Starting /dee2/code/volunteer_pipeline.sh SRR7171092 current disk space = 3088141373440 free memory = 1573563480 SRR7171092 SRAfilesize c66a6de8c9b2183ca5e589b1516127e0 SRR7171092.sra SRR7171092.sra file validated SRR7171092 is paired end SRR7171092 is conventional basespace SRR7171092 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171092_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.47275 31.0 18.0 33.0 18.0 33.0 2 26.81775 29.0 18.0 31.0 18.0 33.0 3 30.18125 31.0 29.0 33.0 27.0 33.0 4 31.84475 33.0 31.0 33.0 29.0 33.0 5 32.60725 33.0 33.0 33.0 32.0 34.0 6 36.33425 38.0 36.0 38.0 33.0 38.0 7 36.70575 38.0 37.0 38.0 34.0 38.0 8 37.1865 38.0 38.0 38.0 36.0 38.0 9 37.28775 38.0 38.0 38.0 36.0 38.0 10-14 37.2981 38.0 38.0 38.0 36.4 38.0 15-19 37.410700000000006 38.0 38.0 38.0 36.8 38.0 20-24 37.184000000000005 38.0 38.0 38.0 36.2 38.0 25-29 37.2278 38.0 38.0 38.0 36.6 38.0 30-34 37.1365 38.0 38.0 38.0 36.4 38.0 35-39 37.11055 38.0 38.0 38.0 36.6 38.0 40-44 37.02419999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.97865 38.0 38.0 38.0 36.0 38.0 50-54 36.23505 38.0 37.4 38.0 32.8 38.0 55-59 35.0206 37.8 35.0 38.0 27.6 38.0 60-64 36.59005 38.0 37.8 38.0 34.2 38.0 65-69 36.6177 38.0 38.0 38.0 34.4 38.0 70-74 36.42405 38.0 38.0 38.0 34.0 38.0 75-79 36.2867 38.0 37.6 38.0 34.0 38.0 80-84 36.20935 38.0 37.6 38.0 33.8 38.0 85-89 35.897149999999996 38.0 37.0 38.0 32.6 38.0 90-94 35.697050000000004 38.0 37.0 38.0 31.6 38.0 95-99 35.539699999999996 38.0 36.8 38.0 30.6 38.0 100-104 35.528999999999996 38.0 36.8 38.0 31.0 38.0 105-109 35.3591 38.0 36.0 38.0 30.2 38.0 110-114 35.061099999999996 38.0 36.0 38.0 28.8 38.0 115-119 34.5407 38.0 35.2 38.0 26.8 38.0 120-124 34.273700000000005 38.0 35.0 38.0 25.0 38.0 125-129 34.153800000000004 38.0 34.6 38.0 24.8 38.0 130-134 31.653699999999997 36.0 28.0 38.0 16.4 38.0 135-139 32.91745 37.6 33.4 38.0 15.0 38.0 140-144 32.30265 37.0 33.0 38.0 14.2 38.0 145-149 31.458299999999998 36.0 31.8 38.0 11.2 38.0 150-151 26.677999999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 5.0 7 2.0 8 7.0 9 0.0 10 2.0 11 2.0 12 3.0 13 1.0 14 6.0 15 3.0 16 3.0 17 2.0 18 11.0 19 9.0 20 6.0 21 10.0 22 7.0 23 12.0 24 19.0 25 20.0 26 18.0 27 22.0 28 35.0 29 26.0 30 66.0 31 83.0 32 127.0 33 178.0 34 274.0 35 598.0 36 1235.0 37 1207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.99221789883269 9.72762645914397 18.028534370946822 46.25162127107652 2 17.61761761761762 16.866866866866868 36.486486486486484 29.02902902902903 3 18.975 23.45 28.050000000000004 29.525000000000002 4 22.25 29.825000000000003 23.95 23.974999999999998 5 20.05 33.975 26.75 19.225 6 16.55 36.575 27.275 19.6 7 13.425 22.0 45.85 18.725 8 17.175 24.125 32.025 26.674999999999997 9 17.599999999999998 23.225 34.050000000000004 25.124999999999996 10-14 19.25 30.085 27.705000000000002 22.96 15-19 19.314999999999998 29.095 28.34 23.25 20-24 19.525000000000002 29.065 28.565 22.845 25-29 18.975 28.945 28.904999999999998 23.175 30-34 19.505 29.205 28.49 22.8 35-39 19.744999999999997 28.925 28.199999999999996 23.13 