Starting /dee2/code/volunteer_pipeline.sh SRR7171090 current disk space = 3088124047360 free memory = 1579892252 SRR7171090 SRAfilesize 039dd48d58a3b25a48ceef94a87795ab SRR7171090.sra SRR7171090.sra file validated SRR7171090 is paired end SRR7171090 is conventional basespace SRR7171090 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.70425 25.0 18.0 33.0 18.0 33.0 2 29.5705 31.0 27.0 33.0 25.0 33.0 3 30.6455 31.0 29.0 33.0 27.0 33.0 4 30.9505 33.0 31.0 33.0 28.0 33.0 5 32.21325 33.0 33.0 33.0 31.0 33.0 6 36.586 38.0 37.0 38.0 34.0 38.0 7 37.0405 38.0 38.0 38.0 35.0 38.0 8 37.37975 38.0 38.0 38.0 37.0 38.0 9 36.92175 38.0 38.0 38.0 36.0 38.0 10-14 37.435 38.0 38.0 38.0 37.0 38.0 15-19 37.5139 38.0 38.0 38.0 37.6 38.0 20-24 37.50595 38.0 38.0 38.0 37.8 38.0 25-29 37.44645 38.0 38.0 38.0 37.0 38.0 30-34 37.41695 38.0 38.0 38.0 37.0 38.0 35-39 36.32025 38.0 37.0 38.0 31.2 38.0 40-44 36.91065 38.0 37.8 38.0 35.2 38.0 45-49 37.1038 38.0 38.0 38.0 36.0 38.0 50-54 37.1885 38.0 38.0 38.0 36.2 38.0 55-59 36.060249999999996 38.0 36.6 38.0 30.4 38.0 60-64 37.0697 38.0 38.0 38.0 36.0 38.0 65-69 36.9953 38.0 38.0 38.0 36.0 38.0 70-74 36.811249999999994 38.0 38.0 38.0 35.2 38.0 75-79 36.79595 38.0 38.0 38.0 35.0 38.0 80-84 36.781499999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.4645 38.0 38.0 38.0 33.8 38.0 90-94 36.16035000000001 38.0 37.6 38.0 33.4 38.0 95-99 36.35395 38.0 37.8 38.0 34.0 38.0 100-104 36.319100000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.115300000000005 38.0 37.0 38.0 33.6 38.0 110-114 35.70385 38.0 36.6 38.0 31.6 38.0 115-119 35.436550000000004 38.0 36.2 38.0 29.8 38.0 120-124 35.412850000000006 38.0 36.0 38.0 30.6 38.0 125-129 35.3397 38.0 36.0 38.0 29.8 38.0 130-134 33.0668 37.6 31.6 38.0 19.2 38.0 135-139 34.3948 38.0 34.8 38.0 25.6 38.0 140-144 34.03335 38.0 34.4 38.0 24.2 38.0 145-149 33.356399999999994 38.0 33.4 38.0 19.6 38.0 150-151 29.207375 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 4.0 18 4.0 19 7.0 20 5.0 21 9.0 22 4.0 23 6.0 24 11.0 25 12.0 26 18.0 27 21.0 28 30.0 29 39.0 30 47.0 31 67.0 32 85.0 33 136.0 34 197.0 35 407.0 36 1080.0 37 1804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.01298701298701 12.623376623376622 10.753246753246753 39.61038961038961 2 20.765574180635475 18.964223167375533 34.40080060045034 25.869402051538653 3 19.1 24.825 27.725 28.349999999999998 4 22.5 31.125000000000004 23.599999999999998 22.775000000000002 5 20.974999999999998 36.65 24.175 18.2 6 17.65 36.05 25.900000000000002 20.4 7 13.375 23.5 45.2 17.925 8 17.724999999999998 23.175 32.4 26.700000000000003 9 17.45 23.775 33.825 24.95 10-14 19.43 30.070000000000004 26.525 23.974999999999998 15-19 19.689999999999998 28.720000000000002 27.650000000000002 23.94 20-24 19.75 28.67 28.765 22.814999999999998 25-29 19.695 29.645 27.675 22.985 30-34 19.72 29.59 27.63 23.06 35-39 19.98 29.38 27.235 23.405 40-44 20.43 29.654999999999998 26.93 22.985 45-49 20.13 28.62 27.46 23.79 50-54 20.28 28.82 28.199999999999996 22.7 55-59 20.215 28.48 27.55 23.755000000000003 60-64 20.01 28.82 27.58 23.59 65-69 20.255000000000003 29.189999999999998 27.384999999999998 23.169999999999998 70-74 20.195 28.660000000000004 27.889999999999997 23.255 75-79 20.09 29.020000000000003 27.46 23.43 80-84 20.86 28.98 27.095000000000002 23.064999999999998 85-89 20.474999999999998 28.865000000000002 27.250000000000004 23.41 90-94 20.244999999999997 28.89 