Starting /dee2/code/volunteer_pipeline.sh SRR7171086 current disk space = 3088070692864 free memory = 1582734340 SRR7171086 SRAfilesize a7e8d9bcd961738bb3fff0385c7f511e SRR7171086.sra SRR7171086.sra file validated SRR7171086 is paired end SRR7171086 is conventional basespace SRR7171086 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.1825 32.0 28.0 33.0 18.0 34.0 2 30.994 33.0 31.0 33.0 27.0 34.0 3 32.169 33.0 33.0 33.0 29.0 34.0 4 32.47175 33.0 33.0 34.0 31.0 34.0 5 32.7215 33.0 33.0 34.0 31.0 34.0 6 35.7515 38.0 37.0 38.0 31.0 38.0 7 37.04175 38.0 38.0 38.0 36.0 38.0 8 37.367 38.0 38.0 38.0 37.0 38.0 9 37.53525 38.0 38.0 38.0 38.0 38.0 10-14 37.5064 38.0 38.0 38.0 38.0 38.0 15-19 37.53415 38.0 38.0 38.0 38.0 38.0 20-24 37.5653 38.0 38.0 38.0 38.0 38.0 25-29 37.57475 38.0 38.0 38.0 38.0 38.0 30-34 37.51535 38.0 38.0 38.0 38.0 38.0 35-39 37.4543 38.0 38.0 38.0 38.0 38.0 40-44 37.423449999999995 38.0 38.0 38.0 37.2 38.0 45-49 37.41185 38.0 38.0 38.0 37.4 38.0 50-54 37.304449999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.213699999999996 38.0 38.0 38.0 36.8 38.0 60-64 37.24235 38.0 38.0 38.0 37.0 38.0 65-69 36.24895 38.0 37.6 38.0 32.0 38.0 70-74 36.4204 38.0 37.2 38.0 31.4 38.0 75-79 37.0468 38.0 38.0 38.0 36.2 38.0 80-84 36.97645 38.0 38.0 38.0 36.0 38.0 85-89 36.84425 38.0 38.0 38.0 35.8 38.0 90-94 36.747699999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.700399999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.623000000000005 38.0 38.0 38.0 34.8 38.0 105-109 36.49715 38.0 38.0 38.0 34.0 38.0 110-114 36.43615 38.0 38.0 38.0 34.2 38.0 115-119 36.122400000000006 38.0 37.8 38.0 33.6 38.0 120-124 36.03959999999999 38.0 37.2 38.0 33.4 38.0 125-129 35.609300000000005 38.0 36.6 38.0 31.4 38.0 130-134 34.99185 38.0 35.8 38.0 28.8 38.0 135-139 34.9122 38.0 36.0 38.0 29.2 38.0 140-144 34.3107 38.0 34.4 38.0 26.6 38.0 145-149 33.3208 38.0 33.2 38.0 19.4 38.0 150-151 27.996875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 4.0 15 2.0 16 1.0 17 0.0 18 2.0 19 9.0 20 1.0 21 6.0 22 4.0 23 8.0 24 7.0 25 10.0 26 16.0 27 13.0 28 16.0 29 25.0 30 38.0 31 57.0 32 76.0 33 99.0 34 177.0 35 296.0 36 752.0 37 2377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.29501915708812 14.17624521072797 8.863346104725416 33.665389527458494 2 19.679919979995 17.27931982995749 38.584646161540384 24.456114028507127 3 17.025000000000002 23.849999999999998 30.725 28.4 4 22.0 29.775000000000002 23.925 24.3 5 21.0 34.225 25.624999999999996 19.15 6 16.6 36.025 26.3 21.075 7 13.750000000000002 22.275 45.15 18.825 8 16.375 22.7 31.65 29.275000000000002 9 16.725 22.900000000000002 35.099999999999994 25.275 10-14 19.33 30.314999999999998 26.605 23.75 15-19 19.225 29.360000000000003 27.77 23.645 20-24 18.985 29.185 27.500000000000004 24.33 25-29 19.78 28.63 27.74 23.849999999999998 30-34 20.05 29.044999999999998 27.339999999999996 23.565 35-39 19.68 29.275000000000002 27.375 23.669999999999998 40-44 19.735 29.49 27.500000000000004 23.275000000000002 45-49 19.755 28.875 27.685 23.685000000000002 50-54 19.35 29.01 27.755000000000003 23.885 55-59 20.1 29.225 27.305 23.369999999999997 60-64 20.200000000000003 28.215 27.35 24.235 65-69 19.75 28.384999999999998 27.815 24.05 70-74 20.169999999999998 29.09 27.155 23.585 75-79 20.05 28.860000000000003 27.060000000000002 24.03 80-84 20.14 28.694999999999997 27.04 24.125 85-89 20.385 28.265 27.35 24.0 90-94 20.16 28.29 27.534999999999997 24.015 95-99 20.27405481096219 28.130626125225046 