Starting /dee2/code/volunteer_pipeline.sh SRR7171084 current disk space = 3088053010432 free memory = 1580286124 SRR7171084 SRAfilesize 51f160e8a7b2576b7a69513303815447 SRR7171084.sra SRR7171084.sra file validated SRR7171084 is paired end SRR7171084 is conventional basespace SRR7171084 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.65575 18.0 18.0 25.0 18.0 32.0 2 25.11975 27.0 18.0 29.0 18.0 31.0 3 25.42525 27.0 18.0 29.0 18.0 31.0 4 28.43925 29.0 27.0 31.0 25.0 33.0 5 29.46575 31.0 29.0 33.0 25.0 33.0 6 35.65575 37.0 36.0 38.0 31.0 38.0 7 36.62275 38.0 37.0 38.0 34.0 38.0 8 36.642 38.0 37.0 38.0 34.0 38.0 9 36.9385 38.0 38.0 38.0 35.0 38.0 10-14 37.32215 38.0 38.0 38.0 36.6 38.0 15-19 37.35425 38.0 38.0 38.0 37.0 38.0 20-24 37.477799999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.08655 38.0 38.0 38.0 35.2 38.0 30-34 37.1918 38.0 38.0 38.0 35.8 38.0 35-39 36.11900000000001 38.0 36.4 38.0 31.0 38.0 40-44 37.12910000000001 38.0 38.0 38.0 36.2 38.0 45-49 36.5882 38.0 37.4 38.0 33.6 38.0 50-54 37.085699999999996 38.0 38.0 38.0 36.4 38.0 55-59 37.0672 38.0 38.0 38.0 36.0 38.0 60-64 36.47165 38.0 37.4 38.0 33.2 38.0 65-69 35.85705 38.0 36.0 38.0 30.0 38.0 70-74 36.27935 38.0 37.4 38.0 32.0 38.0 75-79 36.59615 38.0 37.8 38.0 34.4 38.0 80-84 36.580799999999996 38.0 38.0 38.0 34.2 38.0 85-89 35.4275 38.0 35.8 38.0 30.0 38.0 90-94 35.63785 38.0 36.0 38.0 30.8 38.0 95-99 34.766749999999995 38.0 35.2 38.0 24.4 38.0 100-104 35.877250000000004 38.0 36.6 38.0 31.8 38.0 105-109 35.8873 38.0 37.0 38.0 32.4 38.0 110-114 34.6468 38.0 35.2 38.0 25.2 38.0 115-119 31.76075000000001 34.8 28.0 37.8 20.4 38.0 120-124 35.23355 38.0 35.8 38.0 29.2 38.0 125-129 34.902 38.0 35.2 38.0 28.0 38.0 130-134 33.69845 38.0 32.8 38.0 22.2 38.0 135-139 33.92355 38.0 33.0 38.0 23.8 38.0 140-144 33.154250000000005 38.0 33.0 38.0 18.8 38.0 145-149 29.508500000000005 35.6 25.2 38.0 6.0 38.0 150-151 25.537750000000003 33.5 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 4.0 17 0.0 18 8.0 19 4.0 20 4.0 21 4.0 22 11.0 23 11.0 24 14.0 25 11.0 26 25.0 27 21.0 28 40.0 29 52.0 30 75.0 31 91.0 32 166.0 33 221.0 34 337.0 35 723.0 36 1507.0 37 662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.81735040501699 17.089103736608312 9.328455709432976 36.76509014894173 2 21.25 19.75 34.5 24.5 3 19.979994998749685 23.88097024256064 28.257064266066518 27.881970492623154 4 23.125 30.925000000000004 23.275000000000002 22.675 5 20.580145036259065 36.48412103025757 24.981245311327832 17.95448862215554 6 16.825000000000003 37.05 26.5 19.625 7 13.925 23.200000000000003 43.925 18.95 8 16.650000000000002 24.675 31.374999999999996 27.3 9 17.1 22.425 34.275 26.200000000000003 10-14 19.74 29.849999999999998 26.634999999999998 23.775 15-19 19.575 28.525 27.72 24.18 20-24 19.21 28.655 27.884999999999998 24.25 25-29 18.995 28.34 28.249999999999996 24.415 30-34 19.475 28.694999999999997 28.535 23.294999999999998 35-39 19.53597679883994 28.471423571178562 28.181409070453523 23.811190559527976 40-44 19.805 28.645 27.950000000000003 23.599999999999998 45-49 19.470000000000002 28.93 27.77 23.830000000000002 50-54 19.45 29.13 28.050000000000004 23.369999999999997 55-59 19.814999999999998 28.49 27.134999999999998 