Starting /dee2/code/volunteer_pipeline.sh SRR7171091 current disk space = 3088100270080 free memory = 1574719296 SRR7171091 SRAfilesize 2de4279b8185e3017b99e2c3c2d656bf SRR7171091.sra SRR7171091.sra file validated SRR7171091 is paired end SRR7171091 is conventional basespace SRR7171091 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171091_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.4525 32.0 18.0 33.0 18.0 33.0 2 25.5075 27.0 18.0 31.0 18.0 33.0 3 29.82875 31.0 28.0 33.0 27.0 33.0 4 31.82625 33.0 31.0 33.0 29.0 33.0 5 32.7185 33.0 33.0 33.0 32.0 34.0 6 36.50825 38.0 37.0 38.0 34.0 38.0 7 36.7945 38.0 37.0 38.0 34.0 38.0 8 37.25925 38.0 38.0 38.0 36.0 38.0 9 37.444 38.0 38.0 38.0 37.0 38.0 10-14 37.44095 38.0 38.0 38.0 36.8 38.0 15-19 37.5033 38.0 38.0 38.0 37.2 38.0 20-24 37.48665 38.0 38.0 38.0 37.0 38.0 25-29 37.4484 38.0 38.0 38.0 37.0 38.0 30-34 37.46425 38.0 38.0 38.0 37.4 38.0 35-39 37.336400000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.4317 38.0 38.0 38.0 37.2 38.0 45-49 37.33325000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.751999999999995 38.0 38.0 38.0 34.8 38.0 55-59 37.082499999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.00865 38.0 38.0 38.0 35.8 38.0 65-69 36.93065 38.0 38.0 38.0 35.8 38.0 70-74 36.77575 38.0 38.0 38.0 35.2 38.0 75-79 36.8035 38.0 38.0 38.0 34.8 38.0 80-84 36.7395 38.0 38.0 38.0 34.8 38.0 85-89 36.4678 38.0 37.8 38.0 34.0 38.0 90-94 36.24544999999999 38.0 37.2 38.0 33.6 38.0 95-99 36.318349999999995 38.0 37.2 38.0 33.8 38.0 100-104 36.232549999999996 38.0 37.0 38.0 34.0 38.0 105-109 35.97465 38.0 37.0 38.0 32.8 38.0 110-114 35.701299999999996 38.0 36.8 38.0 31.8 38.0 115-119 35.370599999999996 38.0 36.0 38.0 30.2 38.0 120-124 35.2514 38.0 36.0 38.0 28.8 38.0 125-129 34.98605 38.0 35.6 38.0 28.2 38.0 130-134 31.9531 36.0 28.0 38.0 19.2 38.0 135-139 33.967600000000004 38.0 33.6 38.0 23.6 38.0 140-144 33.45995 38.0 33.6 38.0 21.8 38.0 145-149 32.4987 38.0 32.6 38.0 15.4 38.0 150-151 28.007875 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 3.0 13 0.0 14 3.0 15 1.0 16 3.0 17 2.0 18 5.0 19 5.0 20 2.0 21 4.0 22 5.0 23 6.0 24 3.0 25 12.0 26 15.0 27 25.0 28 26.0 29 36.0 30 40.0 31 53.0 32 100.0 33 145.0 34 234.0 35 459.0 36 1316.0 37 1492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.87367891293407 14.418721690991445 4.378459989934575 58.32913940613991 2 12.55 17.974999999999998 50.4 19.075 3 12.45 21.224999999999998 34.675 31.65 4 19.75 30.925000000000004 26.625 22.7 5 19.325 34.4 28.275 18.0 6 15.174999999999999 35.05 28.449999999999996 21.325 7 12.225 22.6 46.6 18.575 8 15.075 22.7 35.825 26.400000000000002 9 14.799999999999999 21.075 37.7 26.424999999999997 10-14 18.775 28.76 28.415000000000003 24.05 15-19 19.08 28.305000000000003 28.555000000000003 24.060000000000002 20-24 19.595000000000002 29.054999999999996 27.955000000000002 23.395 25-29 19.415 28.835 27.794999999999998 23.955000000000002 30-34 19.165 28.42 28.675 23.74 35-39 19.564999999999998 28.715000000000003 28.199999999999996 23.52 40-44 19.53 28.935 27.900000000000002 23.635 45-49 20.095 28.725 27.839999999999996 23.34 50-54 19.205 28.999999999999996 27.97 23.825 55-59 20.495 28.62 27.779999999999998 23.105 60-64 19.755 27.939999999999998 28.835 23.47 65-69 19.855 28.365000000000002 28.225 23.555 70-74 19.580000000000002 28.62 28.335 23.465 75-79 19.955000000000002 28.389999999999997 