Starting /dee2/code/volunteer_pipeline.sh SRR7171089 current disk space = 3088127578112 free memory = 1581897248 SRR7171089 SRAfilesize b3e7dc892e1ab1ab9a73028ce5f61a69 SRR7171089.sra SRR7171089.sra file validated SRR7171089 is paired end SRR7171089 is conventional basespace SRR7171089 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.8165 18.0 18.0 30.0 18.0 32.0 2 30.43375 31.0 29.0 33.0 27.0 33.0 3 31.577 33.0 31.0 33.0 29.0 33.0 4 32.2295 33.0 33.0 33.0 31.0 34.0 5 32.89 33.0 33.0 34.0 31.0 34.0 6 37.127 38.0 37.0 38.0 36.0 38.0 7 37.3525 38.0 38.0 38.0 37.0 38.0 8 37.43875 38.0 38.0 38.0 37.0 38.0 9 37.506 38.0 38.0 38.0 38.0 38.0 10-14 37.5092 38.0 38.0 38.0 37.8 38.0 15-19 37.51065 38.0 38.0 38.0 37.8 38.0 20-24 37.497 38.0 38.0 38.0 38.0 38.0 25-29 37.06685 38.0 38.0 38.0 35.6 38.0 30-34 37.18745 38.0 38.0 38.0 36.2 38.0 35-39 36.18495 38.0 36.4 38.0 31.2 38.0 40-44 37.30355 38.0 38.0 38.0 37.0 38.0 45-49 36.69995 38.0 37.4 38.0 34.4 38.0 50-54 37.158699999999996 38.0 38.0 38.0 36.6 38.0 55-59 37.15379999999999 38.0 38.0 38.0 36.4 38.0 60-64 36.5283 38.0 37.4 38.0 33.8 38.0 65-69 35.9733 38.0 36.0 38.0 30.2 38.0 70-74 36.385200000000005 38.0 37.4 38.0 32.4 38.0 75-79 36.86745 38.0 38.0 38.0 35.4 38.0 80-84 36.766200000000005 38.0 38.0 38.0 35.0 38.0 85-89 35.52855 38.0 35.6 38.0 30.4 38.0 90-94 35.865300000000005 38.0 36.2 38.0 31.4 38.0 95-99 35.29209999999999 38.0 36.0 38.0 25.4 38.0 100-104 36.06555 38.0 37.0 38.0 32.4 38.0 105-109 36.2007 38.0 37.4 38.0 33.6 38.0 110-114 35.0851 38.0 35.6 38.0 26.4 38.0 115-119 32.141149999999996 34.8 29.2 37.8 23.0 38.0 120-124 35.5065 38.0 36.2 38.0 31.0 38.0 125-129 35.29375 38.0 36.0 38.0 30.6 38.0 130-134 34.19500000000001 38.0 33.6 38.0 23.6 38.0 135-139 34.340999999999994 38.0 33.4 38.0 26.6 38.0 140-144 33.792500000000004 38.0 33.4 38.0 23.0 38.0 145-149 30.1175 36.0 27.0 38.0 8.0 38.0 150-151 26.440875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 4.0 16 2.0 17 7.0 18 3.0 19 0.0 20 6.0 21 2.0 22 4.0 23 7.0 24 12.0 25 16.0 26 19.0 27 25.0 28 41.0 29 39.0 30 54.0 31 86.0 32 101.0 33 175.0 34 254.0 35 551.0 36 1460.0 37 1125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75619295958279 14.289439374185136 9.830508474576272 35.123859191655804 2 19.650000000000002 17.625 37.225 25.5 3 17.00425106276569 24.831207801950487 27.556889222305575 30.607651912978245 4 22.2 31.85 24.4 21.55 5 21.05526381595399 36.284071017754435 24.256064016004 18.404601150287572 6 16.900000000000002 35.699999999999996 26.174999999999997 21.224999999999998 7 13.55 22.400000000000002 45.725 18.325 8 16.950000000000003 23.35 31.674999999999997 28.025 9 18.2 22.775000000000002 32.550000000000004 26.474999999999998 10-14 19.695 29.965000000000003 26.755000000000003 23.585 15-19 20.200000000000003 28.03 27.98 23.79 20-24 19.485 28.884999999999998 27.88 23.75 25-29 19.845 28.975 27.860000000000003 23.32 30-34 19.77 28.425 28.055000000000003 23.75 35-39 19.315965798289913 28.686434321716085 27.811390569528477 24.18620931046552 40-44 20.330000000000002 28.42 28.134999999999998 23.115 45-49 19.915 28.23 28.075 23.78 50-54 19.915 27.925 28.535 23.625 55-59 20.055 28.449999999999996 27.755000000000003 23.74 60-64 20.125 28.199999999999996 27.83 23.845 65-69 20.61 28.92 27.584999999999997 22.884999999999998 70-74 19.85 28.435 27.88 23.835 75-79 20.18 28.565 27.73 23.525 80-84 20.026001300065 28.496424821241064 27.651382569128458 