27.565513102620525 24.02980596119224 100-104 20.465 28.64 26.77 24.125 105-109 20.79 28.505000000000003 26.950000000000003 23.755000000000003 110-114 20.794999999999998 28.765 26.529999999999998 23.91 115-119 21.29 28.000000000000004 26.8 23.91 120-124 21.38 28.235 26.334999999999997 24.05 125-129 21.18 28.634999999999998 26.095000000000002 24.09 130-134 21.09 27.72 26.200000000000003 24.990000000000002 135-139 21.69 27.834999999999997 26.06 24.415 140-144 21.275 27.43 26.605 24.69 145-149 21.240000000000002 28.17 25.71 24.88 150-151 21.534034034034033 27.615115115115113 26.426426426426424 24.424424424424423 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 2.0 22 3.0 23 5.0 24 7.0 25 6.0 26 9.0 27 15.5 28 18.5 29 19.0 30 28.5 31 35.5 32 47.5 33 64.5 34 80.0 35 90.0 36 106.5 37 121.5 38 120.0 39 150.5 40 170.5 41 180.5 42 213.5 43 242.0 44 237.0 45 219.5 46 223.5 47 230.5 48 222.0 49 203.5 50 180.0 51 150.0 52 119.5 53 99.5 54 92.0 55 76.5 56 66.0 57 47.5 58 28.0 59 20.5 60 13.5 61 11.5 62 6.0 63 3.0 64 3.0 65 0.5 66 0.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.125 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4122919334187 96.075 2 1.1523687580025608 2.25 3 0.20486555697823303 0.6 4 0.15364916773367476 0.6 5 0.02560819462227913 0.125 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.02560819462227913 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) GTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7749999999999999 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0750000000000002 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.875 0.0 0.0 0.0 0.0 96-97 2.2875 0.0 0.0 0.0 0.0 98-99 2.5875000000000004 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.325 0.0 0.0 0.0 0.0 104-105 3.725 0.0 0.0 0.0 0.0 106-107 4.3125 0.0 0.0 0.0 0.0 108-109 4.862500000000001 0.0 0.0 0.0 0.0 110-111 5.324999999999999 0.0 0.0 0.0 0.0 112-113 5.8375 0.0 0.0 0.0 0.0 114-115 6.4625 0.0 0.0 0.0 0.0 116-117 7.025 0.0 0.0 0.0 0.0 118-119 7.7875 0.0 0.0 0.0 0.0 120-121 8.587499999999999 0.0 0.0 0.0 0.0 122-123 9.087499999999999 0.0 0.0 0.0 0.0 124-125 9.7375 0.0 0.0 0.0 0.0 126-127 10.425 0.0 0.0 0.0 0.0 128-129 11.075 0.0 0.0 0.0 0.0 130-131 11.725 0.0 0.0 0.0 0.0 132-133 12.4125 0.0 0.0 0.0 0.0 134-135 13.3 0.0 0.0 0.0 0.0 136-137 14.025 0.0 0.0 0.0 0.0 138-139 14.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCAGT 10 0.006577216 146.82278 1 CCAGTGC 10 0.006832588 144.9875 3 GATTGAA 10 0.006832588 144.9875 5 TTGAAGA 10 0.006832588 144.9875 7 >>END_MODULE SRR7171086 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49925 33.0 32.0 34.0 27.0 34.0 2 32.38875 33.0 33.0 34.0 31.0 34.0 3 32.607 33.0 33.0 34.0 32.0 34.0 4 32.76625 33.0 33.0 34.0 32.0 34.0 5 32.81 34.0 33.0 34.0 32.0 34.0 6 37.006 38.0 38.0 38.0 37.0 38.0 7 37.06775 38.0 38.0 38.0 37.0 38.0 8 37.11025 38.0 38.0 38.0 37.0 38.0 9 37.05575 38.0 38.0 38.0 37.0 38.0 10-14 36.87765 38.0 38.0 38.0 35.8 38.0 15-19 36.91275 38.0 38.0 38.0 36.2 38.0 20-24 35.2364 38.0 35.2 38.0 26.8 38.0 25-29 36.78735 38.0 37.8 38.0 35.6 38.0 30-34 36.98515 38.0 38.0 38.0 36.8 38.0 35-39 36.9379 38.0 38.0 38.0 36.6 38.0 40-44 36.835300000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.6862 38.0 38.0 38.0 35.8 38.0 50-54 36.153949999999995 38.0 37.6 38.0 32.8 38.0 55-59 36.64955 38.0 38.0 38.0 35.6 38.0 60-64 36.6392 38.0 38.0 38.0 35.4 38.0 65-69 36.5145 38.0 38.0 38.0 35.2 38.0 70-74 36.563900000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.52505 