28.410000000000004 23.244999999999997 80-84 20.549999999999997 29.189999999999998 27.034999999999997 23.225 85-89 20.06 28.599999999999998 27.655 23.685000000000002 90-94 20.185 28.749999999999996 27.560000000000002 23.505000000000003 95-99 20.715 28.475 27.725 23.085 100-104 20.25 29.215000000000003 27.38 23.155 105-109 20.71 29.134999999999998 27.455000000000002 22.7 110-114 20.935000000000002 29.189999999999998 27.310000000000002 22.564999999999998 115-119 20.89 28.79 27.36 22.96 120-124 20.815 28.804999999999996 27.365000000000002 23.015 125-129 20.715 29.015 26.939999999999998 23.330000000000002 130-134 21.224999999999998 28.835 26.740000000000002 23.200000000000003 135-139 21.675 28.675 26.834999999999997 22.814999999999998 140-144 21.005 28.84 26.810000000000002 23.345 145-149 21.255 28.785 26.724999999999998 23.235 150-151 21.912499999999998 28.749999999999996 26.187500000000004 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 1.5 22 1.0 23 2.5 24 4.5 25 5.0 26 7.5 27 12.0 28 11.0 29 16.0 30 26.0 31 33.0 32 42.0 33 47.0 34 65.5 35 88.5 36 103.5 37 120.0 38 149.5 39 189.5 40 204.5 41 231.0 42 269.5 43 277.5 44 269.5 45 260.5 46 241.5 47 226.5 48 214.0 49 179.0 50 148.5 51 120.0 52 97.0 53 79.0 54 56.5 55 47.5 56 49.0 57 34.5 58 16.0 59 14.5 60 12.5 61 7.0 62 2.5 63 2.0 64 3.5 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11571500757958 98.075 2 0.7832238504295099 1.55 3 0.05053057099545225 0.15 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.2999999999999998 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.425000000000001 0.025 0.0 0.0 0.0 112-113 5.1375 0.025 0.0 0.0 0.0 114-115 5.775 0.025 0.0 0.0 0.0 116-117 6.275 0.025 0.0 0.0 0.0 118-119 6.85 0.025 0.0 0.0 0.0 120-121 7.3375 0.025 0.0 0.0 0.0 122-123 7.737500000000001 0.025 0.0 0.0 0.0 124-125 8.162500000000001 0.025 0.0 0.0 0.0 126-127 8.774999999999999 0.025 0.0 0.0 0.0 128-129 9.2375 0.025 0.0 0.0 0.0 130-131 9.9 0.025 0.0 0.0 0.0 132-133 10.375 0.025 0.0 0.0 0.0 134-135 11.1625 0.025 0.0 0.0 0.0 136-137 11.8625 0.025 0.0 0.0 0.0 138-139 12.8125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTCTC 10 0.006830828 145.0 4 TCTCTCA 10 0.006830828 145.0 7 >>END_MODULE SRR7171091 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171091_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05625 33.0 33.0 34.0 32.0 34.0 2 32.73225 34.0 33.0 34.0 32.0 34.0 3 33.099 34.0 33.0 34.0 32.0 34.0 4 33.15575 34.0 33.0 34.0 33.0 34.0 5 33.22475 34.0 33.0 34.0 33.0 34.0 6 37.41675 38.0 38.0 38.0 38.0 38.0 7 37.38825 38.0 38.0 38.0 38.0 38.0 8 37.48225 38.0 38.0 38.0 38.0 38.0 9 37.5075 38.0 38.0 38.0 38.0 38.0 10-14 37.458600000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.4019 38.0 38.0 38.0 37.8 38.0 20-24 36.247299999999996 38.0 37.4 38.0 30.4 38.0 25-29 36.91715000000001 38.0 38.0 38.0 36.2 38.0 30-34 37.28265 38.0 38.0 38.0 37.0 38.0 35-39 37.374 38.0 38.0 38.0 37.0 38.0 40-44 37.3665 38.0 38.0 38.0 37.2 38.0 45-49 37.32965 38.0 38.0 38.0 37.0 38.0 50-54 37.33265000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2801 38.0 38.0 38.0 37.0 38.0 60-64 37.204499999999996 38.0 38.0 38.0 36.8 38.0 65-69 37.169500000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.12215 38.0 38.0 38.0 36.6 38.0 75-79 36.742000000000004 38.0 37.8 38.0 34.6 38.0 80-84 35.3791 38.0 35.6 38.0 29.0 38.0 85-89 36.87405 38.0 38.0 38.0 36.0 38.0 90-94 36.85105 38.0 38.0 38.0 36.0 