27.529999999999998 23.335 95-99 20.135 29.049999999999997 27.355 23.46 100-104 20.31 27.955000000000002 27.675 24.060000000000002 105-109 20.84 28.71 27.455000000000002 22.994999999999997 110-114 21.165 28.575 27.55 22.71 115-119 20.965 28.904999999999998 26.75 23.380000000000003 120-124 20.96 28.725 26.840000000000003 23.474999999999998 125-129 20.845 28.735 26.955000000000002 23.465 130-134 20.78 28.915000000000003 26.05 24.255 135-139 21.105 28.205000000000002 27.115000000000002 23.575 140-144 21.490000000000002 28.26 26.495 23.755000000000003 145-149 21.765 27.529999999999998 26.295 24.41 150-151 20.575 28.825 25.95 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 3.5 20 2.0 21 0.5 22 2.5 23 4.5 24 4.0 25 3.5 26 7.0 27 17.0 28 21.0 29 20.0 30 30.0 31 42.0 32 47.5 33 50.5 34 66.5 35 92.5 36 119.0 37 126.5 38 131.0 39 152.0 40 181.0 41 206.0 42 220.0 43 241.0 44 244.5 45 246.5 46 242.5 47 222.5 48 204.5 49 185.0 50 169.0 51 141.5 52 111.0 53 97.5 54 81.0 55 56.0 56 48.0 57 47.5 58 36.5 59 27.0 60 17.0 61 9.0 62 7.0 63 2.5 64 1.0 65 0.5 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39470365699874 98.52499999999999 2 0.45397225725094575 0.8999999999999999 3 0.07566204287515763 0.22499999999999998 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.775 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 3.15 0.0 0.0 0.0 0.0 110-111 3.725 0.0 0.0 0.0 0.0 112-113 4.1375 0.0 0.0 0.0 0.0 114-115 4.525 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.3625 0.0 0.0 0.0 0.0 120-121 5.8875 0.0 0.0 0.0 0.0 122-123 6.5375 0.0 0.0 0.0 0.0 124-125 7.1125 0.0 0.0 0.0 0.0 126-127 7.7 0.0 0.0 0.0 0.0 128-129 8.325 0.0 0.0 0.0 0.0 130-131 8.9 0.0 0.0 0.0 0.0 132-133 9.525 0.0 0.0 0.0 0.0 134-135 10.3875 0.0 0.0 0.0 0.0 136-137 11.0 0.0 0.0 0.0 0.0 138-139 11.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCTT 20 0.005940113 28.995 95-99 >>END_MODULE SRR7171090 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.851 33.0 33.0 34.0 32.0 34.0 2 32.97225 34.0 33.0 34.0 32.0 34.0 3 32.93275 34.0 33.0 34.0 32.0 34.0 4 32.92025 34.0 33.0 34.0 32.0 34.0 5 32.7895 34.0 33.0 34.0 32.0 34.0 6 36.97575 38.0 38.0 38.0 36.0 38.0 7 36.8435 38.0 38.0 38.0 36.0 38.0 8 36.91025 38.0 38.0 38.0 36.0 38.0 9 36.91275 38.0 38.0 38.0 36.0 38.0 10-14 36.9793 38.0 38.0 38.0 36.4 38.0 15-19 37.023900000000005 38.0 38.0 38.0 36.8 38.0 20-24 36.06175 38.0 37.2 38.0 30.6 38.0 25-29 36.59635 38.0 38.0 38.0 34.6 38.0 30-34 36.795550000000006 38.0 38.0 38.0 35.8 38.0 35-39 36.8121 38.0 38.0 38.0 35.8 38.0 40-44 36.02355 38.0 36.6 38.0 32.0 38.0 45-49 36.54155000000001 38.0 37.6 38.0 34.0 38.0 50-54 36.851200000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.79535 38.0 38.0 38.0 36.0 38.0 60-64 36.616249999999994 38.0 38.0 38.0 35.0 38.0 65-69 36.56375 38.0 38.0 38.0 34.8 38.0 70-74 36.5458 38.0 38.0 38.0 34.6 38.0 75-79 36.4625 38.0 38.0 38.0 34.8 38.0 80-84 36.3154 38.0 38.0 38.0 34.0 38.0 85-89 36.230650000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.196799999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.117200000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.8761 38.0 37.8 38.0 33.0 38.0 105-109 35.5167 38.0 37.4 38.0 31.0 38.0 110-114 35.1856 38.0 36.6 38.0 29.0 38.0 115-119 35.357749999999996 38.0 37.0 38.0 30.6 38.0 120-124 34.9811 38.0 36.0 38.0 28.6 38.0 125-129 34.335499999999996 38.0 34.6 38.0 24.2 38.0 130-134 34.1543 38.0 34.4 38.0 