Starting /dee2/code/volunteer_pipeline.sh SRR7171085 current disk space = 3087982043136 free memory = 1527799124 SRR7171085 SRAfilesize b6e7801bb663be8a4c9dd5530f299c00 SRR7171085.sra SRR7171085.sra file validated SRR7171085 is paired end SRR7171085 is conventional basespace SRR7171085 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.94425 32.0 28.0 33.0 18.0 34.0 2 30.97475 33.0 31.0 33.0 27.0 34.0 3 32.18725 33.0 33.0 33.0 29.0 34.0 4 32.48075 33.0 33.0 33.0 31.0 34.0 5 32.8025 33.0 33.0 34.0 31.0 34.0 6 35.53575 38.0 37.0 38.0 29.0 38.0 7 36.89225 38.0 38.0 38.0 35.0 38.0 8 37.2825 38.0 38.0 38.0 36.0 38.0 9 37.57325 38.0 38.0 38.0 37.0 38.0 10-14 37.536899999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.54305 38.0 38.0 38.0 38.0 38.0 20-24 37.56075 38.0 38.0 38.0 38.0 38.0 25-29 37.59155 38.0 38.0 38.0 38.0 38.0 30-34 37.512699999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.486 38.0 38.0 38.0 37.6 38.0 40-44 37.44435 38.0 38.0 38.0 37.4 38.0 45-49 37.42805 38.0 38.0 38.0 37.2 38.0 50-54 37.296949999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2249 38.0 38.0 38.0 36.6 38.0 60-64 37.23415 38.0 38.0 38.0 36.8 38.0 65-69 36.352599999999995 38.0 37.4 38.0 33.0 38.0 70-74 36.19665 38.0 37.0 38.0 30.8 38.0 75-79 36.98010000000001 38.0 38.0 38.0 35.8 38.0 80-84 36.96525 38.0 38.0 38.0 36.0 38.0 85-89 36.80929999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.69055 38.0 38.0 38.0 35.0 38.0 95-99 36.6553 38.0 38.0 38.0 34.6 38.0 100-104 36.5914 38.0 38.0 38.0 34.6 38.0 105-109 36.45555 38.0 38.0 38.0 34.0 38.0 110-114 36.34865 38.0 38.0 38.0 34.0 38.0 115-119 36.027499999999996 38.0 37.0 38.0 33.2 38.0 120-124 35.995799999999996 38.0 37.0 38.0 32.6 38.0 125-129 35.48805 38.0 36.4 38.0 30.2 38.0 130-134 35.11255 38.0 35.8 38.0 30.0 38.0 135-139 34.76705 38.0 35.6 38.0 28.4 38.0 140-144 34.0881 38.0 34.2 38.0 25.0 38.0 145-149 33.17385 38.0 33.0 38.0 18.0 38.0 150-151 28.043625 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 3.0 17 0.0 18 6.0 19 3.0 20 1.0 21 3.0 22 6.0 23 7.0 24 8.0 25 16.0 26 15.0 27 17.0 28 20.0 29 37.0 30 43.0 31 47.0 32 67.0 33 104.0 34 163.0 35 314.0 36 806.0 37 2308.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.450653678543965 13.45808766982825 10.484491156113817 33.60676749551397 2 20.349999999999998 17.224999999999998 38.0 24.425 3 18.55 24.95 27.875 28.625 4 21.175 32.074999999999996 24.625 22.125 5 22.075 35.425000000000004 26.1 16.400000000000002 6 17.275 36.275 26.474999999999998 19.975 7 12.55 24.175 44.0 19.275000000000002 8 17.549999999999997 24.0 32.375 26.075 9 17.375 24.15 32.225 26.25 10-14 19.77 30.035 27.0 23.195 15-19 19.634999999999998 28.58 28.189999999999998 23.595 20-24 19.54 29.26 28.33 22.869999999999997 25-29 19.77 29.195 27.865000000000002 23.169999999999998 30-34 19.425 28.935 28.084999999999997 23.555 35-39 20.025000000000002 28.365000000000002 28.125 23.485 40-44 20.615 29.349999999999998 27.215 22.82 45-49 20.080000000000002 28.785 27.705000000000002 23.43 50-54 20.025000000000002 28.645 28.16 23.169999999999998 55-59 19.975 28.535 28.22 23.27 60-64 20.14 28.804999999999996 27.605 23.45 65-69 19.775000000000002 28.74 27.915 23.57 70-74 20.265 28.485 27.750000000000004 23.5 75-79 