23.826191309565477 85-89 20.09801470220533 27.969195379306893 27.809171375706356 24.123618542781415 90-94 20.681034051702586 27.83139156957848 28.046402320116005 23.44117205860293 95-99 20.125 28.804999999999996 27.810000000000002 23.26 100-104 20.507050705070505 28.38783878387839 27.94279427942794 23.162316231623162 105-109 20.27 28.625 27.655 23.45 110-114 20.75 27.860000000000003 27.779999999999998 23.61 115-119 21.285 27.605 27.639999999999997 23.47 120-124 20.816040802040103 28.356417820891046 27.386369318465924 23.44117205860293 125-129 20.336016800840042 28.56642832141607 26.941347067353366 24.15620781039052 130-134 21.349999999999998 28.405 26.715 23.53 135-139 21.791089554477725 27.711385569278463 26.911345567278367 23.58617930896545 140-144 21.19105955297765 28.421421071053555 26.47632381619081 23.91119555977799 145-149 21.16 28.449999999999996 26.205000000000002 24.185000000000002 150-151 21.458046767537827 28.448168063023633 26.647492809803673 23.446292359634864 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 1.5 19 2.0 20 1.5 21 2.0 22 2.5 23 4.0 24 4.5 25 3.5 26 6.0 27 10.5 28 13.5 29 21.5 30 28.5 31 32.0 32 41.5 33 51.5 34 63.5 35 76.5 36 84.5 37 101.0 38 132.0 39 162.5 40 188.5 41 205.0 42 220.0 43 246.5 44 264.5 45 255.0 46 264.5 47 257.5 48 221.5 49 204.0 50 188.5 51 150.0 52 105.5 53 85.0 54 76.5 55 64.5 56 42.5 57 33.0 58 24.0 59 15.5 60 12.5 61 9.5 62 5.5 63 2.0 64 2.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.015 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.1124999999999998 0.0 0.0 0.0 0.0 98-99 1.2625000000000002 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.7125000000000004 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.6375 0.0 0.0 0.0 0.0 128-129 6.25 0.0 0.0 0.0 0.0 130-131 6.9625 0.0 0.0 0.0 0.0 132-133 7.5625 0.0 0.0 0.0 0.0 134-135 8.087499999999999 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACAGA 10 0.0068378756 144.95 4 >>END_MODULE SRR7171089 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92075 33.0 33.0 34.0 32.0 34.0 2 32.89175 33.0 33.0 34.0 32.0 34.0 3 33.05125 34.0 33.0 34.0 32.0 34.0 4 33.003 34.0 33.0 34.0 32.0 34.0 5 33.0155 34.0 33.0 34.0 33.0 34.0 6 37.159 38.0 38.0 38.0 37.0 38.0 7 37.29925 38.0 38.0 38.0 37.0 38.0 8 37.27325 38.0 38.0 38.0 37.0 38.0 9 37.24025 38.0 38.0 38.0 37.0 38.0 10-14 37.111149999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.16615 38.0 38.0 38.0 37.0 38.0 20-24 36.90045 38.0 38.0 38.0 36.0 38.0 25-29 37.1307 38.0 38.0 38.0 37.0 38.0 30-34 37.14765 38.0 38.0 38.0 37.0 38.0 35-39 37.140750000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.042699999999996 38.0 38.0 38.0 36.6 38.0 45-49 36.9043 38.0 38.0 38.0 36.0 38.0 50-54 36.99595000000001 38.0 38.0 38.0 36.4 38.0 55-59 37.0167 38.0 38.0 38.0 36.4 38.0 60-64 36.936449999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.95784999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8976 38.0 38.0 38.0 36.0 38.0 75-79 36.76649999999999 38.0 38.0 38.0 35.8 38.0 80-84 36.747049999999994 38.0 38.0 38.0 35.4 38.0 85-89 36.6594 38.0 38.0 38.0 35.0 38.0 90-94 36.5617 38.0 38.0 38.0 34.6 38.0 95-99 36.50085 38.0 38.0 38.0 34.4 38.0 100-104 36.29535 38.0 38.0 38.0 34.0 38.0 105-109 36.0844 38.0 38.0 38.0 33.2 38.0 110-114 35.989650000000005 38.0 37.2 38.0 33.4 38.0 115-119 35.7264 38.0 37.0 38.0 31.4 38.0 120-124 35.488600000000005 38.0 37.0 38.0 31.0 38.0 125-129 35.11385 38.0 36.2 38.0 29.4 38.0 130-134 34.788650000000004 38.0 36.0 38.0 28.0 38.0 135-139 34.05669999999999 38.0 34.4 38.0 23.8 38.0 140-144 33.0505 38.0 33.0 38.0 18.4 38.0 145-149 32.0495 38.0 33.0 38.0 10.6 38.0 150-151 25.68025 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 1.0 5 3.