Starting /dee2/code/volunteer_pipeline.sh SRR7171088 current disk space = 3088050995200 free memory = 1509688400 SRR7171088 SRAfilesize 3d8c93d09ccae79f7c7b5001dfdaee5f SRR7171088.sra SRR7171088.sra file validated SRR7171088 is paired end SRR7171088 is conventional basespace SRR7171088 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.86575 18.0 18.0 30.0 18.0 33.0 2 29.10125 30.0 27.0 31.0 25.0 33.0 3 30.938 33.0 30.0 33.0 27.0 33.0 4 32.106 33.0 33.0 33.0 30.0 33.0 5 32.5605 33.0 33.0 34.0 31.0 34.0 6 36.6655 38.0 37.0 38.0 34.0 38.0 7 37.10125 38.0 38.0 38.0 36.0 38.0 8 37.30375 38.0 38.0 38.0 37.0 38.0 9 37.441 38.0 38.0 38.0 37.0 38.0 10-14 37.4898 38.0 38.0 38.0 37.0 38.0 15-19 37.472449999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.5476 38.0 38.0 38.0 37.8 38.0 25-29 37.102 38.0 38.0 38.0 36.0 38.0 30-34 37.2108 38.0 38.0 38.0 36.2 38.0 35-39 36.27675000000001 38.0 36.8 38.0 31.2 38.0 40-44 37.31425 38.0 38.0 38.0 37.0 38.0 45-49 36.7375 38.0 37.6 38.0 34.4 38.0 50-54 37.1571 38.0 38.0 38.0 36.4 38.0 55-59 37.16955 38.0 38.0 38.0 36.4 38.0 60-64 36.5774 38.0 37.6 38.0 33.6 38.0 65-69 36.05049999999999 38.0 36.4 38.0 30.2 38.0 70-74 36.45175 38.0 37.6 38.0 32.8 38.0 75-79 36.886300000000006 38.0 38.0 38.0 35.6 38.0 80-84 36.820499999999996 38.0 38.0 38.0 35.2 38.0 85-89 35.628750000000004 38.0 35.8 38.0 30.4 38.0 90-94 35.9424 38.0 36.6 38.0 31.8 38.0 95-99 35.027699999999996 38.0 35.6 38.0 26.0 38.0 100-104 36.14935 38.0 37.0 38.0 32.6 38.0 105-109 36.2178 38.0 37.2 38.0 33.6 38.0 110-114 34.969800000000006 38.0 35.4 38.0 26.2 38.0 115-119 32.26455 35.0 29.2 37.8 22.8 38.0 120-124 35.48055 38.0 36.0 38.0 30.6 38.0 125-129 35.202600000000004 38.0 36.0 38.0 30.0 38.0 130-134 34.0794 38.0 33.6 38.0 22.8 38.0 135-139 34.389500000000005 38.0 33.8 38.0 25.8 38.0 140-144 33.809450000000005 38.0 33.0 38.0 23.6 38.0 145-149 30.278399999999998 36.0 27.4 38.0 8.0 38.0 150-151 26.3155 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 0.0 17 2.0 18 2.0 19 3.0 20 3.0 21 1.0 22 10.0 23 5.0 24 10.0 25 18.0 26 25.0 27 25.0 28 43.0 29 42.0 30 56.0 31 76.0 32 101.0 33 174.0 34 295.0 35 616.0 36 1416.0 37 1071.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.626694473409806 16.319082377476537 8.94160583941606 38.1126173096976 2 19.25 17.325 38.074999999999996 25.35 3 16.975 23.0 28.425 31.6 4 23.1 32.074999999999996 23.05 21.775 5 20.305076269067268 36.809202300575144 24.281070267566893 18.6046511627907 6 17.65 35.575 26.575 20.200000000000003 7 13.875000000000002 22.650000000000002 44.05 19.425 8 16.650000000000002 22.45 32.45 28.449999999999996 9 16.400000000000002 24.4 33.15 26.05 10-14 19.93 29.854999999999997 26.56 23.655 15-19 19.835 28.76 27.77 23.635 20-24 19.634999999999998 28.79 27.855 23.72 25-29 19.495 28.79 27.224999999999998 24.490000000000002 30-34 19.650000000000002 28.62 28.15 23.580000000000002 35-39 19.980999049952498 28.506425321266065 28.196409820491024 23.316165808290414 40-44 20.085 28.325 27.875 23.715 45-49 20.485 28.035 27.505000000000003 23.974999999999998 50-54 20.365 28.544999999999998 27.685 23.405 55-59 20.385 28.51 27.689999999999998 23.415 60-64 20.61 28.265 27.805000000000003 