40-44 19.794999999999998 29.575000000000003 28.125 22.505 45-49 19.905 28.544999999999998 27.88 23.669999999999998 50-54 20.05 28.499999999999996 28.425 23.025000000000002 55-59 19.355 28.775000000000002 28.17 23.7 60-64 19.31 28.43 28.815 23.445 65-69 19.455 28.865000000000002 28.470000000000002 23.21 70-74 19.445 28.62 28.57 23.365 75-79 19.735 28.335 28.52 23.41 80-84 19.81 28.88 28.235 23.075000000000003 85-89 19.645000000000003 28.810000000000002 28.115000000000002 23.43 90-94 19.814999999999998 28.265 28.315 23.605 95-99 20.515 28.389999999999997 28.215 22.88 100-104 19.71 28.65 28.605000000000004 23.035 105-109 20.32 28.389999999999997 28.265 23.025000000000002 110-114 20.45 28.63 27.939999999999998 22.98 115-119 20.810000000000002 28.565 27.705000000000002 22.919999999999998 120-124 20.305 28.449999999999996 28.13 23.115 125-129 20.525 28.499999999999996 28.050000000000004 22.925 130-134 20.724999999999998 28.09 27.994999999999997 23.189999999999998 135-139 20.43 28.875 27.534999999999997 23.16 140-144 20.7 28.499999999999996 27.76 23.04 145-149 20.7 28.64 27.155 23.505000000000003 150-151 20.0125 29.1875 27.8625 22.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 15.0 1 11.0 2 7.5 3 6.5 4 5.0 5 2.5 6 1.5 7 2.0 8 2.0 9 2.0 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 2.5 21 2.0 22 1.5 23 1.0 24 1.0 25 2.5 26 4.0 27 6.0 28 10.5 29 20.5 30 25.5 31 36.5 32 50.5 33 60.5 34 73.5 35 91.5 36 100.5 37 114.5 38 150.0 39 174.0 40 186.5 41 207.5 42 236.0 43 241.5 44 247.0 45 251.5 46 257.0 47 249.0 48 217.0 49 178.0 50 161.5 51 140.0 52 102.0 53 82.0 54 62.5 55 50.5 56 40.0 57 29.5 58 21.5 59 19.5 60 17.0 61 10.5 62 3.5 63 2.5 64 1.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03258655804481 97.25 2 0.7892057026476579 1.55 3 0.07637474541751527 0.22499999999999998 4 0.0 0.0 5 0.02545824847250509 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07637474541751527 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTA 13 0.325 TruSeq Adapter, Index 13 (97% over 38bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 10 0.25 TruSeq Adapter, Index 13 (97% over 38bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.325 0.0 0.0 0.0 0.0 2 0.325 0.0 0.0 0.0 0.0 3 0.325 0.0 0.0 0.0 0.0 4 0.325 0.0 0.0 0.0 0.0 5 0.325 0.0 0.0 0.0 0.0 6 0.325 0.0 0.0 0.0 0.0 7 0.325 0.0 0.0 0.0 0.0 8 0.325 0.0 0.0 0.0 0.0 9 0.325 0.0 0.0 0.0 0.0 10-11 0.325 0.0 0.0 0.0 0.0 12-13 0.325 0.0 0.0 0.0 0.0 14-15 0.325 0.0 0.0 0.0 0.0 16-17 0.325 0.0 0.0 0.0 0.0 18-19 0.325 0.0 0.0 0.0 0.0 20-21 0.325 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.325 0.0 0.0 0.0 0.0 34-35 0.325 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.325 0.0 0.0 0.0 0.0 48-49 0.325 0.0 0.0 0.0 0.0 50-51 0.325 0.0 0.0 0.0 0.0 52-53 0.325 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.325 0.0 0.0 0.0 0.0 58-59 0.325 0.0 0.0 0.0 0.0 60-61 0.35 0.0 0.0 0.0 0.0 62-63 0.375 0.0 0.0 0.0 0.0 64-65 0.375 0.0 0.0 0.0 0.0 66-67 0.375 0.0 0.0 0.0 0.0 68-69 0.375 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.375 