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 3.0 15 1.0 16 2.0 17 3.0 18 3.0 19 4.0 20 6.0 21 5.0 22 7.0 23 15.0 24 10.0 25 17.0 26 21.0 27 23.0 28 30.0 29 44.0 30 43.0 31 43.0 32 66.0 33 115.0 34 163.0 35 301.0 36 771.0 37 2280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.575 19.525000000000002 12.4 25.5 2 24.875 24.925 33.300000000000004 16.900000000000002 3 21.05 25.224999999999998 33.425 20.3 4 23.275000000000002 35.025 21.95 19.75 5 24.099999999999998 37.724999999999994 21.725 16.45 6 19.625 38.4 23.075000000000003 18.9 7 18.55 18.15 42.675000000000004 20.625 8 19.825 24.55 28.725 26.900000000000002 9 22.2 24.55 29.4 23.849999999999998 10-14 23.400000000000002 28.835 26.605 21.16 15-19 22.985 28.299999999999997 28.349999999999998 20.365 20-24 23.305 28.01 27.800000000000004 20.885 25-29 22.95 28.435 27.779999999999998 20.835 30-34 22.74 29.01 27.650000000000002 20.599999999999998 35-39 22.185 28.110000000000003 28.48 21.224999999999998 40-44 22.939999999999998 28.225 28.505000000000003 20.330000000000002 45-49 22.935 28.22 27.650000000000002 21.195 50-54 22.945 28.305000000000003 28.03 20.72 55-59 22.994999999999997 28.18 27.860000000000003 20.965 60-64 23.150000000000002 28.134999999999998 27.985 20.73 65-69 23.244999999999997 27.88 28.17 20.705000000000002 70-74 23.315 28.299999999999997 27.639999999999997 20.745 75-79 23.265 28.055000000000003 27.994999999999997 20.685000000000002 80-84 23.27 28.075 27.994999999999997 20.66 85-89 23.29 28.27 27.505000000000003 20.935000000000002 90-94 23.71 27.67 28.144999999999996 20.474999999999998 95-99 23.645 27.250000000000004 28.139999999999997 20.965 100-104 23.73 28.205000000000002 27.224999999999998 20.84 105-109 23.995 27.6 28.110000000000003 20.294999999999998 110-114 23.93 27.815 27.57 20.685000000000002 115-119 24.635 27.845 27.405 20.115 120-124 23.93 28.694999999999997 27.37 20.005 125-129 24.325 27.965 27.639999999999997 20.07 130-134 25.019999999999996 27.935 27.05 19.994999999999997 135-139 25.47 27.810000000000002 27.295 19.425 140-144 24.995 28.24 27.215 19.55 145-149 25.924999999999997 27.834999999999997 27.265 18.975 150-151 26.54490868151113 28.658994245684262 26.394796097072803 18.4013009757318 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 1.5 20 1.5 21 0.0 22 1.5 23 2.5 24 3.0 25 5.5 26 7.0 27 6.5 28 10.5 29 19.0 30 21.5 31 22.0 32 27.5 33 39.5 34 52.0 35 62.0 36 84.0 37 110.5 38 131.0 39 154.5 40 184.5 41 223.5 42 266.5 43 286.0 44 282.5 45 263.0 46 244.0 47 241.0 48 229.0 49 197.0 50 169.0 51 146.5 52 113.5 53 96.0 54 83.5 55 56.0 56 33.5 57 28.5 58 24.0 59 18.5 60 16.0 61 9.5 62 9.5 63 8.0 64 2.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26823113802675 98.35000000000001 2 0.58036840777189 1.15 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0125 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.05 0.0 0.0 0.025 0.0 58-59 0.05 0.0 0.0 0.025 0.0 60-61 0.05 0.0 0.0 0.025 0.0 62-63 0.05 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.075 0.0 0.0 0.025 0.0 70-71 0.0875 0.0 0.0 0.025 0.0 72-73 0.125 0.0 0.0 0.025 0.0 74-75 0.16249999999999998 0.0 0.0 0.025 0.0 76-77 0.1875 0.0 0.0 