24.0 38.0 135-139 33.697 38.0 33.4 38.0 22.4 38.0 140-144 33.0053 38.0 33.0 38.0 17.0 38.0 145-149 31.910349999999994 38.0 33.0 38.0 10.4 38.0 150-151 26.445875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 0.0 5 2.0 6 2.0 7 1.0 8 3.0 9 2.0 10 4.0 11 5.0 12 3.0 13 1.0 14 4.0 15 2.0 16 6.0 17 4.0 18 5.0 19 9.0 20 9.0 21 9.0 22 15.0 23 14.0 24 10.0 25 16.0 26 32.0 27 37.0 28 29.0 29 39.0 30 57.0 31 57.0 32 99.0 33 110.0 34 179.0 35 332.0 36 762.0 37 2126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.800000000000004 19.375 14.524999999999999 27.3 2 26.474999999999998 23.674999999999997 33.2 16.650000000000002 3 22.35 27.675 31.65 18.325 4 24.05 35.25 22.325 18.375 5 24.831207801950487 37.409352338084524 20.68017004251063 17.079269817454364 6 19.525000000000002 38.550000000000004 23.724999999999998 18.2 7 18.9 20.724999999999998 40.5 19.875 8 22.5 23.45 26.900000000000002 27.150000000000002 9 21.224999999999998 25.775 29.375 23.625 10-14 23.125 29.005 25.955000000000002 21.915000000000003 15-19 23.41 27.83 27.595 21.165 20-24 23.435 28.13 27.534999999999997 20.9 25-29 23.044999999999998 28.235 28.075 20.645 30-34 22.634999999999998 27.725 28.74 20.9 35-39 23.23 27.775 28.025 20.97 40-44 23.05 28.205000000000002 27.725 21.02 45-49 22.845 28.125 27.615000000000002 21.415 50-54 23.555 27.834999999999997 27.62 20.990000000000002 55-59 22.705000000000002 28.08 28.21 21.005 60-64 23.105 28.155 27.48 21.26 65-69 23.49 27.229999999999997 28.465 20.815 70-74 23.169999999999998 27.62 27.91 21.3 75-79 23.41 27.455000000000002 28.084999999999997 21.05 80-84 23.244999999999997 27.66 28.035 21.060000000000002 85-89 23.305 27.665 28.18 20.849999999999998 90-94 23.69 27.860000000000003 27.474999999999998 20.974999999999998 95-99 24.04 28.125 27.474999999999998 20.36 100-104 23.724999999999998 27.839999999999996 27.839999999999996 20.595 105-109 23.29 27.805000000000003 28.275 20.630000000000003 110-114 24.505 28.16 27.500000000000004 19.835 115-119 24.93 28.38 26.865 19.825 120-124 24.610000000000003 28.08 27.265 20.044999999999998 125-129 24.745 27.900000000000002 27.21 20.145 130-134 24.89 27.725 27.61 19.775000000000002 135-139 25.61 27.275 27.715 19.400000000000002 140-144 25.759999999999998 27.435 27.025 19.78 145-149 26.474999999999998 27.855 26.775 18.895 150-151 27.5875 27.200000000000003 26.4125 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 2.5 26 5.0 27 6.0 28 8.5 29 10.5 30 17.0 31 25.0 32 28.5 33 42.5 34 58.5 35 74.0 36 89.0 37 98.0 38 120.5 39 148.0 40 181.5 41 202.5 42 215.5 43 251.5 44 284.5 45 291.0 46 261.0 47 250.0 48 239.5 49 202.0 50 179.0 51 153.0 52 119.5 53 96.0 54 88.5 55 76.5 56 51.0 57 36.5 58 28.5 59 15.5 60 11.5 61 10.0 62 6.0 63 4.5 64 2.0 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21499113699672 97.95 2 0.531780197518359 1.05 3 0.10129146619397315 0.3 4 0.07596859964547988 0.3 5 0.05064573309698658 0.25 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GAACACTTTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.025 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.037500000000000006 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.0625 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.2 0.0 0.0 0.025 0.0 84-85 0.275 0.0 0.0 0.025 0.0 86-87 0.38749999999999996 0.0 0.0 0.025 0.0 88-89 0.5 0.0 0.0 0.025 0.0 90-91 0.5625 0.0 0.0 0.025 0.0 92-93 0.75 0.0 0.0 0.025 0.0 94-95 0.9750000000000001 0.0 0.0 