Starting /dee2/code/volunteer_pipeline.sh SRR7171087 current disk space = 3088122232832 free memory = 1580056040 SRR7171087 SRAfilesize 37399f4f2a2f66d273d4c055fff0e30d SRR7171087.sra SRR7171087.sra file validated SRR7171087 is paired end SRR7171087 is conventional basespace SRR7171087 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.17075 32.0 18.0 33.0 18.0 33.0 2 28.42575 29.0 25.0 33.0 18.0 33.0 3 30.5935 31.0 29.0 33.0 27.0 33.0 4 31.89925 33.0 31.0 33.0 29.0 33.0 5 32.568 33.0 33.0 33.0 32.0 34.0 6 33.24875 37.0 33.0 38.0 16.0 38.0 7 36.19625 38.0 36.0 38.0 31.0 38.0 8 37.0905 38.0 37.0 38.0 36.0 38.0 9 37.39075 38.0 38.0 38.0 37.0 38.0 10-14 37.46714999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.486850000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.48255 38.0 38.0 38.0 37.2 38.0 25-29 37.302800000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.18325 38.0 38.0 38.0 37.0 38.0 35-39 36.59114999999999 38.0 38.0 38.0 34.4 38.0 40-44 36.98175 38.0 38.0 38.0 36.4 38.0 45-49 36.96705 38.0 38.0 38.0 36.0 38.0 50-54 34.4124 37.2 32.8 38.0 28.0 38.0 55-59 35.98565000000001 37.8 35.8 38.0 32.2 38.0 60-64 36.79605000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.676950000000005 38.0 38.0 38.0 35.2 38.0 70-74 36.5224 38.0 38.0 38.0 34.6 38.0 75-79 36.207499999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.111149999999995 38.0 38.0 38.0 33.8 38.0 85-89 35.8138 38.0 37.8 38.0 33.2 38.0 90-94 35.6864 38.0 37.0 38.0 33.0 38.0 95-99 35.648199999999996 38.0 37.2 38.0 32.6 38.0 100-104 35.441199999999995 38.0 37.0 38.0 31.8 38.0 105-109 35.4425 38.0 37.0 38.0 31.4 38.0 110-114 35.0794 38.0 36.6 38.0 29.4 38.0 115-119 34.764300000000006 38.0 36.0 38.0 27.6 38.0 120-124 34.62265000000001 38.0 36.0 38.0 27.0 38.0 125-129 34.2898 38.0 35.0 38.0 24.4 38.0 130-134 28.625400000000003 32.2 22.0 37.2 15.2 38.0 135-139 32.896 37.2 32.8 38.0 18.6 38.0 140-144 32.96515000000001 38.0 33.8 38.0 14.6 38.0 145-149 31.80155 37.6 31.6 38.0 10.8 38.0 150-151 27.4225 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 6.0 8 4.0 9 1.0 10 3.0 11 1.0 12 1.0 13 5.0 14 7.0 15 9.0 16 3.0 17 16.0 18 21.0 19 20.0 20 11.0 21 9.0 22 8.0 23 12.0 24 14.0 25 14.0 26 23.0 27 15.0 28 31.0 29 41.0 30 49.0 31 76.0 32 90.0 33 153.0 34 234.0 35 497.0 36 1499.0 37 1125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.63053394150791 12.235041588408908 10.222699221894285 26.91172524818889 2 22.225 15.425 33.875 28.475 3 17.224999999999998 23.025000000000002 30.625000000000004 29.125 4 20.125 29.599999999999998 25.775 24.5 5 21.925 32.975 26.05 19.05 6 17.575 34.425 27.55 20.45 7 13.750000000000002 23.724999999999998 44.375 18.15 8 14.674999999999999 25.525 33.0 26.8 9 17.299999999999997 23.7 33.775 25.224999999999998 10-14 19.8 29.84 27.52 22.84 15-19 19.57 29.385 28.24 22.805 20-24 19.35 29.215000000000003 28.79 22.645 25-29 19.495 29.26 28.065 23.18 30-34 18.87 29.360000000000003 28.28 23.49 35-39 18.77 29.065 27.639999999999997 24.525 40-44 19.43 29.465000000000003 28.1 23.005 45-49 19.665 28.625 28.005000000000003 23.705000000000002 50-54 19.715 28.444999999999997 28.77 23.07 55-59 19.105 28.705000000000002 28.660000000000004 23.53 60-64 19.17 28.810000000000002 28.825 23.195 65-69 19.105 29.310000000000002 28.044999999999998 23.54 70-74 19.28 29.03 27.97 23.72 75-79 19.139999999999997 29.439999999999998 27.92 23.5 80-84 18.91 29.765000000000004 