0.025 0.0 78-79 0.25 0.0 0.0 0.025 0.0 80-81 0.275 0.0 0.0 0.025 0.0 82-83 0.3375 0.0 0.0 0.025 0.0 84-85 0.3625 0.0 0.0 0.025 0.0 86-87 0.4375 0.0 0.0 0.025 0.0 88-89 0.5625 0.0 0.0 0.025 0.0 90-91 0.675 0.0 0.0 0.025 0.0 92-93 0.8375 0.0 0.0 0.025 0.0 94-95 1.0 0.0 0.0 0.025 0.0 96-97 1.2 0.0 0.0 0.025 0.0 98-99 1.3875000000000002 0.0 0.0 0.025 0.0 100-101 1.5125000000000002 0.0 0.0 0.025 0.0 102-103 1.7125 0.0 0.0 0.025 0.0 104-105 1.9875 0.0 0.0 0.025 0.0 106-107 2.2750000000000004 0.0 0.0 0.025 0.0 108-109 2.4749999999999996 0.0 0.0 0.025 0.0 110-111 2.7750000000000004 0.0 0.0 0.025 0.0 112-113 3.1125 0.0 0.0 0.025 0.0 114-115 3.575 0.0 0.0 0.025 0.0 116-117 4.1 0.0 0.0 0.025 0.0 118-119 4.6375 0.0 0.0 0.025 0.0 120-121 5.0 0.0 0.0 0.025 0.0 122-123 5.275 0.0 0.0 0.025 0.0 124-125 5.6625 0.0 0.0 0.025 0.0 126-127 6.225 0.0 0.0 0.025 0.0 128-129 6.8375 0.0 0.0 0.025 0.0 130-131 7.5375 0.0 0.0 0.025 0.0 132-133 8.1 0.0 0.0 0.025 0.0 134-135 8.6125 0.0 0.0 0.025 0.0 136-137 9.075 0.0 0.0 0.025 0.0 138-139 9.850000000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATCT 10 0.006830828 145.0 3 TAAAGAT 10 0.006830828 145.0 3 >>END_MODULE Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971765 spots for SRR7171089.sra Written 971765 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra Read 971751 spots for SRR7171089.sra Written 971751 spots for SRR7171089.sra SRR ids: ['SRR7171089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4hmvhupx SRR7171089.sra spots: 19435034 blocks: [[1, 971751], [971752, 1943502], [1943503, 2915253], [2915254, 3887004], [3887005, 4858755], [4858756, 5830506], [5830507, 6802257], [6802258, 7774008], [7774009, 8745759], [8745760, 9717510], [9717511, 10689261], [10689262, 11661012], [11661013, 12632763], [12632764, 13604514], [13604515, 14576265], [14576266, 15548016], [15548017, 16519767], [16519768, 17491518], [17491519, 18463269], [18463270, 19435034]] SRR7171089 file size 6564194 SRR7171089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171089 SRR7171089_1.fastq SRR7171089_2.fastq Input file: SRR7171089_1.fastq Paired file: SRR7171089_2.fastq trimmed: SRR7171089-trimmed-pair1.fastq, SRR7171089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:25:17 2025 >> started Fri Feb 14 03:25:38 2025 >> done (20.536s) 19435034 read pairs processed; of these: 14839 ( 0.08%) short read pairs filtered out after trimming by size control 24485 ( 0.13%) empty read pairs filtered out after trimming by size control 19395710 (99.80%) read pairs available; of these: 11823334 (60.96%) trimmed read pairs available after processing 7572376 (39.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 13 0.00% 21 16 0.00% 22 18 0.00% 23 14 0.00% 24 25 0.00% 25 16 0.00% 26 24 0.00% 27 18 0.00% 28 18 0.00% 29 21 0.00% 30 25 0.00% 31 24 0.00% 32 23 0.00% 33 26 0.00% 34 30 0.00% 35 14 0.00% 36 31 0.00% 37 45 0.00% 38 47 0.00% 39 58 0.00% 40 56 0.00% 41 69 0.00% 42 78 0.00% 43 89 0.00% 44 86 0.00% 45 104 0.00% 46 101 0.00% 47 119 0.00% 48 147 0.00% 49 163 0.00% 50 194 0.00% 51 217 0.00% 52 283 0.00% 53 253 0.00% 54 356 0.00% 55 354 0.00% 56 399 0.00% 57 385 0.00% 58 513 0.00% 59 572 0.00% 60 652 0.00% 61 767 0.00% 62 878 0.00% 63 963 0.00% 64 1066 0.01% 65 1140 0.01% 66 1246 0.01% 67 1412 0.01% 68 1564 0.01% 69 1830 0.01% 70 2141 0.01% 71 2433 0.01% 72 2675 0.01% 73 3032 0.02% 74 3454 0.02% 75 3730 0.02% 76 4337 0.02% 77 4889 0.03% 78 4895 0.03% 