38.0 95-99 36.67345 38.0 38.0 38.0 35.2 38.0 100-104 36.63315 38.0 38.0 38.0 34.8 38.0 105-109 35.243849999999995 38.0 35.6 38.0 28.6 38.0 110-114 36.08125 38.0 37.6 38.0 33.2 38.0 115-119 35.348299999999995 38.0 36.4 38.0 27.6 38.0 120-124 35.6282 38.0 36.6 38.0 31.4 38.0 125-129 35.4695 38.0 36.0 38.0 31.0 38.0 130-134 35.098299999999995 38.0 36.0 38.0 28.8 38.0 135-139 34.74885 38.0 35.4 38.0 28.2 38.0 140-144 32.78224999999999 37.0 29.6 38.0 22.8 38.0 145-149 31.427999999999997 36.4 30.2 38.0 10.8 38.0 150-151 27.15125 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 3.0 14 3.0 15 3.0 16 3.0 17 4.0 18 2.0 19 5.0 20 6.0 21 2.0 22 5.0 23 9.0 24 8.0 25 5.0 26 20.0 27 30.0 28 22.0 29 38.0 30 53.0 31 52.0 32 77.0 33 107.0 34 176.0 35 344.0 36 966.0 37 2052.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.349999999999998 22.55 8.075000000000001 40.025 2 21.075 23.5 43.05 12.375 3 14.575 27.425 36.175000000000004 21.825 4 19.675 36.375 24.85 19.1 5 23.380845211302827 39.83495873968492 21.45536384096024 15.328832208052013 6 17.525 39.15 26.025 17.299999999999997 7 18.125 20.075000000000003 41.3 20.5 8 16.75 24.9 32.475 25.874999999999996 9 18.675 22.275 33.900000000000006 25.15 10-14 22.415 28.544999999999998 27.36 21.68 15-19 21.975 28.485 28.499999999999996 21.04 20-24 22.59 27.839999999999996 28.83 20.74 25-29 22.325 28.410000000000004 28.299999999999997 20.965 30-34 21.59 28.88 28.575 20.955 35-39 21.875 28.485 28.58 21.060000000000002 40-44 22.32 27.845 28.720000000000002 21.115000000000002 45-49 22.205 28.244999999999997 29.065 20.485 50-54 22.59 27.765 28.549999999999997 21.095 55-59 22.285 27.894999999999996 28.63 21.19 60-64 22.395 28.355000000000004 28.13 21.12 65-69 22.935 27.939999999999998 28.42 20.705000000000002 70-74 23.419999999999998 28.005000000000003 27.625 20.95 75-79 22.695 27.605 28.15 21.55 80-84 23.01 28.58 27.389999999999997 21.02 85-89 22.865 28.439999999999998 28.310000000000002 20.385 90-94 23.005 28.07 28.044999999999998 20.880000000000003 95-99 23.405 28.455000000000002 27.634999999999998 20.505000000000003 100-104 23.94 27.889999999999997 27.865000000000002 20.305 105-109 23.549999999999997 28.939999999999998 27.73 19.78 110-114 23.91 28.665000000000003 27.42 20.005 115-119 24.610000000000003 28.199999999999996 27.560000000000002 19.63 120-124 25.169999999999998 28.544999999999998 27.169999999999998 19.115 125-129 24.834999999999997 28.599999999999998 27.395000000000003 19.17 130-134 25.515 28.384999999999998 27.245 18.855 135-139 25.335 28.865000000000002 26.995 18.805 140-144 26.075 28.43 27.029999999999998 18.465 145-149 26.33 28.33 27.48 17.86 150-151 27.375 29.7875 25.2125 17.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.5 24 3.0 25 4.5 26 7.0 27 9.0 28 11.5 29 13.5 30 17.5 31 31.0 32 39.0 33 52.0 34 66.5 35 84.0 36 104.5 37 114.0 38 152.0 39 198.5 40 210.0 41 227.0 42 255.0 43 284.5 44 285.5 45 254.5 46 250.5 47 232.5 48 202.5 49 177.0 50 142.0 51 125.5 52 103.5 53 78.0 54 72.5 55 57.5 56 36.0 57 24.5 58 19.5 59 13.5 60 8.0 61 5.0 62 2.0 63 4.0 64 5.0 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24184988627748 98.175 2 0.6570634318928481 1.3 3 0.0 0.0 4 0.050543340914834464 0.2 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025271670457417232 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.9624999999999999 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.3250000000000002 