27.744999999999997 23.580000000000002 85-89 19.535 29.335 27.650000000000002 23.48 90-94 19.31 28.89 28.175 23.625 95-99 20.200000000000003 28.565 27.375 23.86 100-104 19.48 29.475 27.694999999999997 23.35 105-109 19.435 28.970000000000002 27.950000000000003 23.645 110-114 20.775 28.48 27.465 23.28 115-119 20.115 29.220000000000002 27.305 23.36 120-124 19.99 28.575 26.834999999999997 24.6 125-129 20.525 28.645 27.034999999999997 23.794999999999998 130-134 20.49 29.160000000000004 26.85 23.5 135-139 20.965 28.68 25.945 24.41 140-144 20.39 28.549999999999997 26.71 24.349999999999998 145-149 20.575 28.335 26.365 24.725 150-151 20.2875 29.049999999999997 26.325 24.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 8.5 2 7.0 3 5.5 4 6.0 5 5.0 6 3.5 7 2.5 8 2.0 9 1.0 10 1.0 11 0.5 12 1.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 1.5 20 4.0 21 3.5 22 4.0 23 4.5 24 7.5 25 11.0 26 11.5 27 14.5 28 18.0 29 20.0 30 27.0 31 40.0 32 52.5 33 59.5 34 90.5 35 105.0 36 106.0 37 135.5 38 157.5 39 164.5 40 178.5 41 204.0 42 209.0 43 215.5 44 233.5 45 210.5 46 184.0 47 190.5 48 197.5 49 192.5 50 159.5 51 127.5 52 117.0 53 111.5 54 93.0 55 76.0 56 65.0 57 50.0 58 34.5 59 23.0 60 13.5 61 7.5 62 8.5 63 4.5 64 1.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69130100076983 96.15 2 0.8468052347959968 1.6500000000000001 3 0.30792917628945343 0.8999999999999999 4 0.051321529381575574 0.2 5 0.051321529381575574 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025660764690787787 0.2 9 0.0 0.0 >10 0.025660764690787787 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 26 0.65 TruSeq Adapter, Index 27 (97% over 39bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.275 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.0 0.0 0.0 0.0 0.0 118-119 4.425 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.1875 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 5.9625 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.5875 0.0 0.0 0.0 0.0 132-133 7.15 0.0 0.0 0.0 0.0 134-135 7.8375 0.0 0.0 0.0 0.0 136-137 8.6375 0.0 0.0 0.0 0.0 138-139 9.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171087 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.757 33.0 33.0 34.0 32.0 34.0 2 32.76525 33.0 33.0 34.0 32.0 34.0 3 32.63475 34.0 33.0 34.0 32.0 34.0 4 32.6095 34.0 33.0 34.0 32.0 34.0 5 32.7525 34.0 33.0 34.0 32.0 34.0 6 36.8185 38.0 38.0 38.0 36.0 38.0 7 35.527 38.0 37.0 38.0 29.0 38.0 8 36.50925 38.0 38.0 38.0 34.0 38.0 9 36.631 38.0 38.0 38.0 35.0 38.0 10-14 36.74465 38.0 38.0 38.0 36.0 38.0 15-19 36.6438 38.0 38.0 38.0 35.6 38.0 20-24 36.47670000000001 38.0 38.0 38.0 35.4 38.0 25-29 36.31795 38.0 38.0 38.0 34.0 38.0 30-34 36.5715 38.0 38.0 38.0 35.8 38.0 35-39 36.575599999999994 38.0 38.0 38.0 35.8 38.0 40-44 36.565 38.0 38.0 38.0 35.2 38.0 45-49 35.23725 38.0 35.6 38.0 29.2 38.0 50-54 36.5351 38.0 38.0 38.0 35.2 38.0 55-59 36.4171 38.0 38.0 38.0 35.0 38.0 60-64 36.34265 38.0 38.0 38.0 34.0 38.0 65-69 36.360949999999995 38.0 38.0 38.0 34.2 38.0 70-74 36.3823 38.0 38.0 38.0 34.8 38.0 75-79 36.36109999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.031150000000004 38.0 38.0 38.0 33.8 38.0 85-89 35.94425 38.0 38.0 38.0 34.0 38.0 90-94 35.8488 38.0 38.0 38.0 33.4 38.0 95-99 35.757400000000004 38.0 38.0 38.0 33.0 38.0 100-104 35.5161 38.0 37.4 38.0 31.8 38.0 105-109 35.21065 38.0 37.0 38.0 29.8 38.0 110-114 33.119550000000004 37.8 32.2 38.0 21.0 38.0 