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.1124999999999998 0.0 0.0 0.0 0.0 114-115 1.2625 0.0 0.0 0.0 0.0 116-117 1.3875000000000002 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 1.9249999999999998 0.0 0.0 0.0 0.0 128-129 2.075 0.0 0.0 0.0 0.0 130-131 2.2875 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.85 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCAT 10 0.0063298983 148.6923 1 >>END_MODULE SRR7171092 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171092_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.197 33.0 32.0 34.0 30.0 34.0 2 32.5125 33.0 33.0 34.0 32.0 34.0 3 30.1625 33.0 30.0 34.0 18.0 34.0 4 31.86425 33.0 32.0 34.0 27.0 34.0 5 32.4185 33.0 33.0 34.0 32.0 34.0 6 36.83075 38.0 38.0 38.0 36.0 38.0 7 36.94325 38.0 38.0 38.0 36.0 38.0 8 37.05275 38.0 38.0 38.0 37.0 38.0 9 37.04025 38.0 38.0 38.0 37.0 38.0 10-14 37.005849999999995 38.0 38.0 38.0 36.8 38.0 15-19 36.997049999999994 38.0 38.0 38.0 36.8 38.0 20-24 36.775400000000005 38.0 38.0 38.0 35.8 38.0 25-29 36.679899999999996 38.0 38.0 38.0 35.6 38.0 30-34 36.8264 38.0 38.0 38.0 36.0 38.0 35-39 36.8534 38.0 38.0 38.0 36.2 38.0 40-44 36.896 38.0 38.0 38.0 36.0 38.0 45-49 36.8786 38.0 38.0 38.0 36.2 38.0 50-54 36.827600000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8052 38.0 38.0 38.0 35.8 38.0 60-64 36.74945 38.0 38.0 38.0 35.8 38.0 65-69 36.7765 38.0 38.0 38.0 35.8 38.0 70-74 36.7579 38.0 38.0 38.0 35.6 38.0 75-79 36.7237 38.0 38.0 38.0 35.6 38.0 80-84 36.3979 38.0 38.0 38.0 34.6 38.0 85-89 36.329950000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.348749999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.320550000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.090700000000005 38.0 38.0 38.0 33.8 38.0 105-109 35.80405 38.0 37.0 38.0 32.6 38.0 110-114 34.2284 37.8 33.4 38.0 25.0 38.0 115-119 35.0133 37.8 35.4 38.0 28.8 38.0 120-124 35.370050000000006 38.0 36.6 38.0 30.6 38.0 125-129 35.0631 38.0 36.0 38.0 29.2 38.0 130-134 34.781349999999996 38.0 35.6 38.0 27.8 38.0 135-139 34.40645 38.0 34.4 38.0 26.8 38.0 140-144 33.7996 38.0 33.4 38.0 23.0 38.0 145-149 33.048950000000005 38.0 33.0 38.0 16.8 38.0 150-151 27.970875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 0.0 6 1.0 7 1.0 8 1.0 9 4.0 10 1.0 11 3.0 12 7.0 13 4.0 14 3.0 15 3.0 16 2.0 17 4.0 18 3.0 19 5.0 20 12.0 21 9.0 22 10.0 23 12.0 24 14.0 25 16.0 26 22.0 27 27.0 28 30.0 29 27.0 30 53.0 31 50.0 32 93.0 33 91.0 34 167.0 35 300.0 36 761.0 37 2251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.199999999999996 16.825000000000003 22.45 32.525 2 25.6 23.1 34.525 16.775000000000002 3 20.4 28.125 31.275 20.200000000000003 4 23.936968484242122 34.492246123061534 21.335667833916958 20.23511755877939 5 24.474474474474476 34.68468468468468 23.44844844844845 17.39239239239239 6 18.825 38.925 23.75 18.5 7 18.975 18.45 41.425 21.15 8 21.6 25.874999999999996 27.750000000000004 24.775 9 21.25 25.124999999999996 29.299999999999997 24.325 10-14 23.235 28.735 26.125 21.905 15-19 22.795 28.634999999999998 27.705000000000002 20.865000000000002 