24.560000000000002 60-64 20.169999999999998 28.854999999999997 27.655 23.32 65-69 19.965 28.785 27.665 23.585 70-74 20.14 28.735 27.36 23.765 75-79 20.07 28.335 28.105000000000004 23.49 80-84 20.156007800390018 28.666433321666084 28.016400820041003 23.161158057902895 85-89 19.846984698469846 28.64786478647865 27.77777777777778 23.72737273727373 90-94 20.205000000000002 28.665000000000003 27.634999999999998 23.494999999999997 95-99 20.25 28.915000000000003 27.810000000000002 23.025000000000002 100-104 19.59 29.085 27.705000000000002 23.62 105-109 20.615 27.915 28.225 23.244999999999997 110-114 20.515 28.48 27.894999999999996 23.11 115-119 21.23 28.43 27.095000000000002 23.244999999999997 120-124 21.12 28.599999999999998 26.729999999999997 23.549999999999997 125-129 20.446022301115054 29.031451572578632 26.961348067403367 23.561178058902946 130-134 21.349999999999998 28.645 26.805 23.200000000000003 135-139 21.490000000000002 28.34 26.405 23.765 140-144 21.099999999999998 28.575 26.450000000000003 23.875 145-149 20.549999999999997 29.015 26.445 23.990000000000002 150-151 21.315164395549445 27.69096137017127 25.715714464308036 25.278159769971246 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 2.5 22 3.5 23 3.0 24 2.5 25 2.5 26 4.5 27 8.5 28 16.5 29 22.5 30 28.5 31 34.0 32 38.0 33 51.0 34 67.0 35 83.5 36 100.0 37 119.5 38 141.5 39 156.0 40 182.5 41 223.5 42 243.0 43 241.0 44 259.5 45 284.5 46 264.0 47 230.5 48 215.0 49 192.5 50 166.0 51 140.0 52 107.5 53 88.5 54 75.0 55 55.0 56 40.5 57 30.5 58 22.5 59 16.0 60 11.0 61 5.5 62 5.0 63 4.5 64 2.0 65 1.5 66 0.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.35211267605633806 0.7000000000000001 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.05030181086519115 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2375 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.8250000000000002 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.55 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.300000000000001 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCGAA 20 0.0059376103 28.9975 140-144 CGCGAAA 20 0.0059376103 28.9975 140-144 >>END_MODULE SRR7171084 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82425 33.0 33.0 34.0 32.0 34.0 2 32.6655 33.0 33.0 34.0 32.0 34.0 3 32.85225 34.0 33.0 34.0 32.0 34.0 4 32.88325 34.0 33.0 34.0 32.0 34.0 5 32.84175 34.0 33.0 34.0 32.0 34.0 6 36.98325 38.0 38.0 38.0 36.0 38.0 7 37.09625 38.0 38.0 38.0 37.0 38.0 8 37.03075 38.0 38.0 38.0 36.0 38.0 9 37.09375 38.0 38.0 38.0 37.0 38.0 10-14 36.9171 38.0 38.0 38.0 35.8 38.0 15-19 36.9448 38.0 38.0 38.0 36.0 38.0 20-24 36.57925 38.0 38.0 38.0 34.8 38.0 25-29 36.8618 38.0 38.0 38.0 35.8 38.0 30-34 36.8972 38.0 38.0 38.0 36.0 38.0 35-39 36.85625 38.0 38.0 38.0 35.8 38.0 40-44 36.77685 38.0 38.0 38.0 35.6 38.0 45-49 36.57065 38.0 38.0 38.0 34.8 38.0 50-54 36.6864 38.0 38.0 38.0 35.2 38.0 55-59 36.69655 38.0 38.0 38.0 35.2 38.0 60-64 36.56830000000001 38.0 38.0 38.0 34.8 38.0 65-69 36.6254 38.0 38.0 38.0 35.0 38.0 70-74 36.5441 38.0 38.0 38.0 34.8 38.0 75-79 36.38035 38.0 38.0 38.0 34.4 38.0 80-84 36.27645 38.0 38.0 38.0 34.0 38.0 85-89 36.16435 38.0 38.0 38.0 34.0 38.0 90-94 36.07625 38.0 38.0 38.0 33.4 38.0 95-99 36.0188 