Starting /dee2/code/volunteer_pipeline.sh SRR7171093 current disk space = 3087932850176 free memory = 1574787356 SRR7171093 SRAfilesize c0598a39f6cb5a5d5765ab044febd128 SRR7171093.sra SRR7171093.sra file validated SRR7171093 is paired end SRR7171093 is conventional basespace SRR7171093 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171093_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.049 32.0 18.0 33.0 18.0 33.0 2 27.168 29.0 25.0 31.0 18.0 33.0 3 29.768 31.0 28.0 33.0 25.0 33.0 4 31.39475 33.0 31.0 33.0 29.0 33.0 5 32.32725 33.0 32.0 33.0 32.0 33.0 6 33.46425 37.0 33.0 38.0 16.0 38.0 7 35.6085 37.0 35.0 38.0 30.0 38.0 8 36.473 38.0 37.0 38.0 34.0 38.0 9 37.0475 38.0 38.0 38.0 35.0 38.0 10-14 37.256099999999996 38.0 38.0 38.0 36.2 38.0 15-19 37.3475 38.0 38.0 38.0 36.8 38.0 20-24 37.45265 38.0 38.0 38.0 37.0 38.0 25-29 37.40865 38.0 38.0 38.0 37.0 38.0 30-34 37.4067 38.0 38.0 38.0 37.0 38.0 35-39 37.0029 38.0 38.0 38.0 35.6 38.0 40-44 37.25945 38.0 38.0 38.0 36.8 38.0 45-49 37.17225 38.0 38.0 38.0 36.0 38.0 50-54 35.510400000000004 38.0 35.2 38.0 28.0 38.0 55-59 36.35985 38.0 37.2 38.0 32.6 38.0 60-64 36.86485 38.0 38.0 38.0 35.4 38.0 65-69 36.8316 38.0 38.0 38.0 35.2 38.0 70-74 36.68035 38.0 38.0 38.0 34.4 38.0 75-79 36.5186 38.0 38.0 38.0 34.2 38.0 80-84 36.3541 38.0 37.8 38.0 33.8 38.0 85-89 36.261849999999995 38.0 37.8 38.0 34.0 38.0 90-94 36.080650000000006 38.0 37.0 38.0 33.0 38.0 95-99 36.03825 38.0 37.0 38.0 33.2 38.0 100-104 35.90205 38.0 37.0 38.0 32.8 38.0 105-109 35.75955 38.0 37.0 38.0 31.8 38.0 110-114 35.39085 38.0 36.4 38.0 29.8 38.0 115-119 35.09235 38.0 36.0 38.0 28.4 38.0 120-124 34.9143 38.0 35.6 38.0 28.0 38.0 125-129 34.56035000000001 38.0 35.0 38.0 26.6 38.0 130-134 30.979950000000002 35.6 23.4 38.0 16.2 38.0 135-139 33.55295 37.6 33.8 38.0 22.2 38.0 140-144 33.2122 38.0 33.6 38.0 17.4 38.0 145-149 31.336850000000005 37.0 30.8 38.0 11.2 38.0 150-151 27.296875 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 1.0 17 7.0 18 14.0 19 12.0 20 5.0 21 1.0 22 7.0 23 9.0 24 14.0 25 15.0 26 15.0 27 28.0 28 29.0 29 41.0 30 49.0 31 81.0 32 107.0 33 180.0 34 318.0 35 525.0 36 1347.0 37 1186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.720990201134605 12.60959257349149 5.157297576070139 63.51211964930377 2 10.225 15.9 55.474999999999994 18.4 3 11.600000000000001 20.0 34.325 34.075 4 17.424999999999997 28.95 27.925 25.7 5 19.475 33.25 28.375 18.9 6 15.950000000000001 33.275 30.025000000000002 20.75 7 12.625 23.599999999999998 47.199999999999996 16.575 8 14.224999999999998 23.474999999999998 37.1 25.2 9 15.325 20.7 38.65 25.324999999999996 10-14 18.32 29.04 28.16 24.48 15-19 18.515 29.505 28.28 23.7 20-24 18.495 29.025000000000002 28.37 24.11 25-29 18.834999999999997 29.195 27.73 24.240000000000002 30-34 18.665000000000003 29.330000000000002 28.189999999999998 23.815 35-39 19.395 28.84 