38.0 38.0 38.0 34.8 38.0 80-84 35.5768 38.0 36.8 38.0 29.4 38.0 85-89 36.28775 38.0 38.0 38.0 34.0 38.0 90-94 36.37325 38.0 38.0 38.0 34.2 38.0 95-99 36.1971 38.0 38.0 38.0 34.0 38.0 100-104 35.9476 38.0 37.6 38.0 33.0 38.0 105-109 35.19855 38.0 36.4 38.0 27.0 38.0 110-114 35.48395000000001 38.0 36.8 38.0 30.6 38.0 115-119 35.30215 38.0 37.0 38.0 30.2 38.0 120-124 35.07185 38.0 36.2 38.0 29.6 38.0 125-129 34.68554999999999 38.0 35.8 38.0 27.4 38.0 130-134 33.77335 38.0 33.8 38.0 21.8 38.0 135-139 33.2285 38.0 33.2 38.0 17.8 38.0 140-144 32.108850000000004 38.0 32.6 38.0 13.0 38.0 145-149 31.02935 38.0 31.0 38.0 4.0 38.0 150-151 24.8765 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 3.0 5 1.0 6 5.0 7 2.0 8 1.0 9 3.0 10 3.0 11 0.0 12 1.0 13 4.0 14 2.0 15 6.0 16 4.0 17 3.0 18 6.0 19 5.0 20 8.0 21 3.0 22 10.0 23 7.0 24 15.0 25 21.0 26 27.0 27 34.0 28 41.0 29 54.0 30 63.0 31 76.0 32 100.0 33 159.0 34 205.0 35 318.0 36 801.0 37 1991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.849999999999994 22.075 11.35 25.724999999999998 2 25.8 26.224999999999998 32.525 15.45 3 20.325 27.275 32.1 20.3 4 23.65 35.099999999999994 22.45 18.8 5 24.725 38.35 21.15 15.775 6 18.7 39.125 22.650000000000002 19.525000000000002 7 18.4 20.150000000000002 39.525 21.925 8 20.875 25.775 27.750000000000004 25.6 9 22.475 25.45 27.775 24.3 10-14 23.74 29.104999999999997 26.0 21.154999999999998 15-19 23.27 28.15 27.12 21.46 20-24 23.599999999999998 28.499999999999996 27.35 20.549999999999997 25-29 22.845 28.29 27.765 21.099999999999998 30-34 23.095 27.750000000000004 27.985 21.17 35-39 22.595000000000002 28.33 27.950000000000003 21.125 40-44 23.400000000000002 28.134999999999998 28.03 20.435 45-49 22.56 28.365000000000002 27.955000000000002 21.12 50-54 23.21 28.105000000000004 27.965 20.72 55-59 23.315 27.985 28.435 20.265 60-64 23.655 27.185 28.17 20.990000000000002 65-69 24.22 27.37 27.750000000000004 20.66 70-74 23.73 27.779999999999998 27.589999999999996 20.9 75-79 23.68 27.76 27.54 21.02 80-84 23.82 27.705000000000002 27.24 21.235 85-89 24.154999999999998 27.49 27.12 21.235 90-94 23.98 27.99 27.38 20.65 95-99 24.285 28.035 27.13 20.549999999999997 100-104 24.795 27.810000000000002 26.845000000000002 20.549999999999997 105-109 24.485 27.905 27.365000000000002 20.244999999999997 110-114 24.936246812340617 27.961398069903492 27.541377068853446 19.560978048902445 115-119 25.074999999999996 28.105000000000004 26.950000000000003 19.869999999999997 120-124 25.46 27.939999999999998 26.75 19.85 125-129 25.485000000000003 28.005000000000003 27.38 19.13 130-134 26.005 27.265 26.96 19.77 135-139 26.46 27.185 27.02 19.335 140-144 26.145000000000003 28.544999999999998 26.355 18.955 145-149 26.96 28.08 26.25 18.709999999999997 150-151 27.779862414008754 27.717323327079423 25.691056910569106 18.811757348342713 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.0 18 1.5 19 1.0 20 0.5 21 0.5 22 2.5 23 3.5 24 2.5 25 2.5 26 4.0 27 7.5 28 10.5 29 11.5 30 17.5 31 24.5 32 29.0 33 34.5 34 50.0 35 69.0 36 91.0 37 111.5 38 118.0 39 141.5 40 181.5 41 206.5 42 219.5 43 236.0 44 273.5 45 270.5 46 257.0 47 250.0 48 210.0 49 204.5 50 194.0 51 150.5 52 111.0 53 102.0 54 106.5 55 79.5 56 59.0 57 46.5 58 27.0 59 18.5 60 14.5 61 19.0 62 14.5 63 3.5 64 1.0 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5147247119078 96.175 2 1.0243277848911652 2.0 3 0.20486555697823303 0.6 4 0.10243277848911651 0.4 5 0.10243277848911651 0.5 6 0.02560819462227913 0.15 7 