235 15-19 17.935000000000002 30.0 27.93 24.135 20-24 19.39 29.630000000000003 27.384999999999998 23.595 25-29 18.785 29.154999999999998 28.58 23.48 30-34 19.02 29.310000000000002 27.810000000000002 23.86 35-39 18.990000000000002 29.609999999999996 28.265 23.135 40-44 19.155957797889894 30.191509575478776 27.1863593179659 23.466173308665432 45-49 19.48 29.48 27.51 23.53 50-54 19.54 29.645 27.63 23.185 55-59 19.040000000000003 29.854999999999997 27.77 23.335 60-64 19.67 29.785 26.87 23.674999999999997 65-69 20.1 29.744999999999997 27.474999999999998 22.68 70-74 19.13 30.035 27.35 23.485 75-79 19.38 29.525000000000002 27.57 23.525 80-84 19.57 29.315 27.055 24.060000000000002 85-89 19.35 29.685 27.345000000000002 23.62 90-94 20.09 29.21 27.04 23.66 95-99 20.215 29.275000000000002 27.05 23.46 100-104 20.695 28.96 26.724999999999998 23.62 105-109 19.994999999999997 29.354999999999997 26.965 23.685000000000002 110-114 20.47 28.799999999999997 26.900000000000002 23.830000000000002 115-119 20.424999999999997 29.005 27.005000000000003 23.565 120-124 20.995 28.525 26.595000000000002 23.885 125-129 20.835 29.21 25.900000000000002 24.055 130-134 20.485 28.465 26.450000000000003 24.6 135-139 21.005 27.950000000000003 26.19 24.855 140-144 20.52 27.91 26.314999999999998 25.255 145-149 20.215 27.400000000000002 26.729999999999997 25.655 150-151 19.792188282423638 27.45368052078117 26.514772158237353 26.239359038557836 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 1.5 6 1.0 7 1.0 8 1.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 3.5 22 4.0 23 3.0 24 4.5 25 5.0 26 6.5 27 12.0 28 19.0 29 23.0 30 32.5 31 55.0 32 64.5 33 80.0 34 102.0 35 118.0 36 133.5 37 137.5 38 159.5 39 178.5 40 192.5 41 217.0 42 224.0 43 236.5 44 241.5 45 222.5 46 205.0 47 211.0 48 199.5 49 169.0 50 147.5 51 116.0 52 93.0 53 87.5 54 82.0 55 64.0 56 49.5 57 34.0 58 17.5 59 9.5 60 8.5 61 9.0 62 5.5 63 1.5 64 0.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.825 2 0.025 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22758797842282 95.6 2 1.4384793218597483 2.8000000000000003 3 0.10274852298998202 0.3 4 0.12843565373747753 0.5 5 0.07706139224248652 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025687130747495505 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 8 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit ATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.2375 0.0 0.0 0.0 0.0 70-71 0.2875 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.7125 0.0 0.0 0.0 0.0 82-83 0.8500000000000001 0.0 0.0 0.0 0.0 84-85 1.025 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.5625 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.05 0.0 0.0 0.0 0.0 94-95 2.3875 0.0 0.0 0.0 0.0 96-97 2.8375000000000004 0.0 0.0 0.0 0.0 98-99 3.4125 0.0 0.0 0.0 0.0 100-101 3.7750000000000004 0.0 0.0 0.0 0.0 102-103 4.262499999999999 0.0 0.0 0.0 0.0 104-105 4.9625 0.0 0.0 0.0 0.0 106-107 5.6375 0.0 0.0 0.0 0.0 108-109 6.237500000000001 0.0 0.0 0.0 0.0 110-111 6.85 0.0 0.0 0.0 0.0 112-113 7.5375 0.0 0.0 0.0 0.0 114-115 8.4125 0.0 0.0 0.0 0.0 116-117 9.4375 0.0 0.0 0.0 0.0 118-119 10.3 0.0 0.0 0.0 0.0 120-121 11.0375 0.0 0.0 0.0 0.0 122-123 11.775 0.0 0.0 0.0 0.0 124-125 12.7125 0.0 0.0 0.0 0.0 126-127 13.5125 0.0 0.0 0.0 0.0 128-129 14.350000000000001 0.0 0.0 0.0 0.0 130-131 14.962499999999999 0.0 0.0 0.0 0.0 132-133 15.8 0.0 0.0 0.0 0.0 134-135 16.6625 0.0 0.0 0.0 0.0 136-137 17.725 0.0 0.0 0.0 0.0 138-139 18.