28.310000000000002 23.455000000000002 40-44 19.365 29.79 27.57 23.275000000000002 45-49 19.97 28.744999999999997 27.88 23.405 50-54 19.725 28.875 28.42 22.98 55-59 19.55 28.675 28.384999999999998 23.39 60-64 19.505 28.625 27.900000000000002 23.97 65-69 19.825 29.385 27.76 23.03 70-74 19.165 29.755 27.35 23.73 75-79 19.43 29.57 27.685 23.315 80-84 19.435 28.525 28.275 23.765 85-89 19.985 29.060000000000002 27.365000000000002 23.59 90-94 20.02 28.884999999999998 27.445000000000004 23.65 95-99 20.14 28.625 28.01 23.225 100-104 20.200000000000003 29.104999999999997 27.639999999999997 23.055 105-109 20.765 29.015 27.750000000000004 22.470000000000002 110-114 20.349999999999998 28.810000000000002 27.66 23.18 115-119 20.66 28.535 27.265 23.54 120-124 19.939999999999998 29.025000000000002 27.295 23.74 125-129 20.48 29.17 27.1 23.25 130-134 20.535 29.45 26.845000000000002 23.169999999999998 135-139 21.305 28.144999999999996 27.05 23.5 140-144 21.099999999999998 28.555000000000003 27.055 23.29 145-149 21.145 28.51 27.315 23.03 150-151 21.325 28.0875 27.675 22.912499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 3.5 24 7.0 25 9.5 26 11.5 27 10.5 28 15.0 29 21.5 30 30.0 31 42.5 32 53.0 33 70.0 34 90.0 35 106.5 36 111.5 37 121.0 38 145.0 39 171.5 40 211.0 41 244.5 42 251.0 43 266.0 44 263.5 45 241.0 46 225.5 47 202.5 48 187.5 49 168.0 50 142.5 51 123.5 52 101.5 53 86.0 54 71.5 55 51.0 56 38.5 57 32.0 58 22.0 59 12.0 60 12.5 61 10.0 62 3.0 63 2.5 64 1.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77551020408163 96.8 2 0.8928571428571428 1.7500000000000002 3 0.17857142857142858 0.525 4 0.05102040816326531 0.2 5 0.05102040816326531 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025510204081632654 0.22499999999999998 >10 0.025510204081632654 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTA 10 0.25 TruSeq Adapter, Index 7 (97% over 35bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 9 0.22499999999999998 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit CTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.325 0.0 0.0 0.0 0.0 2 0.325 0.0 0.0 0.0 0.0 3 0.325 0.0 0.0 0.0 0.0 4 0.325 0.0 0.0 0.0 0.0 5 0.325 0.0 0.0 0.0 0.0 6 0.325 0.0 0.0 0.0 0.0 7 0.325 0.0 0.0 0.0 0.0 8 0.325 0.0 0.0 0.0 0.0 9 0.325 0.0 0.0 0.0 0.0 10-11 0.325 0.0 0.0 0.0 0.0 12-13 0.325 0.0 0.0 0.0 0.0 14-15 0.325 0.0 0.0 0.0 0.0 16-17 0.325 0.0 0.0 0.0 0.0 18-19 0.325 0.0 0.0 0.0 0.0 20-21 0.325 0.0 0.0 0.0 0.0 22-23 0.325 0.0 0.0 0.0 0.0 24-25 0.325 0.0 0.0 0.0 0.0 26-27 0.325 0.0 0.0 0.0 0.0 28-29 0.325 0.0 0.0 0.0 0.0 30-31 0.325 0.0 0.0 0.0 0.0 32-33 0.325 0.0 0.0 0.0 0.0 34-35 0.325 0.0 0.0 0.0 0.0 36-37 0.325 0.0 0.0 0.0 0.0 38-39 0.325 0.0 0.0 0.0 0.0 40-41 0.325 0.0 0.0 0.0 0.0 42-43 0.325 0.0 0.0 0.0 0.0 44-45 0.325 0.0 0.0 0.0 0.0 46-47 0.3375 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.3625 