38.0 37.8 38.0 33.6 38.0 100-104 35.7149 38.0 37.0 38.0 31.8 38.0 105-109 35.458200000000005 38.0 37.0 38.0 30.6 38.0 110-114 35.381 38.0 36.8 38.0 30.2 38.0 115-119 35.08655 38.0 36.2 38.0 28.6 38.0 120-124 34.807649999999995 38.0 36.0 38.0 27.4 38.0 125-129 34.38785 38.0 35.2 38.0 25.8 38.0 130-134 33.9871 38.0 34.4 38.0 23.4 38.0 135-139 33.091800000000006 38.0 33.0 38.0 17.4 38.0 140-144 31.959699999999998 38.0 31.8 38.0 13.0 38.0 145-149 30.897249999999996 38.0 30.6 38.0 5.8 38.0 150-151 24.38675 31.0 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 6.0 5 1.0 6 4.0 7 3.0 8 1.0 9 1.0 10 4.0 11 2.0 12 1.0 13 3.0 14 4.0 15 5.0 16 3.0 17 8.0 18 3.0 19 6.0 20 14.0 21 10.0 22 8.0 23 17.0 24 15.0 25 27.0 26 26.0 27 20.0 28 37.0 29 54.0 30 57.0 31 79.0 32 116.0 33 123.0 34 179.0 35 347.0 36 781.0 37 2026.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.199999999999996 19.475 12.45 25.874999999999996 2 24.65 25.224999999999998 33.35 16.775000000000002 3 20.625 27.425 32.775 19.175 4 24.875 33.95 22.125 19.05 5 23.275000000000002 38.1 21.55 17.075000000000003 6 19.7 39.550000000000004 23.175 17.575 7 18.75 19.45 41.9 19.900000000000002 8 19.950000000000003 23.525 30.4 26.125 9 21.5 24.2 31.175000000000004 23.125 10-14 23.215 28.395 26.834999999999997 21.555 15-19 22.884999999999998 28.485 27.92 20.71 20-24 22.08 28.494999999999997 28.360000000000003 21.065 25-29 22.625 28.285 27.944999999999997 21.145 30-34 22.68 28.515 27.87 20.935000000000002 35-39 22.27 28.205000000000002 28.515 21.01 40-44 22.689999999999998 28.665000000000003 28.26 20.385 45-49 22.975 28.560000000000002 28.199999999999996 20.265 50-54 22.869999999999997 28.310000000000002 28.044999999999998 20.775 55-59 23.49 28.110000000000003 27.83 20.57 60-64 23.715 27.395000000000003 28.155 20.735 65-69 22.720000000000002 28.050000000000004 28.32 20.91 70-74 22.97 28.13 27.700000000000003 21.2 75-79 22.355 28.53 27.79 21.325 80-84 23.29 28.02 27.71 20.979999999999997 85-89 23.580000000000002 28.255000000000003 27.415 20.75 90-94 23.369999999999997 27.97 28.07 20.59 95-99 23.625 27.555000000000003 28.305000000000003 20.515 100-104 23.32 27.83 28.57 20.28 105-109 23.985 27.939999999999998 28.4 19.675 110-114 24.075 27.750000000000004 27.715 20.46 115-119 24.195 28.125 27.555000000000003 20.125 120-124 24.13 27.900000000000002 28.27 19.7 125-129 24.51 27.985 27.47 20.035 130-134 24.755 28.17 27.565 19.509999999999998 135-139 25.055 27.529999999999998 27.595 19.82 140-144 25.405 27.71 27.825 19.06 145-149 24.87 27.72 27.605 19.805 150-151 25.640705088136016 27.240905113139142 27.17839729966246 19.939992499062384 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.5 14 1.5 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.5 25 1.5 26 3.5 27 8.0 28 11.5 29 13.0 30 18.0 31 19.5 32 27.0 33 42.5 34 59.5 35 80.0 36 95.5 37 119.5 38 139.5 39 151.5 40 185.0 41 232.5 42 269.5 43 279.5 44 284.0 45 277.0 46 258.5 47 234.0 48 204.5 49 185.0 50 165.0 51 135.5 52 108.5 53 90.5 54 74.5 55 58.5 56 45.0 57 34.0 58 23.0 59 18.5 60 13.0 61 6.5 62 4.0 63 4.5 64 3.