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTAAA 10 0.0068343505 144.975 6 TTTAAAA 10 0.0068343505 144.975 7 GTCTGAA 80 0.0020157364 12.685313 140-144 CACACGT 85 0.003177497 11.939117 135-139 >>END_MODULE SRR7171082 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.642 33.0 33.0 34.0 32.0 34.0 2 31.23925 33.0 32.0 34.0 18.0 34.0 3 32.424 33.0 33.0 34.0 28.0 34.0 4 32.80025 33.0 33.0 34.0 32.0 34.0 5 32.97875 33.0 33.0 34.0 32.0 34.0 6 37.257 38.0 38.0 38.0 37.0 38.0 7 37.35 38.0 38.0 38.0 37.0 38.0 8 37.33675 38.0 38.0 38.0 37.0 38.0 9 37.25975 38.0 38.0 38.0 37.0 38.0 10-14 37.26735 38.0 38.0 38.0 37.0 38.0 15-19 37.28529999999999 38.0 38.0 38.0 37.0 38.0 20-24 36.26435000000001 38.0 37.6 38.0 30.4 38.0 25-29 37.12535 38.0 38.0 38.0 36.6 38.0 30-34 37.2864 38.0 38.0 38.0 37.0 38.0 35-39 37.30005 38.0 38.0 38.0 37.4 38.0 40-44 37.23434999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.513999999999996 38.0 37.8 38.0 34.2 38.0 50-54 37.17145000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.017900000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.280350000000006 38.0 37.4 38.0 32.8 38.0 65-69 36.983 38.0 38.0 38.0 36.0 38.0 70-74 36.91915 38.0 38.0 38.0 36.0 38.0 75-79 36.96915 38.0 38.0 38.0 36.0 38.0 80-84 35.6943 38.0 36.6 38.0 29.8 38.0 85-89 36.45685 38.0 38.0 38.0 34.4 38.0 90-94 36.588 38.0 38.0 38.0 35.0 38.0 95-99 36.470299999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.268499999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.0684 37.8 35.6 38.0 29.0 38.0 110-114 33.62405 37.8 32.4 38.0 22.8 38.0 115-119 35.429700000000004 38.0 36.6 38.0 31.0 38.0 120-124 35.220600000000005 38.0 36.6 38.0 30.2 38.0 125-129 34.84625 38.0 36.0 38.0 28.8 38.0 130-134 34.31595 38.0 35.4 38.0 25.6 38.0 135-139 33.56055 38.0 33.4 38.0 21.2 38.0 140-144 32.50165 38.0 32.8 38.0 14.8 38.0 145-149 31.16845 38.0 31.0 38.0 6.2 38.0 150-151 24.352 30.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 1.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 6.0 18 12.0 19 15.0 20 2.0 21 1.0 22 12.0 23 13.0 24 16.0 25 16.0 26 19.0 27 14.0 28 28.0 29 44.0 30 44.0 31 69.0 32 93.0 33 145.0 34 225.0 35 414.0 36 983.0 37 1808.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.599999999999998 26.775 7.1 36.525 2 22.6 24.55 41.4 11.450000000000001 3 15.682841420710355 27.938969484742373 35.79289644822411 20.58529264632316 4 20.925 35.125 24.975 18.975 5 24.474999999999998 39.2 21.05 15.275 6 19.75 40.275 23.175 16.8 7 20.05 21.2 40.5 18.25 8 19.475 24.95 30.2 25.374999999999996 9 21.525 22.925 31.65 23.9 10-14 23.44 28.384999999999998 26.445 21.73 15-19 23.41 27.915 27.994999999999997 20.68 20-24 23.565 27.650000000000002 28.275 20.51 25-29 23.36 27.744999999999997 