23.32 65-69 19.855 28.365000000000002 28.035 23.745 70-74 20.21 28.015 27.694999999999997 24.08 75-79 20.695 28.335 27.744999999999997 23.225 80-84 20.536026801340068 28.291414570728534 27.67638381919096 23.496174808740435 85-89 20.603090463569533 28.004200630094516 27.56413462019303 23.82857428614292 90-94 20.431021551077556 27.83639181959098 27.60638031901595 24.126206310315514 95-99 21.05 28.310000000000002 27.26 23.380000000000003 100-104 20.96709670967097 28.232823282328233 27.437743774377438 23.362336233623363 105-109 21.16 28.499999999999996 26.93 23.41 110-114 20.86 28.105000000000004 27.139999999999997 23.895 115-119 21.05 28.505000000000003 27.125 23.32 120-124 20.991049552477623 28.026401320066004 26.74633731686584 24.23621181059053 125-129 20.72603630181509 27.471373568678437 27.931396569828493 23.871193559677984 130-134 21.465 27.939999999999998 27.04 23.555 135-139 21.49107455372769 27.60638031901595 27.29136456822841 23.611180559027954 140-144 20.796039801990098 27.456372818640933 27.13635681784089 24.611230561528078 145-149 21.26 28.194999999999997 26.02 24.525 150-151 21.177647205900737 28.79109888736092 26.615826978372297 23.415426928366045 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 5.0 26 5.5 27 4.5 28 11.5 29 19.5 30 23.0 31 31.5 32 41.0 33 48.5 34 63.0 35 76.5 36 88.0 37 118.0 38 147.5 39 163.5 40 184.5 41 216.0 42 233.5 43 231.5 44 230.0 45 242.0 46 254.0 47 250.0 48 226.5 49 204.5 50 188.5 51 153.0 52 118.0 53 89.5 54 79.0 55 71.0 56 50.0 57 37.0 58 28.5 59 21.5 60 15.5 61 8.5 62 4.5 63 3.5 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.1000000000000005 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.65 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.612500000000001 0.0 0.0 0.0 0.0 132-133 6.1125 0.0 0.0 0.0 0.0 134-135 6.5125 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171088 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8365 33.0 33.0 34.0 32.0 34.0 2 32.76625 33.0 33.0 34.0 32.0 34.0 3 32.912 34.0 33.0 34.0 32.0 34.0 4 32.829 34.0 33.0 34.0 32.0 34.0 5 32.88225 34.0 33.0 34.0 32.0 34.0 6 37.02025 38.0 38.0 38.0 37.0 38.0 7 37.15525 38.0 38.0 38.0 37.0 38.0 8 37.1295 38.0 38.0 38.0 37.0 38.0 9 37.1545 38.0 38.0 38.0 37.0 38.0 10-14 37.07685 38.0 38.0 38.0 36.8 38.0 15-19 37.08155000000001 38.0 38.0 38.0 36.8 38.0 20-24 36.7941 38.0 38.0 38.0 35.4 38.0 25-29 37.09605 38.0 38.0 38.0 37.0 38.0 30-34 37.069700000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.01875 38.0 38.0 38.0 36.4 38.0 40-44 36.93005 38.0 38.0 38.0 36.2 38.0 45-49 36.76995000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.84755 38.0 38.0 38.0 36.0 38.0 55-59 36.8354 38.0 38.0 38.0 36.0 38.0 60-64 36.76005 38.0 38.0 38.0 35.8 38.0 65-69 36.809749999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.7506 38.0 38.0 38.0 35.4 38.0 75-79 36.581250000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.4651 38.0 38.0 38.0 34.4 38.0 85-89 36.461349999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.364549999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.25075 38.0 38.0 38.0 34.0 38.0 100-104 36.0728 38.0 37.6 38.0 33.2 38.0 105-109 35.85695 38.0 37.0 38.0 32.8 38.0 110-114 35.655199999999994 38.0 37.0 38.0 31.0 38.0 115-119 35.39985 38.0 36.4 38.0 30.6 38.0 120-124 35.1971 38.0 36.0 38.0 31.0 38.0 125-129 34.623450000000005 38.0 36.0 38.0 27.0 38.0 130-134 34.46425000000001 38.0 35.6 38.0 26.6 38.0 135-139 33.725350000000006 38.0 33.6 38.0 22.6 38.0 140-144 32.481350000000006 38.0 32.6 38.0 14.4 38.0 145-149 31.560399999999998 38.0 31.6 38.0 8.6 38.0 150-151 25.11725 32.