0.0 0.0 0.0 0.0 98-99 1.6749999999999998 0.0 0.0 0.0 0.0 100-101 2.1500000000000004 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 3.9625 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 5.1 0.0 0.0 0.0 0.0 114-115 5.725 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.800000000000001 0.0 0.0 0.0 0.0 120-121 7.3375 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0 0.0 124-125 8.2875 0.0 0.0 0.0 0.0 126-127 9.1 0.0 0.0 0.0 0.0 128-129 9.675 0.0 0.0 0.0 0.0 130-131 10.524999999999999 0.0 0.0 0.0 0.0 132-133 10.9875 0.0 0.0 0.0 0.0 134-135 11.6625 0.0 0.0 0.0 0.0 136-137 12.225000000000001 0.0 0.0 0.0 0.0 138-139 13.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAAGC 10 0.006830828 145.0 2 CTTCAAT 10 0.006830828 145.0 1 ATTTTAT 10 0.006830828 145.0 5 >>END_MODULE Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671983 spots for SRR7171091.sra Written 671983 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra Read 671976 spots for SRR7171091.sra Written 671976 spots for SRR7171091.sra SRR ids: ['SRR7171091.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhx0jh_m SRR7171091.sra spots: 13439527 blocks: [[1, 671976], [671977, 1343952], [1343953, 2015928], [2015929, 2687904], [2687905, 3359880], [3359881, 4031856], [4031857, 4703832], [4703833, 5375808], [5375809, 6047784], [6047785, 6719760], [6719761, 7391736], [7391737, 8063712], [8063713, 8735688], [8735689, 9407664], [9407665, 10079640], [10079641, 10751616], [10751617, 11423592], [11423593, 12095568], [12095569, 12767544], [12767545, 13439527]] SRR7171091 file size 4532514 SRR7171091 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171091 SRR7171091_1.fastq SRR7171091_2.fastq Input file: SRR7171091_1.fastq Paired file: SRR7171091_2.fastq trimmed: SRR7171091-trimmed-pair1.fastq, SRR7171091-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:17:39 2025 >> started Fri Feb 14 03:17:52 2025 >> done (13.756s) 13439527 read pairs processed; of these: 7656 ( 0.06%) short read pairs filtered out after trimming by size control 13772 ( 0.10%) empty read pairs filtered out after trimming by size control 13418099 (99.84%) read pairs available; of these: 8478222 (63.18%) trimmed read pairs available after processing 4939877 (36.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 7 0.00% 20 15 0.00% 21 22 0.00% 22 13 0.00% 23 16 0.00% 24 20 0.00% 25 20 0.00% 26 27 0.00% 27 18 0.00% 28 29 0.00% 29 23 0.00% 30 22 0.00% 31 25 0.00% 32 24 0.00% 33 35 0.00% 34 38 0.00% 35 49 0.00% 36 29 0.00% 37 45 0.00% 38 55 0.00% 39 56 0.00% 40 82 0.00% 41 68 0.00% 42 85 0.00% 43 90 0.00% 44 82 0.00% 45 119 0.00% 46 130 0.00% 47 145 0.00% 48 160 0.00% 49 192 0.00% 50 205 0.00% 51 279 0.00% 52 324 0.00% 53 323 0.00% 54 336 0.00% 55 355 0.00% 56 402 0.00% 57 413 0.00% 58 541 0.00% 59 588 0.00% 60 659 0.00% 61 762 0.01% 62 861 0.01% 63 960 0.01% 64 1043 0.01% 65 1038 0.01% 66 1228 0.01% 67 1298 0.01% 68 1518 0.01% 69 1710 0.01% 70 1978 0.01% 71 2121 0.02% 72 2476 0.02% 73 2821 0.02% 74 3000 0.02% 75 3291 0.02% 76 3686 0.03% 77 3967 0.03% 78 4350 0.03% 79 4885 0.04% 80 5186 0.04% 81 6057 0.05% 82 6779 0.05% 83 7556 0.06% 84 8639 0.06% 85 9327 0.07% 86 9974 0.07% 87 10427 0.08% 88 11186 0.08% 89 12021 0.09% 90 12791 0.10% 91 14054 0.10% 92 14991 0.11% 93 16723 0.12% 94 17595 0.13% 95 18768 0.14% 96 19357 0.14% 97 20387 0.15% 98 21194 0.16% 99 21719 0.16% 100 23346 0.17% 101 