20-24 23.325000000000003 28.985 27.47 20.22 25-29 23.0 28.744999999999997 27.525 20.73 30-34 23.27 28.444999999999997 28.03 20.255000000000003 35-39 22.575 28.395 28.139999999999997 20.89 40-44 23.59 27.860000000000003 28.110000000000003 20.44 45-49 22.759999999999998 28.12 28.560000000000002 20.560000000000002 50-54 23.294999999999998 27.43 28.485 20.79 55-59 23.09 27.944999999999997 28.15 20.815 60-64 22.900000000000002 27.755000000000003 27.865000000000002 21.48 65-69 22.955000000000002 28.23 28.139999999999997 20.674999999999997 70-74 22.89 28.410000000000004 27.860000000000003 20.84 75-79 22.88 28.28 27.52 21.32 80-84 23.025000000000002 28.315 27.63 21.029999999999998 85-89 23.724999999999998 28.155 27.52 20.599999999999998 90-94 23.275000000000002 28.095 27.66 20.97 95-99 23.505000000000003 27.93 27.800000000000004 20.765 100-104 24.095 27.500000000000004 28.125 20.28 105-109 23.510877719429857 28.11202800700175 28.22705676419105 20.150037509377345 110-114 24.32 27.68 27.87 20.13 115-119 23.815 28.144999999999996 27.775 20.265 120-124 23.255 28.9 27.229999999999997 20.615 125-129 23.945 28.235 27.575 20.244999999999997 130-134 23.46 27.82 28.225 20.495 135-139 23.79 28.52 27.74 19.950000000000003 140-144 23.875 28.425 27.935 19.765 145-149 24.165 28.555000000000003 27.375 19.905 150-151 24.462500000000002 28.125 28.3625 19.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 3.0 25 4.0 26 7.5 27 9.5 28 11.5 29 16.0 30 17.0 31 19.5 32 35.5 33 47.0 34 50.0 35 70.0 36 88.0 37 104.5 38 122.5 39 156.0 40 199.5 41 225.5 42 233.5 43 237.5 44 270.5 45 280.0 46 267.0 47 245.5 48 227.0 49 205.0 50 166.5 51 139.0 52 109.0 53 97.5 54 84.5 55 58.5 56 46.0 57 36.0 58 27.0 59 20.0 60 13.5 61 10.0 62 7.0 63 4.5 64 3.5 65 3.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01015228426397 97.52499999999999 2 0.7106598984771574 1.4000000000000001 3 0.17766497461928935 0.525 4 0.025380710659898477 0.1 5 0.025380710659898477 0.125 6 0.025380710659898477 0.15 7 0.025380710659898477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATC 6 0.15 Illumina Single End PCR Primer 1 (97% over 35bp) CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.025 0.0 0.0 80-81 0.225 0.0 0.025 0.0 0.0 82-83 0.225 0.0 0.025 0.0 0.0 84-85 0.25 0.0 0.025 0.0 0.0 86-87 0.25 0.0 0.025 0.0 0.0 88-89 0.32499999999999996 0.0 0.025 0.0 0.0 90-91 0.375 0.0 0.025 0.0 0.0 92-93 0.375 0.0 0.025 0.0 0.0 94-95 0.3875 0.0 0.025 0.0 0.0 96-97 0.4625 0.0 0.025 0.0 0.0 98-99 0.475 0.0 0.025 0.0 0.0 100-101 0.525 0.0 0.025 0.0 0.0 102-103 0.5874999999999999 0.0 0.025 0.0 0.0 104-105 0.625 0.0 0.025 0.0 0.0 106-107 0.725 0.0 0.025 0.0 0.0 108-109 0.8 0.0 0.025 0.0 0.0 110-111 0.9 0.0 0.025 0.0 0.0 112-113 0.9874999999999999 0.0 0.025 0.0 0.0 114-115 1.1125 0.0 0.025 0.0 0.0 116-117 1.2374999999999998 0.0 0.025 0.0 0.0 118-119 1.35 0.0 0.025 0.0 0.0 120-121 1.4125 0.0 0.025 0.0 0.0 122-123 1.5375 0.0 0.025 0.0 0.0 124-125 1.7125 0.0 0.025 0.0 0.0 126-127 1.85 0.0 0.025 0.0 0.0 128-129 2.0 0.0 0.025 0.0 0.0 130-131 2.2125 0.0 0.025 0.0 0.0 132-133 