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4949494949495 98.5 2 0.3282828282828283 0.65 3 0.050505050505050504 0.15 4 0.050505050505050504 0.2 5 0.025252525252525252 0.125 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.025252525252525252 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.675 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.4749999999999996 0.0 0.0 0.0 0.0 116-117 3.8125 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 4.737500000000001 0.0 0.0 0.0 0.0 122-123 5.2 0.0 0.0 0.0 0.0 124-125 5.637499999999999 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.475 0.0 0.0 0.0 0.0 134-135 8.1625 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATGGT 10 0.006830828 145.0 1 >>END_MODULE Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918192 spots for SRR7171084.sra Written 918192 spots for SRR7171084.sra Read 918199 spots for SRR7171084.sra Written 918199 spots for SRR7171084.sra SRR ids: ['SRR7171084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1lvbsomw SRR7171084.sra spots: 18363847 blocks: [[1, 918192], [918193, 1836384], [1836385, 2754576], [2754577, 3672768], [3672769, 4590960], [4590961, 5509152], [5509153, 6427344], [6427345, 7345536], [7345537, 8263728], [8263729, 9181920], [9181921, 10100112], [10100113, 11018304], [11018305, 11936496], [11936497, 12854688], [12854689, 13772880], [13772881, 14691072], [14691073, 15609264], [15609265, 16527456], [16527457, 17445648], [17445649, 18363847]] SRR7171084 file size 6201204 SRR7171084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171084 SRR7171084_1.fastq SRR7171084_2.fastq Input file: SRR7171084_1.fastq Paired file: SRR7171084_2.fastq trimmed: SRR7171084-trimmed-pair1.fastq, SRR7171084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:45:05 2025 >> started Fri Feb 14 02:45:24 2025 >> done (18.989s) 18363847 read pairs processed; of these: 20922 ( 0.11%) short read pairs filtered out after trimming by size control 47024 ( 0.26%) empty read pairs filtered out after trimming by size control 18295901 (99.63%) read pairs available; of these: 11506238 (62.89%) trimmed read pairs available after processing 6789663 (37.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 6 0.00% 20 13 0.00% 21 5 0.00% 22 15 0.00% 23 13 0.00% 24 18 0.00% 25 16 0.00% 26 18 0.00% 27 19 0.00% 28 16 0.00% 29 19 0.00% 30 22 0.00% 31 34 0.00% 32 31 0.00% 33 33 0.00% 34 36 0.00% 35 43 0.00% 36 36 0.00% 37 55 0.00% 38 60 0.00% 39 60 0.00% 40 72 0.00% 41 99 0.00% 42 99 0.00% 43 118 0.00% 44 109 0.00% 45 131 0.00% 46 160 0.00% 47 155 0.00% 48 189 0.00% 49 233 0.00% 50 259 0.00% 51 270 0.00% 52 316 0.00% 53 349 0.00% 54 369 0.00% 55 412 0.00% 56 444 0.00% 57 438 0.00% 58 554 0.00% 59 627 0.00% 60 649 0.00% 61 843 0.00% 62 914 0.00% 63 1046 0.01% 64 1082 0.01% 65 1197 0.01% 66 1319 0.01% 67 1407 0.01% 68 1551 0.01% 69 1676 0.01% 70 1991 0.01% 71 2309 0.01% 72 2622 0.01% 73 2981 0.02% 74 3380 0.02% 75 4036 0.02% 76 5625 0.03% 77 5380 0.03% 78 4687 0.03% 79 5081 0.03% 80 5516 0.03% 81 6148 0.03% 82 7084 0.04% 83 7716 0.04% 84 9326 0.05% 85 10514 0.06% 86 11206 0.06% 87 11964 0.07% 88 12674 0.07% 89 13448 0.07% 90 14460 0.08% 91 15565 0.09% 92 16931 0.09% 93 18708 0.10% 94 19854 0.11% 95 20864 0.11% 96 21685 0.12% 97 23088 0.13% 98 23478 0.13% 99 24637 0.13% 100 26436 0.14% 101 27424 0.15% 102 29149 0.16% 103 30708 0.17% 104 32655 