0.025 0.0 96-97 1.1375000000000002 0.0 0.0 0.025 0.0 98-99 1.3375 0.0 0.0 0.025 0.0 100-101 1.6124999999999998 0.0 0.0 0.025 0.0 102-103 1.7625000000000002 0.0 0.0 0.025 0.0 104-105 2.1 0.0 0.0 0.025 0.0 106-107 2.4875 0.0 0.0 0.025 0.0 108-109 3.05 0.0 0.0 0.025 0.0 110-111 3.65 0.0 0.0 0.025 0.0 112-113 4.0875 0.0 0.0 0.025 0.0 114-115 4.475 0.0 0.0 0.025 0.0 116-117 4.825 0.0 0.0 0.025 0.0 118-119 5.275 0.0 0.0 0.025 0.0 120-121 5.7875 0.0 0.0 0.025 0.0 122-123 6.45 0.0 0.0 0.025 0.0 124-125 7.0625 0.0 0.0 0.025 0.0 126-127 7.825 0.0 0.0 0.025 0.0 128-129 8.525 0.0 0.0 0.025 0.0 130-131 9.0875 0.0 0.0 0.025 0.0 132-133 9.75 0.0 0.0 0.025 0.0 134-135 10.600000000000001 0.0 0.0 0.025 0.0 136-137 11.212499999999999 0.0 0.0 0.025 0.0 138-139 12.024999999999999 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708481 spots for SRR7171090.sra Written 708481 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra Read 708479 spots for SRR7171090.sra Written 708479 spots for SRR7171090.sra SRR ids: ['SRR7171090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9zoa32bx SRR7171090.sra spots: 14169582 blocks: [[1, 708479], [708480, 1416958], [1416959, 2125437], [2125438, 2833916], [2833917, 3542395], [3542396, 4250874], [4250875, 4959353], [4959354, 5667832], [5667833, 6376311], [6376312, 7084790], [7084791, 7793269], [7793270, 8501748], [8501749, 9210227], [9210228, 9918706], [9918707, 10627185], [10627186, 11335664], [11335665, 12044143], [12044144, 12752622], [12752623, 13461101], [13461102, 14169582]] SRR7171090 file size 4779906 SRR7171090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171090 SRR7171090_1.fastq SRR7171090_2.fastq Input file: SRR7171090_1.fastq Paired file: SRR7171090_2.fastq trimmed: SRR7171090-trimmed-pair1.fastq, SRR7171090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:15:38 2025 >> started Fri Feb 14 03:15:55 2025 >> done (16.212s) 14169582 read pairs processed; of these: 12846 ( 0.09%) short read pairs filtered out after trimming by size control 30785 ( 0.22%) empty read pairs filtered out after trimming by size control 14125951 (99.69%) read pairs available; of these: 8179747 (57.91%) trimmed read pairs available after processing 5946204 (42.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 5 0.00% 21 7 0.00% 22 6 0.00% 23 7 0.00% 24 7 0.00% 25 3 0.00% 26 7 0.00% 27 15 0.00% 28 11 0.00% 29 9 0.00% 30 5 0.00% 31 12 0.00% 32 11 0.00% 33 18 0.00% 34 11 0.00% 35 12 0.00% 36 11 0.00% 37 14 0.00% 38 20 0.00% 39 24 0.00% 40 26 0.00% 41 43 0.00% 42 28 0.00% 43 36 0.00% 44 54 0.00% 45 45 0.00% 46 67 0.00% 47 85 0.00% 48 84 0.00% 49 120 0.00% 50 138 0.00% 51 124 0.00% 52 172 0.00% 53 175 0.00% 54 199 0.00% 55 213 0.00% 56 233 0.00% 57 238 0.00% 58 298 0.00% 59 385 0.00% 60 439 0.00% 61 494 0.00% 62 592 0.00% 63 596 0.00% 64 705 0.00% 65 725 0.01% 66 811 0.01% 67 930 0.01% 68 1053 0.01% 69 1158 0.01% 70 1376 0.01% 71 1534 0.01% 72 1735 0.01% 73 2149 0.02% 74 2336 0.02% 75 2714 0.02% 76 3449 0.02% 77 3858 0.03% 78 3567 0.03% 79 3881 0.03% 80 4173 0.03% 81 4788 0.03% 82 5544 0.04% 83 6398 0.05% 84 7567 0.05% 85 8334 0.06% 86 9017 0.06% 87 9651 0.07% 88 10251 0.07% 89 10777 0.08% 90 11767 0.08% 91 12804 0.09% 92 13848 0.10% 93 15215 0.11% 94 16622 0.12% 95 17690 0.13% 96 18730 0.13% 97 19559 0.14% 98 19737 0.14% 99 20505 0.15% 100 21836 0.15% 101 22694 0.16% 102 24573 0.17% 103 26124 0.18% 104 27739 0.20% 105 29690 0.21% 106 