28.405 20.49 30-34 22.759999999999998 28.285 28.22 20.735 35-39 23.215 27.91 28.535 20.34 40-44 23.25 28.050000000000004 28.685 20.015 45-49 23.244999999999997 28.12 27.82 20.815 50-54 23.7 27.589999999999996 28.465 20.244999999999997 55-59 24.099999999999998 27.595 27.215 21.09 60-64 23.16 27.76 28.095 20.985 65-69 23.62 27.27 28.665000000000003 20.445 70-74 24.175 27.955000000000002 27.839999999999996 20.03 75-79 23.785 27.839999999999996 28.43 19.945 80-84 23.915 28.585 27.395000000000003 20.105 85-89 23.575 27.750000000000004 28.63 20.044999999999998 90-94 24.21 28.405 27.665 19.72 95-99 24.01 28.21 28.055000000000003 19.725 100-104 24.3 28.345 27.705000000000002 19.650000000000002 105-109 24.37 28.244999999999997 28.38 19.005 110-114 24.635 28.655 27.67 19.040000000000003 115-119 25.095 28.694999999999997 27.134999999999998 19.075 120-124 25.915 28.775000000000002 27.0 18.310000000000002 125-129 25.83 28.53 26.665 18.975 130-134 26.355 28.470000000000002 27.334999999999997 17.84 135-139 26.595000000000002 28.000000000000004 27.18 18.224999999999998 140-144 25.874999999999996 29.12 27.339999999999996 17.665 145-149 26.935 28.585 26.985 17.495 150-151 26.83110053837486 29.798422436459248 26.76849881056717 16.601978214598724 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.5 19 2.0 20 0.0 21 0.5 22 1.0 23 2.5 24 2.5 25 2.5 26 6.5 27 7.5 28 9.5 29 14.0 30 20.5 31 28.0 32 37.5 33 50.0 34 62.5 35 82.5 36 105.0 37 120.5 38 134.0 39 160.5 40 187.0 41 208.0 42 231.5 43 268.5 44 287.0 45 248.5 46 239.0 47 248.5 48 226.0 49 196.0 50 166.5 51 136.0 52 112.5 53 105.5 54 82.0 55 54.0 56 41.0 57 32.5 58 23.5 59 18.0 60 13.0 61 6.5 62 5.0 63 3.5 64 3.0 65 2.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.05467552376086 96.925 2 0.6898313745528871 1.35 3 0.07664793050587634 0.22499999999999998 4 0.02554931016862545 0.1 5 0.0 0.0 6 0.0510986203372509 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0510986203372509 0.44999999999999996 >10 0.0510986203372509 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 9 0.22499999999999998 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.45 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.725 0.0 0.0 0.0 0.0 82-83 0.8500000000000001 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.625 0.0 0.0 0.0 0.0 90-91 1.9249999999999998 0.0 0.0 0.0 0.0 92-93 2.125 0.0 0.0 0.0 0.0 94-95 2.45 0.0 0.0 0.0 0.0 96-97 2.8875 0.0 0.0 0.0 0.0 98-99 3.375 0.0 0.0 0.0 0.0 100-101 3.7125 0.0 0.0 0.0 0.0 102-103 4.125 0.0 0.0 0.0 0.0 104-105 4.7125 0.0 0.0 0.0 0.0 106-107 5.275 0.0 0.0 0.0 0.0 108-109 5.85 0.0 0.0 0.0 0.0 110-111 6.425000000000001 0.0 0.0 0.0 0.0 112-113 7.0625 0.0 0.0 0.0 0.0 114-115 7.9375 0.0 0.0 0.0 0.0 116-117 8.9625 0.0 0.0 0.0 0.0 118-119 9.825 0.0 0.0 0.0 0.0 120-121 10.5625 0.0 0.0 0.0 0.0 122-123 11.337499999999999 0.0 0.0 0.0 0.0 124-125 12.35 0.0 0.0 0.0 0.0 126-127 13.2375 0.0 0.0 0.0 0.0 128-129 14.125 0.0 0.0 0.0 0.0 130-131 14.837499999999999 0.0 0.0 0.0 0.0 132-133 15.65 0.0 0.0 0.0 0.0 134-135 16.4875 0.0 0.0 0.0 0.0 136-137 17.575 0.0 0.0 0.0 0.0 138-139 18.