0.02560819462227913 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7749999999999999 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.2999999999999998 0.0 0.0 0.0 0.0 92-93 1.5499999999999998 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.2125 0.0 0.0 0.0 0.0 98-99 2.5125 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.175 0.0 0.0 0.0 0.0 104-105 3.525 0.0 0.0 0.0 0.0 106-107 4.0875 0.0 0.0 0.0 0.0 108-109 4.637499999999999 0.0 0.0 0.0 0.0 110-111 5.1 0.0 0.0 0.0 0.0 112-113 5.5875 0.0 0.0 0.0 0.0 114-115 6.1875 0.0 0.0 0.0 0.0 116-117 6.75 0.0 0.0 0.0 0.0 118-119 7.512499999999999 0.0 0.0 0.0 0.0 120-121 8.3125 0.0 0.0 0.0 0.0 122-123 8.875 0.0 0.0 0.0 0.0 124-125 9.5 0.0 0.0 0.0 0.0 126-127 10.1875 0.0 0.0 0.0 0.0 128-129 10.825 0.0 0.0 0.0 0.0 130-131 11.537500000000001 0.0 0.0 0.0 0.0 132-133 12.2375 0.0 0.0 0.0 0.0 134-135 13.15 0.0 0.0 0.0 0.0 136-137 13.9 0.0 0.0 0.0 0.0 138-139 14.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAAG 10 0.006830828 145.0 5 GAACACA 10 0.006830828 145.0 2 >>END_MODULE Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738383 spots for SRR7171086.sra Written 738383 spots for SRR7171086.sra Read 738390 spots for SRR7171086.sra Written 738390 spots for SRR7171086.sra SRR ids: ['SRR7171086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x6qrrks3 SRR7171086.sra spots: 14767667 blocks: [[1, 738383], [738384, 1476766], [1476767, 2215149], [2215150, 2953532], [2953533, 3691915], [3691916, 4430298], [4430299, 5168681], [5168682, 5907064], [5907065, 6645447], [6645448, 7383830], [7383831, 8122213], [8122214, 8860596], [8860597, 9598979], [9598980, 10337362], [10337363, 11075745], [11075746, 11814128], [11814129, 12552511], [12552512, 13290894], [13290895, 14029277], [14029278, 14767667]] SRR7171086 file size 4982577 SRR7171086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171086 SRR7171086_1.fastq SRR7171086_2.fastq Input file: SRR7171086_1.fastq Paired file: SRR7171086_2.fastq trimmed: SRR7171086-trimmed-pair1.fastq, SRR7171086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:07:09 2025 >> started Fri Feb 14 03:07:32 2025 >> done (23.048s) 14767667 read pairs processed; of these: 15346 ( 0.10%) short read pairs filtered out after trimming by size control 46181 ( 0.31%) empty read pairs filtered out after trimming by size control 14706140 (99.58%) read pairs available; of these: 9571308 (65.08%) trimmed read pairs available after processing 5134832 (34.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 11 0.00% 21 8 0.00% 22 4 0.00% 23 10 0.00% 24 12 0.00% 25 17 0.00% 26 10 0.00% 27 5 0.00% 28 19 0.00% 29 22 0.00% 30 35 0.00% 31 25 0.00% 32 37 0.00% 33 28 0.00% 34 37 0.00% 35 34 0.00% 36 37 0.00% 37 56 0.00% 38 57 0.00% 39 78 0.00% 40 94 0.00% 41 83 0.00% 42 97 0.00% 43 109 0.00% 44 115 0.00% 45 134 0.00% 46 163 0.00% 47 177 0.00% 48 237 0.00% 49 277 0.00% 50 312 0.00% 51 352 0.00% 52 375 0.00% 53 436 0.00% 54 440 0.00% 55 435 0.00% 56 598 0.00% 57 604 0.00% 58 713 0.00% 59 775 0.01% 60 964 0.01% 61 1134 0.01% 62 1215 0.01% 63 1398 0.01% 64 1546 0.01% 65 1638 0.01% 66 1653 0.01% 67 1882 0.01% 68 2114 0.01% 69 2376 0.02% 70 2780 0.02% 71 3204 0.02% 72 3686 0.03% 73 4101 0.03% 74 4581 0.03% 75 5269 0.04% 76 6584 0.04% 77 7406 0.05% 78 6813 0.05% 79 7234 0.05% 80 7753 0.05% 81 8888 0.06% 82 9995 0.07% 83 11023 0.07% 84 13108 0.09% 85 14077 0.10% 86 15106 0.10% 87 15325 0.10% 88 16774 0.11% 89 17412 0.12% 90 18833 0.13% 91 20504 0.14% 92 21509 0.15% 