115-119 34.903999999999996 38.0 35.8 38.0 28.0 38.0 120-124 34.67425000000001 38.0 35.8 38.0 26.4 38.0 125-129 34.4056 38.0 35.6 38.0 25.2 38.0 130-134 34.14685 38.0 34.8 38.0 23.6 38.0 135-139 33.4758 38.0 33.2 38.0 20.2 38.0 140-144 32.77415 38.0 33.0 38.0 14.8 38.0 145-149 31.4767 38.0 32.2 38.0 6.4 38.0 150-151 26.193375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 6.0 5 3.0 6 1.0 7 0.0 8 4.0 9 3.0 10 3.0 11 3.0 12 2.0 13 7.0 14 12.0 15 5.0 16 7.0 17 9.0 18 9.0 19 16.0 20 8.0 21 5.0 22 9.0 23 13.0 24 17.0 25 23.0 26 32.0 27 26.0 28 38.0 29 53.0 30 64.0 31 49.0 32 102.0 33 104.0 34 188.0 35 321.0 36 791.0 37 2044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.275000000000006 20.575 11.625 18.525 2 27.800000000000004 23.9 29.675 18.625 3 23.575 24.925 32.550000000000004 18.95 4 24.831207801950487 33.50837709427357 22.330582645661416 19.32983245811453 5 25.424999999999997 37.6 20.05 16.925 6 22.925 36.7 20.8 19.575 7 20.575 21.15 38.475 19.8 8 21.25 25.8 27.6 25.35 9 23.025000000000002 24.4 28.075 24.5 10-14 24.86 27.860000000000003 26.369999999999997 20.91 15-19 23.93 27.96 27.0 21.11 20-24 24.395 28.355000000000004 26.915 20.335 25-29 23.605 28.99 27.310000000000002 20.095 30-34 24.18 27.705000000000002 27.529999999999998 20.585 35-39 24.285 27.85 27.32 20.544999999999998 40-44 24.26 27.255000000000003 27.875 20.61 45-49 23.71 28.025 27.625 20.64 50-54 23.849999999999998 27.21 28.744999999999997 20.195 55-59 24.575 27.27 27.67 20.485 60-64 23.685000000000002 27.445000000000004 28.315 20.555 65-69 23.875 27.015 28.605000000000004 20.505000000000003 70-74 23.625 28.345 27.534999999999997 20.495 75-79 24.11 28.455000000000002 26.995 20.44 80-84 23.990000000000002 27.21 28.335 20.465 85-89 23.705000000000002 27.965 28.505000000000003 19.825 90-94 24.005000000000003 27.900000000000002 28.299999999999997 19.794999999999998 95-99 23.78 27.855 28.415000000000003 19.950000000000003 100-104 24.27 27.68 28.055000000000003 19.994999999999997 105-109 24.560000000000002 27.400000000000002 28.595 19.445 110-114 24.285 28.365000000000002 27.765 19.585 115-119 24.955 28.565 26.935 19.545 120-124 24.795 28.360000000000003 27.565 19.28 125-129 24.740000000000002 28.315 27.450000000000003 19.495 130-134 24.745 28.32 27.134999999999998 19.8 135-139 25.435000000000002 28.405 26.96 19.2 140-144 25.795 28.025 27.405 18.775 145-149 26.745 28.08 25.900000000000002 19.275000000000002 150-151 26.474999999999998 28.050000000000004 26.400000000000002 19.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 1.0 14 0.5 15 2.0 16 2.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 2.5 24 2.5 25 3.0 26 7.5 27 10.0 28 9.0 29 11.0 30 13.5 31 22.5 32 32.5 33 39.5 34 53.0 35 66.5 36 78.5 37 107.5 38 129.5 39 144.0 40 180.0 41 200.0 42 212.5 43 237.5 44 244.5 45 255.0 46 261.5 47 242.0 48 205.0 49 183.5 50 166.5 51 154.5 52 150.0 53 117.0 54 108.5 55 107.0 56 76.0 57 46.5 58 31.5 59 25.5 60 16.5 61 10.0 62 11.0 63 7.5 64 2.