0.18% 105 33956 0.19% 106 35345 0.19% 107 36217 0.20% 108 37609 0.21% 109 38956 0.21% 110 39719 0.22% 111 40943 0.22% 112 42684 0.23% 113 44705 0.24% 114 46406 0.25% 115 48422 0.26% 116 49890 0.27% 117 50600 0.28% 118 52147 0.29% 119 53490 0.29% 120 54969 0.30% 121 56556 0.31% 122 58050 0.32% 123 60718 0.33% 124 62809 0.34% 125 65403 0.36% 126 67390 0.37% 127 69722 0.38% 128 71832 0.39% 129 74410 0.41% 130 77189 0.42% 131 79708 0.44% 132 83448 0.46% 133 88849 0.49% 134 93100 0.51% 135 99451 0.54% 136 106817 0.58% 137 115118 0.63% 138 122671 0.67% 139 131952 0.72% 140 141971 0.78% 141 155253 0.85% 142 170628 0.93% 143 191544 1.05% 144 222226 1.21% 145 261225 1.43% 146 322048 1.76% 147 425602 2.33% 148 644204 3.52% 149 1237715 6.76% 150 4945577 27.03% 151 6789663 37.11% 18295901 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=6 prefix-density=0.57 prefix-fanout=3.1 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=42.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=18 prefix-density=0.75 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=34.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.2 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGTACCTAAAACACCAAGAGGTTGCCCAA SRR7171084 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:46:08 Started mapping on | Feb 14 02:46:08 Finished on | Feb 14 02:47:58 Mapping speed, Million of reads per hour | 598.77 Number of input reads | 18295901 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17311861 Uniquely mapped reads % | 94.62% Average mapped length | 289.50 Number of splices: Total | 16554492 Number of splices: Annotated (sjdb) | 16148759 Number of splices: GT/AG | 16236197 Number of splices: GC/AG | 252706 Number of splices: AT/AC | 10227 Number of splices: Non-canonical | 55362 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 497718 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 47161 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507775 507775 507775 N_multimapping 497718 497718 497718 N_noFeature 762645 17027817 875551 N_ambiguous 308142 1430 136072 UnstrandedReadsAssigned:16241074 PositiveStrandReadsAssigned:282614 NegativeStrandReadsAssigned:16300238 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171084-trimmed-pair1.fastq SRR7171084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,295,901 reads, 16,186,349 reads pseudoaligned [quant] estimated average fragment length: 228.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7171084.ke.tsv 34699 SRR7171084.se.tsv 87100 total ==> SRR7171084.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.56 793 24.7921 Potri.005G024800.1.v4.1 1035 807.565 209 14.4877 Potri.004G059700.1.v4.1 961 733.585 16 1.22096 Potri.007G009000.2.v4.1 1416 1188.56 0 0 Potri.003G141000.2.v4.1 2943 2715.56 1264.63 26.0695 Potri.016G087400.1.v4.1 270 89.1686 948.077 595.199 Potri.015G069301.1.v4.1 564 340.634 0 0 Potri.010G195200.1.v4.1 1773 1545.56 64 2.31805 Potri.012G127500.1.v4.1 977 749.575 50 3.7341 ==> SRR7171084.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 599 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 189 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7171084 completed mapping pipeline successfully