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGGG 75 0.0012377208 13.533334 140-144 CGTCGTG 85 0.0031733946 11.941176 135-139 >>END_MODULE Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502929 spots for SRR7171082.sra Written 502929 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra Read 502923 spots for SRR7171082.sra Written 502923 spots for SRR7171082.sra SRR ids: ['SRR7171082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y5rg_0gl SRR7171082.sra spots: 10058466 blocks: [[1, 502923], [502924, 1005846], [1005847, 1508769], [1508770, 2011692], [2011693, 2514615], [2514616, 3017538], [3017539, 3520461], [3520462, 4023384], [4023385, 4526307], [4526308, 5029230], [5029231, 5532153], [5532154, 6035076], [6035077, 6537999], [6538000, 7040922], [7040923, 7543845], [7543846, 8046768], [8046769, 8549691], [8549692, 9052614], [9052615, 9555537], [9555538, 10058466]] SRR7171082 file size 3386783 SRR7171082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171082 SRR7171082_1.fastq SRR7171082_2.fastq Input file: SRR7171082_1.fastq Paired file: SRR7171082_2.fastq trimmed: SRR7171082-trimmed-pair1.fastq, SRR7171082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 01:37:24 2025 >> started Fri Feb 14 01:37:36 2025 >> done (11.620s) 10058466 read pairs processed; of these: 5664 ( 0.06%) short read pairs filtered out after trimming by size control 55996 ( 0.56%) empty read pairs filtered out after trimming by size control 9996806 (99.39%) read pairs available; of these: 6535602 (65.38%) trimmed read pairs available after processing 3461204 (34.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 13 0.00% 20 13 0.00% 21 24 0.00% 22 14 0.00% 23 13 0.00% 24 20 0.00% 25 17 0.00% 26 25 0.00% 27 24 0.00% 28 24 0.00% 29 25 0.00% 30 21 0.00% 31 30 0.00% 32 29 0.00% 33 36 0.00% 34 43 0.00% 35 44 0.00% 36 41 0.00% 37 56 0.00% 38 55 0.00% 39 71 0.00% 40 79 0.00% 41 97 0.00% 42 87 0.00% 43 85 0.00% 44 90 0.00% 45 151 0.00% 46 183 0.00% 47 198 0.00% 48 216 0.00% 49 277 0.00% 50 319 0.00% 51 341 0.00% 52 372 0.00% 53 413 0.00% 54 404 0.00% 55 488 0.00% 56 531 0.01% 57 602 0.01% 58 730 0.01% 59 735 0.01% 60 1002 0.01% 61 1075 0.01% 62 1213 0.01% 63 1363 0.01% 64 1502 0.02% 65 1591 0.02% 66 1769 0.02% 67 1928 0.02% 68 2132 0.02% 69 2441 0.02% 70 2888 0.03% 71 3178 0.03% 72 3776 0.04% 73 4183 0.04% 74 4562 0.05% 75 5272 0.05% 76 6324 0.06% 77 7079 0.07% 78 6715 0.07% 79 7230 0.07% 80 8067 0.08% 81 8832 0.09% 82 9999 0.10% 83 10834 0.11% 84 12412 0.12% 85 13058 0.13% 86 14184 0.14% 87 14571 0.15% 88 15733 0.16% 89 16355 0.16% 90 17949 0.18% 91 18848 0.19% 92 19565 0.20% 93 22488 0.22% 94 23103 0.23% 95 24633 0.25% 96 24699 0.25% 97 25378 0.25% 98 26913 0.27% 99 26991 0.27% 100 29060 0.29% 101 28310 0.28% 102 30829 0.31% 103 31325 0.31% 104 32651 0.33% 105 34295 0.34% 106 34708 0.35% 107 34793 0.35% 108 35130 0.35% 109 36266 0.36% 110 36646 0.37% 111 37493 0.38% 112 38633 0.39% 113 40153 0.40% 114 41203 0.41% 115 43686 0.44% 116 44778 0.45% 117 43764 0.44% 118 44922 0.45% 119 44692 0.45% 120 46429 0.46% 121 45314 0.45% 122 48929 0.49% 123 49579 0.50% 