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 4.0 5 0.0 6 0.0 7 1.0 8 0.0 9 3.0 10 1.0 11 2.0 12 3.0 13 1.0 14 2.0 15 3.0 16 6.0 17 3.0 18 7.0 19 7.0 20 12.0 21 6.0 22 8.0 23 8.0 24 16.0 25 32.0 26 24.0 27 14.0 28 29.0 29 42.0 30 52.0 31 55.0 32 82.0 33 121.0 34 203.0 35 298.0 36 778.0 37 2166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 19.125 12.075 28.65 2 24.95 25.974999999999998 33.275 15.8 3 20.200000000000003 27.750000000000004 32.0 20.05 4 23.599999999999998 34.275 22.8 19.325 5 22.400000000000002 38.2 21.85 17.549999999999997 6 20.674999999999997 38.175 22.875 18.275 7 18.625 19.25 40.625 21.5 8 21.349999999999998 24.55 27.975 26.125 9 21.5 24.525 30.15 23.825 10-14 23.630000000000003 28.26 26.31 21.8 15-19 23.055 28.110000000000003 27.810000000000002 21.025 20-24 22.68 28.439999999999998 28.15 20.73 25-29 22.395 28.605000000000004 27.694999999999997 21.305 30-34 23.165 28.470000000000002 27.365000000000002 21.0 35-39 23.064999999999998 27.71 28.565 20.66 40-44 23.22 27.445000000000004 28.225 21.11 45-49 23.18 27.24 28.349999999999998 21.23 50-54 22.814999999999998 27.950000000000003 27.55 21.685 55-59 23.375 28.42 27.185 21.02 60-64 22.835 27.534999999999997 28.115000000000002 21.515 65-69 23.724999999999998 27.755000000000003 27.46 21.060000000000002 70-74 23.974999999999998 27.235 27.51 21.279999999999998 75-79 23.095 27.485 27.889999999999997 21.529999999999998 80-84 23.125 27.965 27.595 21.315 85-89 23.61 27.355 27.935 21.099999999999998 90-94 23.53 28.044999999999998 27.384999999999998 21.04 95-99 23.7 27.88 27.575 20.845 100-104 23.485 27.810000000000002 27.900000000000002 20.805 105-109 23.915 27.85 27.525 20.71 110-114 23.52 28.1 27.735 20.645 115-119 24.26 28.03 27.169999999999998 20.54 120-124 23.945 27.91 27.284999999999997 20.86 125-129 24.145 27.55 27.839999999999996 20.465 130-134 24.525 27.400000000000002 27.584999999999997 20.49 135-139 24.89 27.665 27.575 19.869999999999997 140-144 25.045 27.744999999999997 26.39 20.82 145-149 25.424999999999997 27.765 26.695 20.115 150-151 25.834688008003 27.260222583468803 26.760035013129922 20.145054395398272 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 2.0 22 1.0 23 2.0 24 2.0 25 4.0 26 6.5 27 6.0 28 8.5 29 10.5 30 17.0 31 25.0 32 31.5 33 41.0 34 48.5 35 64.5 36 77.5 37 94.5 38 124.5 39 151.0 40 171.5 41 202.0 42 243.5 43 260.0 44 263.0 45 264.5 46 268.0 47 259.0 48 224.0 49 192.5 50 189.0 51 171.0 52 130.5 53 105.0 54 81.0 55 64.0 56 51.5 57 42.5 58 31.0 59 22.0 60 17.5 61 8.5 62 5.5 63 5.0 64 3.0 65 2.0 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26841574167507 98.375 2 0.554994954591322 1.0999999999999999 3 0.17658930373360243 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.3499999999999996 