2.4000000000000004 0.0 0.025 0.0 0.0 134-135 2.625 0.0 0.025 0.0 0.0 136-137 2.775 0.0 0.025 0.0 0.0 138-139 3.0375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCATG 10 0.006830828 145.0 145 GGAATTC 10 0.006830828 145.0 4 AAAAAAA 20 0.00593511 29.0 70-74 >>END_MODULE Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra Read 581961 spots for SRR7171092.sra Written 581961 spots for SRR7171092.sra Read 581956 spots for SRR7171092.sra Written 581956 spots for SRR7171092.sra SRR ids: ['SRR7171092.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__j87vw7w SRR7171092.sra spots: 11639125 blocks: [[1, 581956], [581957, 1163912], [1163913, 1745868], [1745869, 2327824], [2327825, 2909780], [2909781, 3491736], [3491737, 4073692], [4073693, 4655648], [4655649, 5237604], [5237605, 5819560], [5819561, 6401516], [6401517, 6983472], [6983473, 7565428], [7565429, 8147384], [8147385, 8729340], [8729341, 9311296], [9311297, 9893252], [9893253, 10475208], [10475209, 11057164], [11057165, 11639125]] SRR7171092 file size 3922417 SRR7171092 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171092 SRR7171092_1.fastq SRR7171092_2.fastq Input file: SRR7171092_1.fastq Paired file: SRR7171092_2.fastq trimmed: SRR7171092-trimmed-pair1.fastq, SRR7171092-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:25:36 2025 >> started Fri Feb 14 03:25:51 2025 >> done (14.249s) 11639125 read pairs processed; of these: 15816 ( 0.14%) short read pairs filtered out after trimming by size control 76324 ( 0.66%) empty read pairs filtered out after trimming by size control 11546985 (99.21%) read pairs available; of these: 6488311 (56.19%) trimmed read pairs available after processing 5058674 (43.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 26 0.00% 21 34 0.00% 22 42 0.00% 23 44 0.00% 24 59 0.00% 25 41 0.00% 26 44 0.00% 27 53 0.00% 28 57 0.00% 29 45 0.00% 30 37 0.00% 31 45 0.00% 32 38 0.00% 33 46 0.00% 34 30 0.00% 35 33 0.00% 36 43 0.00% 37 35 0.00% 38 31 0.00% 39 33 0.00% 40 40 0.00% 41 49 0.00% 42 60 0.00% 43 66 0.00% 44 61 0.00% 45 67 0.00% 46 74 0.00% 47 111 0.00% 48 137 0.00% 49 120 0.00% 50 169 0.00% 51 160 0.00% 52 169 0.00% 53 208 0.00% 54 181 0.00% 55 263 0.00% 56 312 0.00% 57 317 0.00% 58 317 0.00% 59 353 0.00% 60 397 0.00% 61 555 0.00% 62 585 0.01% 63 632 0.01% 64 613 0.01% 65 537 0.00% 66 524 0.00% 67 518 0.00% 68 527 0.00% 69 573 0.00% 70 612 0.01% 71 642 0.01% 72 673 0.01% 73 742 0.01% 74 790 0.01% 75 865 0.01% 76 906 0.01% 77 929 0.01% 78 1073 0.01% 79 1213 0.01% 80 1315 0.01% 81 1450 0.01% 82 1658 0.01% 83 1992 0.02% 84 2782 0.02% 85 3658 0.03% 86 4733 0.04% 87 5451 0.05% 88 5961 0.05% 89 5738 0.05% 90 5270 0.05% 91 5011 0.04% 92 4720 0.04% 93 4652 0.04% 94 4352 0.04% 95 4688 0.04% 96 4773 0.04% 97 5016 0.04% 98 5074 0.04% 99 5584 0.05% 100 5856 0.05% 101 6056 0.05% 102 6567 0.06% 103 7003 0.06% 104 7874 0.07% 105 8425 0.07% 106 8852 0.08% 107 9483 0.08% 108 10231 0.09% 109 11023 0.10% 110 11463 0.10% 111 12184 0.11% 112 13186 0.11% 113 13817 0.12% 114 14441 0.13% 115 15294 0.13% 116 16044 0.14% 117 16401 0.14% 118 