124 49544 0.50% 125 50037 0.50% 126 51263 0.51% 127 51693 0.52% 128 52975 0.53% 129 53059 0.53% 130 54721 0.55% 131 54826 0.55% 132 57144 0.57% 133 58616 0.59% 134 62040 0.62% 135 64168 0.64% 136 65242 0.65% 137 68432 0.68% 138 71991 0.72% 139 75779 0.76% 140 79064 0.79% 141 85640 0.86% 142 91343 0.91% 143 99394 0.99% 144 113312 1.13% 145 129252 1.29% 146 157573 1.58% 147 201409 2.01% 148 295158 2.95% 149 560099 5.60% 150 2419355 24.20% 151 3461204 34.62% 9996806 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=27 prefix-density=0.79 prefix-fanout=2.0 sequence=TGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=47.45 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.8 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.86 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=1.84 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=18.67 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=4.5 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7171082 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 01:38:19 Started mapping on | Feb 14 01:38:19 Finished on | Feb 14 01:39:30 Mapping speed, Million of reads per hour | 506.88 Number of input reads | 9996806 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 9334307 Uniquely mapped reads % | 93.37% Average mapped length | 283.61 Number of splices: Total | 7862941 Number of splices: Annotated (sjdb) | 7686633 Number of splices: GT/AG | 7702006 Number of splices: GC/AG | 128157 Number of splices: AT/AC | 6712 Number of splices: Non-canonical | 26066 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.03% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251170 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 32319 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 419994 419994 419994 N_multimapping 251170 251170 251170 N_noFeature 326861 9082435 399903 N_ambiguous 248279 596 69329 UnstrandedReadsAssigned:8759167 PositiveStrandReadsAssigned:251276 NegativeStrandReadsAssigned:8865075 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR7171082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171082-trimmed-pair1.fastq SRR7171082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,996,806 reads, 8,852,115 reads pseudoaligned [quant] estimated average fragment length: 205.405 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7171082.ke.tsv 34699 SRR7171082.se.tsv 87100 total ==> SRR7171082.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1813.59 191 8.23753 Potri.005G024800.1.v4.1 1035 830.595 236 22.2242 Potri.004G059700.1.v4.1 961 756.616 61 6.30606 Potri.007G009000.2.v4.1 1416 1211.59 0 0 Potri.003G141000.2.v4.1 2943 2738.59 325 9.28238 Potri.016G087400.1.v4.1 270 102.972 906 688.194 Potri.015G069301.1.v4.1 564 363.267 0 0 Potri.010G195200.1.v4.1 1773 1568.59 11 0.548511 Potri.012G127500.1.v4.1 977 772.611 94 9.51636 ==> SRR7171082.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 481 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 66 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7171082 completed mapping pipeline successfully