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8994113130279 96.6 2 0.7678525723061171 1.5 3 0.12797542871768622 0.375 4 0.07678525723061172 0.3 5 0.05119017148707448 0.25 6 0.02559508574353724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02559508574353724 0.22499999999999998 >10 0.02559508574353724 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 24 0.6 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTCGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) GTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCA 5 0.125 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4249999999999998 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.2125 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5625 0.0 0.0 0.0 0.0 116-117 3.9875 0.0 0.0 0.0 0.0 118-119 4.425 0.0 0.0 0.0 0.0 120-121 4.9375 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.175 0.0 0.0 0.0 0.0 126-127 6.9875 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.225 0.0 0.0 0.0 0.0 132-133 8.9625 0.0 0.0 0.0 0.0 134-135 9.725 0.0 0.0 0.0 0.0 136-137 10.5125 0.0 0.0 0.0 0.0 138-139 11.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGAT 10 0.006830828 145.0 1 GGACGAA 10 0.006830828 145.0 145 AAAAAAA 220 0.009102302 6.5909095 145 >>END_MODULE Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785600 spots for SRR7171087.sra Written 785600 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra Read 785598 spots for SRR7171087.sra Written 785598 spots for SRR7171087.sra SRR ids: ['SRR7171087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_98a1y2hr SRR7171087.sra spots: 15711962 blocks: [[1, 785598], [785599, 1571196], [1571197, 2356794], [2356795, 3142392], [3142393, 3927990], [3927991, 4713588], [4713589, 5499186], [5499187, 6284784], [6284785, 7070382], [7070383, 7855980], [7855981, 8641578], [8641579, 9427176], [9427177, 10212774], [10212775, 10998372], [10998373, 11783970], [11783971, 12569568], [12569569, 13355166], [13355167, 14140764], [14140765, 14926362], [14926363, 15711962]] SRR7171087 file size 5302567 SRR7171087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171087 SRR7171087_1.fastq SRR7171087_2.fastq Input file: SRR7171087_1.fastq Paired file: SRR7171087_2.fastq trimmed: SRR7171087-trimmed-pair1.fastq, SRR7171087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:15:54 2025 >> started Fri Feb 14 03:16:15 2025 >> done (21.768s) 15711962 read pairs processed; of these: 35335 ( 0.22%) short read pairs filtered out after trimming by size control 105413 ( 0.67%) empty read pairs filtered out after trimming by size control 15571214 (99.10%) read pairs available; of these: 9543403 (61.29%) trimmed read pairs available after processing 6027811 (38.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 17 0.00% 20 28 0.00% 21 49 0.00% 22 39 0.00% 23 65 0.00% 24 79 0.00% 25 74 0.00% 26 49 0.00% 27 63 0.00% 28 59 0.00% 29 58 0.00% 30 56 0.00% 31 60 0.00% 32 68 0.00% 33 50 0.00% 34 42 0.00% 35 49 0.00% 36 50 0.00% 37 45 0.00% 38 56 0.00% 39 70 0.00% 40 89 0.00% 41 93 0.00% 42 95 0.00% 43 77 0.00% 44 86 0.00% 45 129 0.00% 46 126 0.00% 47 159 0.00% 48 213 0.00% 49 231 0.00% 50 267 0.00% 51 298 0.00% 52 342 0.00% 53 354 0.00% 54 418 0.00% 55 422 0.00% 56 490 0.00% 57 545 0.00% 58 578 0.00% 59 622 0.00% 60 688 0.00% 61 796 0.01% 62 851 0.01% 63 963 0.01% 64 1017 0.01% 65 1038 0.01% 66 1020 0.01% 67 1290 0.01% 68 1336 0.01% 69 1569 0.01% 70 1778 0.01% 71 1956 0.01% 72 2216 0.01% 73 2456 0.02% 74 2780 0.02% 75 3174 0.02% 76 4204 0.03% 77 5562 0.04% 78 4870 0.03% 79 4735 0.03% 80 5013 0.03% 81 5578 0.04% 82 6309 0.04% 83 7483 0.05% 84 9847 0.06% 85 11665 0.07% 86 13538 0.09% 87 15454 0.10% 88 16462 0.11% 89 16404 0.11% 90 16378 0.11% 91 16597 0.11% 92 17046 0.11% 93 18393 0.12% 94 18844 0.12% 95 20257 0.13% 96 20751 0.13% 97 21241 0.14% 98 21943 0.14% 99 22921 0.15% 100 25873 0.17% 