93 24356 0.17% 94 25618 0.17% 95 26900 0.18% 96 27629 0.19% 97 28199 0.19% 98 28700 0.20% 99 29705 0.20% 100 31875 0.22% 101 32288 0.22% 102 34638 0.24% 103 36493 0.25% 104 37840 0.26% 105 40087 0.27% 106 40725 0.28% 107 41001 0.28% 108 41402 0.28% 109 43654 0.30% 110 43893 0.30% 111 44470 0.30% 112 46783 0.32% 113 49190 0.33% 114 50796 0.35% 115 52652 0.36% 116 53560 0.36% 117 53835 0.37% 118 54999 0.37% 119 54896 0.37% 120 57367 0.39% 121 58091 0.40% 122 59734 0.41% 123 62170 0.42% 124 64242 0.44% 125 65546 0.45% 126 67899 0.46% 127 69167 0.47% 128 70364 0.48% 129 72008 0.49% 130 73774 0.50% 131 75747 0.52% 132 78255 0.53% 133 82747 0.56% 134 86398 0.59% 135 91641 0.62% 136 96076 0.65% 137 101522 0.69% 138 106933 0.73% 139 111897 0.76% 140 117700 0.80% 141 125664 0.85% 142 135425 0.92% 143 148138 1.01% 144 168914 1.15% 145 197683 1.34% 146 236860 1.61% 147 311216 2.12% 148 473191 3.22% 149 937595 6.38% 150 3826191 26.02% 151 5134832 34.92% 14706140 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=26 fanout-score=26.11 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=9.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=1.58 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=1.61 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=43.53 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7171086 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:08:22 Started mapping on | Feb 14 03:08:23 Finished on | Feb 14 03:10:17 Mapping speed, Million of reads per hour | 464.40 Number of input reads | 14706140 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13565310 Uniquely mapped reads % | 92.24% Average mapped length | 286.21 Number of splices: Total | 12591048 Number of splices: Annotated (sjdb) | 12293532 Number of splices: GT/AG | 12343921 Number of splices: GC/AG | 188019 Number of splices: AT/AC | 10186 Number of splices: Non-canonical | 48922 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433179 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 45438 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.37% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725396 725396 725396 N_multimapping 433179 433179 433179 N_noFeature 439687 13204340 537702 N_ambiguous 383470 768 120306 UnstrandedReadsAssigned:12742153 PositiveStrandReadsAssigned:360202 NegativeStrandReadsAssigned:12907302 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7171086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171086-trimmed-pair1.fastq SRR7171086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,706,140 reads, 12,842,805 reads pseudoaligned [quant] estimated average fragment length: 213.324 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52401 SRR7171086.ke.tsv 34699 SRR7171086.se.tsv 87100 total ==> SRR7171086.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.68 352 9.25135 Potri.005G024800.1.v4.1 1035 822.676 317 18.2866 Potri.004G059700.1.v4.1 961 748.692 10 0.633868 Potri.007G009000.2.v4.1 1416 1203.68 0 0 Potri.003G141000.2.v4.1 2943 2730.68 307 5.33544 Potri.016G087400.1.v4.1 270 96.6686 1589 780.083 Potri.015G069301.1.v4.1 564 354.704 0 0 Potri.010G195200.1.v4.1 1773 1560.68 41 1.24673 Potri.012G127500.1.v4.1 977 764.681 93 5.77171 ==> SRR7171086.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 481 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 432 Potri.001G212900.v4.1 79 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7171086 completed mapping pipeline successfully