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.025 0.0 120-121 3.85 0.0 0.0 0.025 0.0 122-123 4.2 0.0 0.0 0.025 0.0 124-125 4.6625 0.0 0.0 0.025 0.0 126-127 5.1375 0.0 0.0 0.025 0.0 128-129 5.65 0.0 0.0 0.025 0.0 130-131 6.137499999999999 0.0 0.0 0.025 0.0 132-133 6.6375 0.0 0.0 0.025 0.0 134-135 7.0375 0.0 0.0 0.025 0.0 136-137 7.425000000000001 0.0 0.0 0.025 0.0 138-139 8.075 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGATC 10 0.006830828 145.0 145 >>END_MODULE Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872143 spots for SRR7171088.sra Written 872143 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra Read 872128 spots for SRR7171088.sra Written 872128 spots for SRR7171088.sra SRR ids: ['SRR7171088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e_i1bd48 SRR7171088.sra spots: 17442575 blocks: [[1, 872128], [872129, 1744256], [1744257, 2616384], [2616385, 3488512], [3488513, 4360640], [4360641, 5232768], [5232769, 6104896], [6104897, 6977024], [6977025, 7849152], [7849153, 8721280], [8721281, 9593408], [9593409, 10465536], [10465537, 11337664], [11337665, 12209792], [12209793, 13081920], [13081921, 13954048], [13954049, 14826176], [14826177, 15698304], [15698305, 16570432], [16570433, 17442575]] SRR7171088 file size 5889015 SRR7171088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171088 SRR7171088_1.fastq SRR7171088_2.fastq Input file: SRR7171088_1.fastq Paired file: SRR7171088_2.fastq trimmed: SRR7171088-trimmed-pair1.fastq, SRR7171088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 02:55:14 2025 >> started Fri Feb 14 02:55:42 2025 >> done (27.943s) 17442575 read pairs processed; of these: 15149 ( 0.09%) short read pairs filtered out after trimming by size control 21657 ( 0.12%) empty read pairs filtered out after trimming by size control 17405769 (99.79%) read pairs available; of these: 10557907 (60.66%) trimmed read pairs available after processing 6847862 (39.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 8 0.00% 21 8 0.00% 22 10 0.00% 23 9 0.00% 24 11 0.00% 25 5 0.00% 26 12 0.00% 27 12 0.00% 28 9 0.00% 29 17 0.00% 30 13 0.00% 31 14 0.00% 32 13 0.00% 33 15 0.00% 34 17 0.00% 35 21 0.00% 36 15 0.00% 37 30 0.00% 38 28 0.00% 39 32 0.00% 40 35 0.00% 41 36 0.00% 42 32 0.00% 43 45 0.00% 44 46 0.00% 45 58 0.00% 46 54 0.00% 47 76 0.00% 48 65 0.00% 49 97 0.00% 50 110 0.00% 51 132 0.00% 52 138 0.00% 53 128 0.00% 54 166 0.00% 55 168 0.00% 56 176 0.00% 57 202 0.00% 58 237 0.00% 59 253 0.00% 60 353 0.00% 61 363 0.00% 62 428 0.00% 63 437 0.00% 64 549 0.00% 65 585 0.00% 66 692 0.00% 67 710 0.00% 68 753 0.00% 69 900 0.01% 70 1045 0.01% 71 1227 0.01% 72 1308 0.01% 73 1604 0.01% 74 1847 0.01% 75 2096 0.01% 76 3031 0.02% 77 2876 0.02% 78 2715 0.02% 79 3006 0.02% 80 3246 0.02% 81 3849 0.02% 82 4382 0.03% 83 4938 0.03% 84 6003 0.03% 85 6955 0.04% 86 7510 0.04% 87 8167 0.05% 88 8762 0.05% 89 9375 0.05% 90 9941 0.06% 91 10867 0.06% 92 11671 0.07% 93 12879 0.07% 94 13988 0.08% 95 14845 0.09% 96 15388 0.09% 97 16404 0.09% 98 17244 0.10% 99 17977 0.10% 100 19274 0.11% 101 20531 0.12% 102 22030 0.13% 103 23041 0.13% 104 24663 0.14% 105 25761 0.15% 106 27011 0.16% 107 28098 0.16% 108 29332 0.17% 109 30243 0.17% 110 