30260 0.21% 107 31179 0.22% 108 32384 0.23% 109 32776 0.23% 110 34029 0.24% 111 35140 0.25% 112 36365 0.26% 113 38318 0.27% 114 39868 0.28% 115 41939 0.30% 116 42547 0.30% 117 43511 0.31% 118 44478 0.31% 119 45031 0.32% 120 45977 0.33% 121 47172 0.33% 122 47907 0.34% 123 50113 0.35% 124 52227 0.37% 125 52949 0.37% 126 55306 0.39% 127 56695 0.40% 128 57325 0.41% 129 59916 0.42% 130 60656 0.43% 131 61910 0.44% 132 63956 0.45% 133 67284 0.48% 134 70095 0.50% 135 74289 0.53% 136 77483 0.55% 137 82328 0.58% 138 86529 0.61% 139 91875 0.65% 140 97589 0.69% 141 106010 0.75% 142 115395 0.82% 143 129680 0.92% 144 151305 1.07% 145 178687 1.26% 146 221001 1.56% 147 299850 2.12% 148 439436 3.11% 149 824340 5.84% 150 3393917 24.03% 151 5946204 42.09% 14125951 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=12 prefix-density=1.18 prefix-fanout=2.1 sequence=TTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=43.21 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTT criterion=sequence-density sequence-density=1.49 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=16 prefix-density=1.55 prefix-fanout=2.2 sequence=CAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=25.49 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAA SRR7171090 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:16:40 Started mapping on | Feb 14 03:16:41 Finished on | Feb 14 03:18:54 Mapping speed, Million of reads per hour | 382.36 Number of input reads | 14125951 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13013877 Uniquely mapped reads % | 92.13% Average mapped length | 288.36 Number of splices: Total | 12108362 Number of splices: Annotated (sjdb) | 11806144 Number of splices: GT/AG | 11855738 Number of splices: GC/AG | 185613 Number of splices: AT/AC | 8367 Number of splices: Non-canonical | 58644 Mismatch rate per base, % | 0.86% Deletion rate per base | 0.06% Deletion average length | 2.97 Insertion rate per base | 0.04% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 511477 % of reads mapped to multiple loci | 3.62% Number of reads mapped to too many loci | 28869 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 613177 613177 613177 N_multimapping 511477 511477 511477 N_noFeature 405241 12725214 487741 N_ambiguous 313609 780 107131 UnstrandedReadsAssigned:12295027 PositiveStrandReadsAssigned:287883 NegativeStrandReadsAssigned:12419005 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171090-trimmed-pair1.fastq SRR7171090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,125,951 reads, 12,080,153 reads pseudoaligned [quant] estimated average fragment length: 214.93 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR7171090.ke.tsv 34699 SRR7171090.se.tsv 87100 total ==> SRR7171090.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.07 390 12.8656 Potri.005G024800.1.v4.1 1035 821.07 462 33.4875 Potri.004G059700.1.v4.1 961 747.075 10 0.79663 Potri.007G009000.2.v4.1 1416 1202.07 0 0 Potri.003G141000.2.v4.1 2943 2729.07 394 8.59215 Potri.016G087400.1.v4.1 270 91.3253 1143.76 745.355 Potri.015G069301.1.v4.1 564 351.833 0 0 Potri.010G195200.1.v4.1 1773 1559.07 77 2.93931 Potri.012G127500.1.v4.1 977 763.07 39 3.04173 ==> SRR7171090.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 639 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 195 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7171090 completed mapping pipeline successfully