19.845 29.15 27.72 23.285 80-84 20.125 28.544999999999998 27.445000000000004 23.885 85-89 20.61 29.435 27.43 22.525000000000002 90-94 20.36 28.565 27.889999999999997 23.185 95-99 21.09210921092109 28.03780378037804 27.742774277427745 23.12731273127313 100-104 20.735 28.95 27.560000000000002 22.755 105-109 20.47 28.244999999999997 28.335 22.95 110-114 20.044999999999998 28.744999999999997 27.79 23.419999999999998 115-119 20.91 29.294999999999998 26.52 23.275000000000002 120-124 21.0 28.935 26.650000000000002 23.415 125-129 20.86 28.565 27.125 23.45 130-134 20.75 28.305000000000003 26.815 24.13 135-139 20.830000000000002 29.375 26.145000000000003 23.65 140-144 21.64 28.49 26.75 23.119999999999997 145-149 20.62 28.935 26.174999999999997 24.27 150-151 20.647823911955978 28.83941970985493 25.912956478239117 24.599799899949975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 2.5 23 6.0 24 7.5 25 8.0 26 8.0 27 10.5 28 12.5 29 14.0 30 24.0 31 36.5 32 45.5 33 62.0 34 73.5 35 78.5 36 99.0 37 124.5 38 144.0 39 163.0 40 186.0 41 218.5 42 247.0 43 248.0 44 238.5 45 260.0 46 257.0 47 231.0 48 219.0 49 186.0 50 159.0 51 133.0 52 110.0 53 95.0 54 70.5 55 56.5 56 46.5 57 35.0 58 27.0 59 17.0 60 8.0 61 6.5 62 6.5 63 2.5 64 1.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09021986353298 98.02499999999999 2 0.7581501137225171 1.5 3 0.1263583522870862 0.375 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.3499999999999996 0.0125 0.0 0.0 0.0 116-117 3.85 0.025 0.0 0.0 0.0 118-119 4.3 0.025 0.0 0.0 0.0 120-121 4.9125 0.025 0.0 0.0 0.0 122-123 5.35 0.025 0.0 0.0 0.0 124-125 5.800000000000001 0.025 0.0 0.0 0.0 126-127 6.3125 0.025 0.0 0.0 0.0 128-129 6.775 0.025 0.0 0.0 0.0 130-131 7.2625 0.025 0.0 0.0 0.0 132-133 7.8375 0.025 0.0 0.0 0.0 134-135 8.524999999999999 0.025 0.0 0.0 0.0 136-137 9.212499999999999 0.025 0.0 0.0 0.0 138-139 9.9375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGAT 10 0.006836113 144.9625 6 GTTTCCA 10 0.006836113 144.9625 4 CATTTGA 10 0.006836113 144.9625 5 AACATGT 10 0.006836113 144.9625 3 TTTCCAT 25 8.7222434E-4 86.97751 5 >>END_MODULE SRR7171085 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1495 33.0 33.0 34.0 30.0 34.0 2 32.64125 33.0 33.0 34.0 32.0 34.0 3 32.784 33.0 33.0 34.0 32.0 34.0 4 32.8275 34.0 33.0 34.0 32.0 34.0 5 32.818 34.0 33.0 34.0 32.0 34.0 6 37.11375 38.0 38.0 38.0 37.0 38.0 7 37.11875 38.0 38.0 38.0 37.0 38.0 8 37.14475 38.0 38.0 38.0 37.0 38.0 9 37.1995 38.0 38.0 38.0 37.0 38.0 10-14 36.8836 38.0 38.0 38.0 35.8 38.0 15-19 36.955850000000005 38.0 38.0 38.0 36.8 38.0 20-24 35.074250000000006 38.0 34.8 38.0 26.8 38.0 25-29 36.788599999999995 38.0 37.8 38.0 36.0 38.0 30-34 36.9401 38.0 38.0 38.0 37.0 38.0 35-39 36.8827 38.0 38.0 38.0 37.0 38.0 40-44 36.841300000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.77035 38.0 38.0 38.0 36.2 38.0 50-54 36.190650000000005 38.0 37.6 38.0 33.4 38.0 55-59 36.68429999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.6853 38.0 38.0 38.0 36.0 38.0 65-69 36.5763 38.0 38.0 38.0 35.8 38.0 70-74 36.58645 38.0 38.0 38.0 35.8 38.0 75-79 36.502849999999995 38.0 38.0 38.0 35.2 38.0 80-84 35.61735 38.0 37.2 38.0 29.4 38.0 85-89 36.28830000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.3584 