16899 0.15% 119 17279 0.15% 120 17536 0.15% 121 17654 0.15% 122 18176 0.16% 123 18696 0.16% 124 19518 0.17% 125 20246 0.18% 126 20632 0.18% 127 21578 0.19% 128 23074 0.20% 129 23786 0.21% 130 25436 0.22% 131 26764 0.23% 132 28381 0.25% 133 30350 0.26% 134 32888 0.28% 135 36140 0.31% 136 38879 0.34% 137 43087 0.37% 138 48147 0.42% 139 53163 0.46% 140 60491 0.52% 141 69573 0.60% 142 81965 0.71% 143 98608 0.85% 144 121637 1.05% 145 153296 1.33% 146 199334 1.73% 147 284966 2.47% 148 451546 3.91% 149 888217 7.69% 150 3184311 27.58% 151 5058674 43.81% 11546985 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=50.85 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=1.17 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=12.01 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=3.6 sequence=AAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCACGCACAAAGCATCTTGGCCATCTGGGCTACACAGGTGGTCTTGATGGGTGCCGTTGAGGGTTACAGAATTGCTGGCGGGCCACTCGGTGAGGTAACTGACCCAATCTACCCAGGTGGAAGCTTCGACCCACTGGGCTTGGCTGACGATCCCGAAGCATTCGCTGAGTTGAAGGTGAAGGAACTCAAGAATGG SRR7171092 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:26:34 Started mapping on | Feb 14 03:26:35 Finished on | Feb 14 03:28:13 Mapping speed, Million of reads per hour | 424.17 Number of input reads | 11546985 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 10708971 Uniquely mapped reads % | 92.74% Average mapped length | 295.25 Number of splices: Total | 10320165 Number of splices: Annotated (sjdb) | 10101266 Number of splices: GT/AG | 10123798 Number of splices: GC/AG | 158416 Number of splices: AT/AC | 6644 Number of splices: Non-canonical | 31307 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320362 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 18299 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 544018 544018 544018 N_multimapping 320362 320362 320362 N_noFeature 373651 10509089 421832 N_ambiguous 229057 709 77016 UnstrandedReadsAssigned:10106263 PositiveStrandReadsAssigned:199173 NegativeStrandReadsAssigned:10210123 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7171092 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171092-trimmed-pair1.fastq SRR7171092-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,546,985 reads, 10,151,426 reads pseudoaligned [quant] estimated average fragment length: 257.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7171092.ke.tsv 34699 SRR7171092.se.tsv 87100 total ==> SRR7171092.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.28 753 31.0723 Potri.005G024800.1.v4.1 1035 778.277 283 26.4276 Potri.004G059700.1.v4.1 961 704.293 13 1.34152 Potri.007G009000.2.v4.1 1416 1159.28 0 0 Potri.003G141000.2.v4.1 2943 2686.28 599.436 16.218 Potri.016G087400.1.v4.1 270 68.6635 733 775.861 Potri.015G069301.1.v4.1 564 310.926 0 0 Potri.010G195200.1.v4.1 1773 1516.28 86 4.12217 Potri.012G127500.1.v4.1 977 720.288 57 5.75141 ==> SRR7171092.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 276 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7171092 completed mapping pipeline successfully