79 5590 0.03% 80 6133 0.03% 81 7013 0.04% 82 7972 0.04% 83 8650 0.04% 84 10701 0.06% 85 11570 0.06% 86 12402 0.06% 87 13357 0.07% 88 14280 0.07% 89 14972 0.08% 90 16071 0.08% 91 17709 0.09% 92 18925 0.10% 93 20309 0.10% 94 21377 0.11% 95 22782 0.12% 96 23752 0.12% 97 24776 0.13% 98 25520 0.13% 99 26657 0.14% 100 28125 0.15% 101 29466 0.15% 102 31054 0.16% 103 32284 0.17% 104 33645 0.17% 105 35482 0.18% 106 36841 0.19% 107 38008 0.20% 108 39011 0.20% 109 40375 0.21% 110 41590 0.21% 111 42240 0.22% 112 44263 0.23% 113 46006 0.24% 114 47670 0.25% 115 49457 0.25% 116 50693 0.26% 117 51728 0.27% 118 53238 0.27% 119 54052 0.28% 120 55848 0.29% 121 57194 0.29% 122 59262 0.31% 123 61408 0.32% 124 63137 0.33% 125 64740 0.33% 126 68268 0.35% 127 69493 0.36% 128 71764 0.37% 129 74405 0.38% 130 77139 0.40% 131 79704 0.41% 132 83443 0.43% 133 87877 0.45% 134 91759 0.47% 135 98116 0.51% 136 104004 0.54% 137 111180 0.57% 138 118511 0.61% 139 127198 0.66% 140 136784 0.71% 141 150499 0.78% 142 164874 0.85% 143 183857 0.95% 144 213333 1.10% 145 251480 1.30% 146 306290 1.58% 147 409068 2.11% 148 625490 3.22% 149 1225794 6.32% 150 5327502 27.47% 151 7572376 39.04% 19395710 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=34.31 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=21.21 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTAC SRR7171089 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:26:24 Started mapping on | Feb 14 03:26:24 Finished on | Feb 14 03:28:18 Mapping speed, Million of reads per hour | 612.50 Number of input reads | 19395710 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18287728 Uniquely mapped reads % | 94.29% Average mapped length | 289.91 Number of splices: Total | 17174760 Number of splices: Annotated (sjdb) | 16759990 Number of splices: GT/AG | 16840376 Number of splices: GC/AG | 257732 Number of splices: AT/AC | 10813 Number of splices: Non-canonical | 65839 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 534197 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 66833 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 593324 593324 593324 N_multimapping 534197 534197 534197 N_noFeature 752750 17946650 893461 N_ambiguous 344941 1802 143252 UnstrandedReadsAssigned:17190037 PositiveStrandReadsAssigned:339276 NegativeStrandReadsAssigned:17251015 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171089-trimmed-pair1.fastq SRR7171089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,395,710 reads, 17,240,434 reads pseudoaligned [quant] estimated average fragment length: 225.357 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7171089.ke.tsv 34699 SRR7171089.se.tsv 87100 total ==> SRR7171089.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.64 851 25.0419 Potri.005G024800.1.v4.1 1035 810.643 137 8.92001 Potri.004G059700.1.v4.1 961 736.673 32 2.29271 Potri.007G009000.2.v4.1 1416 1191.64 0 0 Potri.003G141000.2.v4.1 2943 2718.64 669.991 13.0074 Potri.016G087400.1.v4.1 270 88.3652 989 590.73 Potri.015G069301.1.v4.1 564 342.943 0 0 Potri.010G195200.1.v4.1 1773 1548.64 86 2.93104 Potri.012G127500.1.v4.1 977 752.663 377 26.4372 ==> SRR7171089.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1028 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 435 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 33 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 38 SRR7171089 completed mapping pipeline successfully