38.0 38.0 38.0 35.0 38.0 95-99 36.217200000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.004000000000005 38.0 38.0 38.0 33.6 38.0 105-109 35.2271 38.0 36.6 38.0 27.8 38.0 110-114 35.519600000000004 38.0 37.0 38.0 31.4 38.0 115-119 35.449400000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.2659 38.0 37.0 38.0 30.6 38.0 125-129 34.973699999999994 38.0 36.4 38.0 29.4 38.0 130-134 34.3901 38.0 35.6 38.0 26.0 38.0 135-139 33.70399999999999 38.0 33.8 38.0 21.6 38.0 140-144 32.935700000000004 38.0 33.0 38.0 15.4 38.0 145-149 32.026500000000006 38.0 33.0 38.0 10.4 38.0 150-151 26.0245 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 7.0 4 9.0 5 7.0 6 2.0 7 1.0 8 3.0 9 2.0 10 3.0 11 6.0 12 2.0 13 3.0 14 3.0 15 3.0 16 1.0 17 3.0 18 9.0 19 3.0 20 11.0 21 4.0 22 10.0 23 10.0 24 11.0 25 17.0 26 17.0 27 20.0 28 25.0 29 37.0 30 39.0 31 56.0 32 94.0 33 125.0 34 183.0 35 305.0 36 769.0 37 2185.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.05 19.8 13.450000000000001 24.7 2 25.900000000000002 25.474999999999998 33.425 15.2 3 20.9 26.625 33.25 19.225 4 25.25 34.949999999999996 21.875 17.925 5 25.35 37.15 22.1 15.4 6 20.349999999999998 36.875 23.150000000000002 19.625 7 19.85 19.7 39.550000000000004 20.9 8 21.075 25.575 27.625 25.724999999999998 9 21.15 26.025 29.275000000000002 23.549999999999997 10-14 23.95 28.215 26.245 21.59 15-19 22.625 27.689999999999998 28.549999999999997 21.135 20-24 22.645 28.165000000000003 28.15 21.04 25-29 23.215 28.155 28.04 20.59 30-34 22.79 27.839999999999996 28.645 20.724999999999998 35-39 22.84 27.855 28.189999999999998 21.115000000000002 40-44 23.794999999999998 27.415 27.97 20.82 45-49 22.994999999999997 28.115000000000002 28.305000000000003 20.585 50-54 23.1 27.775 28.28 20.845 55-59 23.125 27.975 28.355000000000004 20.544999999999998 60-64 22.785 27.889999999999997 28.575 20.75 65-69 23.169999999999998 27.665 28.435 20.73 70-74 22.8 27.63 28.560000000000002 21.01 75-79 23.150000000000002 28.265 27.839999999999996 20.745 80-84 23.62 28.299999999999997 27.334999999999997 20.745 85-89 23.415 27.93 28.389999999999997 20.265 90-94 23.505000000000003 27.650000000000002 28.18 20.665 95-99 23.494999999999997 27.575 27.775 21.154999999999998 100-104 23.455000000000002 28.405 27.915 20.225 105-109 23.385 28.065 28.035 20.515 110-114 23.61618080904045 28.491424571228563 27.481374068703435 20.41102055102755 115-119 23.974999999999998 28.075 27.55 20.4 120-124 23.91 28.075 28.005000000000003 20.01 125-129 24.015 28.389999999999997 27.839999999999996 19.755 130-134 24.97 27.450000000000003 27.575 20.005 135-139 24.59 27.834999999999997 27.74 19.835 140-144 25.905 27.99 27.279999999999998 18.825 145-149 25.650000000000002 28.315 27.235 18.8 150-151 26.700850425212607 27.33866933466733 27.151075537768882 18.809404702351177 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 2.5 24 3.0 25 2.5 26 5.5 27 7.0 28 7.5 29 9.0 30 13.5 31 19.0 32 22.5 33 34.0 34 51.0 35 72.5 36 90.5 37 111.0 38 130.0 39 156.0 40 198.5 41 231.5 42 251.5 43 269.0 44 288.5 45 288.0 46 261.0 47 249.0 48 237.0 49 205.0 50 169.5 51 120.5 52 93.5 53 89.0 54 75.0 55 64.0 56 50.0 57 32.0 58 26.0 59 21.0 60 14.0 61 8.5 62 5.0 63 4.0 64 2.