101 26155 0.17% 102 28183 0.18% 103 30290 0.19% 104 32196 0.21% 105 34646 0.22% 106 35187 0.23% 107 36612 0.24% 108 37888 0.24% 109 41083 0.26% 110 41911 0.27% 111 43064 0.28% 112 45845 0.29% 113 49315 0.32% 114 49740 0.32% 115 51856 0.33% 116 53883 0.35% 117 54131 0.35% 118 55592 0.36% 119 55582 0.36% 120 57821 0.37% 121 58931 0.38% 122 60420 0.39% 123 62677 0.40% 124 66295 0.43% 125 67066 0.43% 126 69544 0.45% 127 70414 0.45% 128 71768 0.46% 129 74899 0.48% 130 76595 0.49% 131 77877 0.50% 132 81219 0.52% 133 85106 0.55% 134 89587 0.58% 135 95281 0.61% 136 99041 0.64% 137 104298 0.67% 138 108809 0.70% 139 115375 0.74% 140 120864 0.78% 141 132263 0.85% 142 143492 0.92% 143 161172 1.04% 144 185955 1.19% 145 217370 1.40% 146 267652 1.72% 147 354650 2.28% 148 527319 3.39% 149 971376 6.24% 150 3686045 23.67% 151 6027811 38.71% 15571214 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=25 prefix-density=0.52 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=48.64 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.4 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=19 prefix-density=1.28 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTAGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=42.66 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR7171087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:17:00 Started mapping on | Feb 14 03:17:00 Finished on | Feb 14 03:19:27 Mapping speed, Million of reads per hour | 381.34 Number of input reads | 15571214 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14081210 Uniquely mapped reads % | 90.43% Average mapped length | 288.65 Number of splices: Total | 12235426 Number of splices: Annotated (sjdb) | 11958707 Number of splices: GT/AG | 11995946 Number of splices: GC/AG | 184155 Number of splices: AT/AC | 9534 Number of splices: Non-canonical | 45791 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 379493 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 45295 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.68% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1163090 1163090 1163090 N_multimapping 379493 379493 379493 N_noFeature 476077 13647105 603013 N_ambiguous 409036 1129 101553 UnstrandedReadsAssigned:13196097 PositiveStrandReadsAssigned:432976 NegativeStrandReadsAssigned:13376644 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171087-trimmed-pair1.fastq SRR7171087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,571,214 reads, 13,272,257 reads pseudoaligned [quant] estimated average fragment length: 211.355 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52401 SRR7171087.ke.tsv 34699 SRR7171087.se.tsv 87100 total ==> SRR7171087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.64 433 11.772 Potri.005G024800.1.v4.1 1035 824.645 300 17.8784 Potri.004G059700.1.v4.1 961 750.65 15 0.982038 Potri.007G009000.2.v4.1 1416 1205.64 0 0 Potri.003G141000.2.v4.1 2943 2732.64 765.389 13.7649 Potri.016G087400.1.v4.1 270 92.3487 1121 596.554 Potri.015G069301.1.v4.1 564 355.818 0 0 Potri.010G195200.1.v4.1 1773 1562.64 49 1.54103 Potri.012G127500.1.v4.1 977 766.645 206 13.2053 ==> SRR7171087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 474 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 404 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 87 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7171087 completed mapping pipeline successfully