24274 0.18% 102 26084 0.19% 103 27059 0.20% 104 28440 0.21% 105 30072 0.22% 106 30659 0.23% 107 31302 0.23% 108 32585 0.24% 109 33347 0.25% 110 34349 0.26% 111 35883 0.27% 112 37390 0.28% 113 38262 0.29% 114 39846 0.30% 115 41282 0.31% 116 42375 0.32% 117 43130 0.32% 118 44802 0.33% 119 44485 0.33% 120 45773 0.34% 121 46850 0.35% 122 48932 0.36% 123 50534 0.38% 124 52124 0.39% 125 54005 0.40% 126 55354 0.41% 127 56145 0.42% 128 57172 0.43% 129 58810 0.44% 130 60167 0.45% 131 62468 0.47% 132 65301 0.49% 133 68115 0.51% 134 72346 0.54% 135 75139 0.56% 136 79572 0.59% 137 83443 0.62% 138 89395 0.67% 139 94876 0.71% 140 101360 0.76% 141 112403 0.84% 142 123700 0.92% 143 140572 1.05% 144 163813 1.22% 145 196146 1.46% 146 243028 1.81% 147 324298 2.42% 148 487487 3.63% 149 918699 6.85% 150 3387311 25.24% 151 4939877 36.82% 13418099 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=19 prefix-density=0.40 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=292.79 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=18.2 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=24 prefix-density=0.28 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=29.00 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.7 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7171091 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:18:39 Started mapping on | Feb 14 03:18:39 Finished on | Feb 14 03:19:59 Mapping speed, Million of reads per hour | 603.81 Number of input reads | 13418099 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12823778 Uniquely mapped reads % | 95.57% Average mapped length | 287.96 Number of splices: Total | 12167781 Number of splices: Annotated (sjdb) | 11871541 Number of splices: GT/AG | 11929512 Number of splices: GC/AG | 182958 Number of splices: AT/AC | 7080 Number of splices: Non-canonical | 48231 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348823 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 23941 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.60% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253700 253700 253700 N_multimapping 348823 348823 348823 N_noFeature 583239 12625729 668145 N_ambiguous 208302 747 94719 UnstrandedReadsAssigned:12032237 PositiveStrandReadsAssigned:197302 NegativeStrandReadsAssigned:12060914 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171091 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171091-trimmed-pair1.fastq SRR7171091-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,418,099 reads, 12,010,243 reads pseudoaligned [quant] estimated average fragment length: 216.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7171091.ke.tsv 34699 SRR7171091.se.tsv 87100 total ==> SRR7171091.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.18 583 25.1229 Potri.005G024800.1.v4.1 1035 819.181 226 21.4253 Potri.004G059700.1.v4.1 961 745.206 23 2.39691 Potri.007G009000.2.v4.1 1416 1200.18 0 0 Potri.003G141000.2.v4.1 2943 2727.18 818.79 23.3162 Potri.016G087400.1.v4.1 270 93.0504 866 722.769 Potri.015G069301.1.v4.1 564 351.683 0 0 Potri.010G195200.1.v4.1 1773 1557.18 40 1.9949 Potri.012G127500.1.v4.1 977 761.191 141 14.3855 ==> SRR7171091.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 735 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 91 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 11 SRR7171091 completed mapping pipeline successfully