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36980085707083 98.55000000000001 2 0.5041593143433325 1.0 3 0.050415931434333254 0.15 4 0.07562389715149988 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.05 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.8375000000000004 0.0 0.0 0.0 0.0 114-115 3.2 0.0 0.0 0.0 0.0 116-117 3.7 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.199999999999999 0.0 0.0 0.0 0.0 124-125 5.637499999999999 0.0 0.0 0.0 0.0 126-127 6.125 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.074999999999999 0.0 0.0 0.0 0.0 132-133 7.65 0.0 0.0 0.0 0.0 134-135 8.350000000000001 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAATC 10 0.006830828 145.0 2 CAATCAG 10 0.006830828 145.0 4 >>END_MODULE Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919202 spots for SRR7171085.sra Written 919202 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra Read 919189 spots for SRR7171085.sra Written 919189 spots for SRR7171085.sra SRR ids: ['SRR7171085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_itsik61q SRR7171085.sra spots: 18383793 blocks: [[1, 919189], [919190, 1838378], [1838379, 2757567], [2757568, 3676756], [3676757, 4595945], [4595946, 5515134], [5515135, 6434323], [6434324, 7353512], [7353513, 8272701], [8272702, 9191890], [9191891, 10111079], [10111080, 11030268], [11030269, 11949457], [11949458, 12868646], [12868647, 13787835], [13787836, 14707024], [14707025, 15626213], [15626214, 16545402], [16545403, 17464591], [17464592, 18383793]] SRR7171085 file size 6207963 SRR7171085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171085 SRR7171085_1.fastq SRR7171085_2.fastq Input file: SRR7171085_1.fastq Paired file: SRR7171085_2.fastq trimmed: SRR7171085-trimmed-pair1.fastq, SRR7171085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:27:15 2025 >> started Fri Feb 14 02:27:36 2025 >> done (20.623s) 18383793 read pairs processed; of these: 25755 ( 0.14%) short read pairs filtered out after trimming by size control 40700 ( 0.22%) empty read pairs filtered out after trimming by size control 18317338 (99.64%) read pairs available; of these: 11487855 (62.72%) trimmed read pairs available after processing 6829483 (37.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 8 0.00% 21 9 0.00% 22 5 0.00% 23 7 0.00% 24 12 0.00% 25 13 0.00% 26 14 0.00% 27 11 0.00% 28 16 0.00% 29 19 0.00% 30 23 0.00% 31 25 0.00% 32 19 0.00% 33 26 0.00% 34 21 0.00% 35 24 0.00% 36 19 0.00% 37 29 0.00% 38 32 0.00% 39 62 0.00% 40 61 0.00% 41 56 0.00% 42 59 0.00% 43 86 0.00% 44 94 0.00% 45 75 0.00% 46 97 0.00% 47 117 0.00% 48 131 0.00% 49 153 0.00% 50 184 0.00% 51 218 0.00% 52 242 0.00% 53 258 0.00% 54 287 0.00% 55 300 0.00% 56 366 0.00% 57 421 0.00% 58 431 0.00% 59 510 0.00% 60 590 0.00% 61 664 0.00% 62 819 0.00% 63 882 0.00% 64 927 0.01% 65 1079 0.01% 66 1104 0.01% 67 1304 0.01% 68 1385 0.01% 69 1658 0.01% 70 1843 0.01% 71 2189 0.01% 72 2551 0.01% 73 2848 0.02% 74 3173 0.02% 75 3806 0.02% 76 4881 0.03% 77 6088 0.03% 78 5456 0.03% 79 5554 0.03% 80 5971 0.03% 81 6677 0.04% 82 7473 0.04% 83 8139 0.04% 84 10540 0.06% 85 11676 0.06% 86 12624 0.07% 87 13569 0.07% 88 14157 0.08% 89 14761 0.08% 90 16287 0.09% 91 17274 0.09% 92 18589 0.10% 93 20488 0.11% 94 21462 0.12% 95 23112 