31105 0.18% 111 32236 0.19% 112 33957 0.20% 113 35555 0.20% 114 37143 0.21% 115 39188 0.23% 116 40094 0.23% 117 41087 0.24% 118 42865 0.25% 119 43997 0.25% 120 45337 0.26% 121 47579 0.27% 122 48728 0.28% 123 51299 0.29% 124 53229 0.31% 125 55101 0.32% 126 57707 0.33% 127 59752 0.34% 128 61815 0.36% 129 64512 0.37% 130 66894 0.38% 131 70198 0.40% 132 73660 0.42% 133 77753 0.45% 134 83059 0.48% 135 88058 0.51% 136 94547 0.54% 137 101620 0.58% 138 108421 0.62% 139 117468 0.67% 140 126411 0.73% 141 138023 0.79% 142 151794 0.87% 143 171332 0.98% 144 197804 1.14% 145 235208 1.35% 146 289294 1.66% 147 384285 2.21% 148 587994 3.38% 149 1150186 6.61% 150 4838144 27.80% 151 6847862 39.34% 17405769 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=21 prefix-density=0.65 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=343.72 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=19 prefix-density=0.42 prefix-fanout=2.6 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=30.09 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.8 sequence=ACTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGACTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTA SRR7171088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 02:56:25 Started mapping on | Feb 14 02:56:25 Finished on | Feb 14 02:58:09 Mapping speed, Million of reads per hour | 602.51 Number of input reads | 17405769 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16475688 Uniquely mapped reads % | 94.66% Average mapped length | 291.48 Number of splices: Total | 15407523 Number of splices: Annotated (sjdb) | 15080430 Number of splices: GT/AG | 15079919 Number of splices: GC/AG | 275278 Number of splices: AT/AC | 9751 Number of splices: Non-canonical | 42575 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 525143 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 44753 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 421099 421099 421099 N_multimapping 525143 525143 525143 N_noFeature 601243 16228305 697100 N_ambiguous 261401 1004 109266 UnstrandedReadsAssigned:15613044 PositiveStrandReadsAssigned:246379 NegativeStrandReadsAssigned:15669322 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171088-trimmed-pair1.fastq SRR7171088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,405,769 reads, 15,714,217 reads pseudoaligned [quant] estimated average fragment length: 230.317 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7171088.ke.tsv 34699 SRR7171088.se.tsv 87100 total ==> SRR7171088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.68 650 21.2041 Potri.005G024800.1.v4.1 1035 805.683 348 25.2031 Potri.004G059700.1.v4.1 961 731.711 10 0.797444 Potri.007G009000.2.v4.1 1416 1186.68 0 0 Potri.003G141000.2.v4.1 2943 2713.68 587 12.6217 Potri.016G087400.1.v4.1 270 85.3996 938 640.895 Potri.015G069301.1.v4.1 564 338.42 0 0 Potri.010G195200.1.v4.1 1773 1543.68 15 0.566986 Potri.012G127500.1.v4.1 977 747.705 679 52.9882 ==> SRR7171088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 239 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 94 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR7171088 completed mapping pipeline successfully