0.13% 96 23884 0.13% 97 25324 0.14% 98 26007 0.14% 99 27047 0.15% 100 28691 0.16% 101 29209 0.16% 102 31968 0.17% 103 33315 0.18% 104 35028 0.19% 105 37051 0.20% 106 38385 0.21% 107 39270 0.21% 108 40508 0.22% 109 42197 0.23% 110 42998 0.23% 111 43927 0.24% 112 46219 0.25% 113 47880 0.26% 114 50018 0.27% 115 51719 0.28% 116 53851 0.29% 117 54719 0.30% 118 56481 0.31% 119 57299 0.31% 120 58780 0.32% 121 60712 0.33% 122 62230 0.34% 123 64658 0.35% 124 67259 0.37% 125 68891 0.38% 126 72271 0.39% 127 74007 0.40% 128 76166 0.42% 129 78302 0.43% 130 80758 0.44% 131 83670 0.46% 132 87515 0.48% 133 90958 0.50% 134 95690 0.52% 135 101606 0.55% 136 107870 0.59% 137 115011 0.63% 138 123457 0.67% 139 129855 0.71% 140 137790 0.75% 141 148906 0.81% 142 161387 0.88% 143 178322 0.97% 144 203805 1.11% 145 240986 1.32% 146 290982 1.59% 147 388919 2.12% 148 596238 3.26% 149 1205577 6.58% 150 4996132 27.28% 151 6829483 37.28% 18317338 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=19.82 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.0 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=15.68 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.0 sequence=CAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7171085 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:28:21 Started mapping on | Feb 14 02:28:21 Finished on | Feb 14 02:30:52 Mapping speed, Million of reads per hour | 436.70 Number of input reads | 18317338 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16973870 Uniquely mapped reads % | 92.67% Average mapped length | 288.98 Number of splices: Total | 15760141 Number of splices: Annotated (sjdb) | 15362129 Number of splices: GT/AG | 15443112 Number of splices: GC/AG | 238926 Number of splices: AT/AC | 10816 Number of splices: Non-canonical | 67287 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568015 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 23294 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802340 802340 802340 N_multimapping 568015 568015 568015 N_noFeature 591686 16652148 698654 N_ambiguous 360452 1325 145182 UnstrandedReadsAssigned:16021732 PositiveStrandReadsAssigned:320397 NegativeStrandReadsAssigned:16130034 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171085-trimmed-pair1.fastq SRR7171085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,317,338 reads, 16,067,775 reads pseudoaligned [quant] estimated average fragment length: 223.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7171085.ke.tsv 34699 SRR7171085.se.tsv 87100 total ==> SRR7171085.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.37 1280 35.8135 Potri.005G024800.1.v4.1 1035 812.367 328 20.2821 Potri.004G059700.1.v4.1 961 738.396 2 0.13606 Potri.007G009000.2.v4.1 1416 1193.37 0 0 Potri.003G141000.2.v4.1 2943 2720.37 790 14.5878 Potri.016G087400.1.v4.1 270 90.4486 1562 867.5 Potri.015G069301.1.v4.1 564 344.843 0 0 Potri.010G195200.1.v4.1 1773 1550.37 1264.93 40.9849 Potri.012G127500.1.v4.1 977 754.386 94 6.25928 ==> SRR7171085.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 413 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 80 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7171085 completed mapping pipeline successfully