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.375 0.0 0.0 0.0 0.0 60-61 0.3875 0.0 0.0 0.0 0.0 62-63 0.4125 0.0 0.0 0.0 0.0 64-65 0.425 0.0 0.0 0.0 0.0 66-67 0.425 0.0 0.0 0.0 0.0 68-69 0.425 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.5 0.0 0.0 0.0 0.0 76-77 0.65 0.0 0.0 0.0 0.0 78-79 0.7375 0.0 0.0 0.0 0.0 80-81 0.8125 0.0 0.0 0.0 0.0 82-83 1.0 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.35 0.0 0.0 0.0 0.0 90-91 1.5499999999999998 0.0 0.0 0.0 0.0 92-93 1.8375 0.0 0.0 0.0 0.0 94-95 2.0625 0.0 0.0 0.0 0.0 96-97 2.4124999999999996 0.0 0.0 0.0 0.0 98-99 2.7 0.0 0.0 0.0 0.0 100-101 3.25 0.0 0.0 0.0 0.0 102-103 3.6500000000000004 0.0 0.0 0.0 0.0 104-105 3.95 0.0 0.0 0.0 0.0 106-107 4.225 0.0 0.0 0.0 0.0 108-109 4.6 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 114-115 5.7875 0.0 0.0 0.0 0.0 116-117 6.3375 0.0 0.0 0.0 0.0 118-119 6.737500000000001 0.0 0.0 0.0 0.0 120-121 7.1875 0.0 0.0 0.0 0.0 122-123 7.55 0.0 0.0 0.0 0.0 124-125 7.925000000000001 0.0 0.0 0.0 0.0 126-127 8.5125 0.0 0.0 0.0 0.0 128-129 9.0 0.0 0.0 0.0 0.0 130-131 9.425 0.0 0.0 0.0 0.0 132-133 9.875 0.0 0.0 0.0 0.0 134-135 10.4375 0.0 0.0 0.0 0.0 136-137 11.0875 0.0 0.0 0.0 0.0 138-139 11.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTCCT 10 0.0068343505 144.975 5 CATAGTC 10 0.0068343505 144.975 8 >>END_MODULE SRR7171093 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171093_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0945 33.0 33.0 34.0 32.0 34.0 2 33.219 34.0 33.0 34.0 33.0 34.0 3 33.1085 34.0 33.0 34.0 32.0 34.0 4 33.19225 34.0 33.0 34.0 33.0 34.0 5 33.26075 34.0 33.0 34.0 33.0 34.0 6 37.4005 38.0 38.0 38.0 37.0 38.0 7 34.8095 38.0 36.0 38.0 16.0 38.0 8 36.7725 38.0 38.0 38.0 34.0 38.0 9 37.212 38.0 38.0 38.0 37.0 38.0 10-14 37.37895 38.0 38.0 38.0 37.2 38.0 15-19 37.395500000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.34175 38.0 38.0 38.0 37.0 38.0 25-29 37.1802 38.0 38.0 38.0 36.8 38.0 30-34 37.35925 38.0 38.0 38.0 37.0 38.0 35-39 37.32725 38.0 38.0 38.0 37.0 38.0 40-44 37.27875 38.0 38.0 38.0 37.0 38.0 45-49 36.165 38.0 37.0 38.0 30.4 38.0 50-54 37.179950000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.08975 38.0 38.0 38.0 36.2 38.0 60-64 37.090199999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.06465 38.0 38.0 38.0 36.0 38.0 70-74 37.0149 38.0 38.0 38.0 36.0 38.0 75-79 36.9625 38.0 38.0 38.0 36.0 38.0 80-84 36.76505 38.0 38.0 38.0 35.6 38.0 85-89 36.68755 38.0 38.0 38.0 35.6 38.0 90-94 36.5175 38.0 38.0 38.0 34.8 38.0 95-99 36.4927 38.0 38.0 38.0 34.6 38.0 100-104 36.3191 38.0 38.0 38.0 34.0 38.0 105-109 35.82899999999999 38.0 37.4 38.0 31.8 38.0 110-114 34.60144999999999 38.0 35.4 38.0 24.6 38.0 115-119 35.6862 38.0 36.8 38.0 31.6 38.0 120-124 35.5986 38.0 36.6 38.0 31.6 38.0 125-129 35.30385 38.0 36.0 38.0 31.0 38.0 130-134 35.0466 38.0 35.8 38.0 30.0 38.0 135-139 34.3518 38.0 34.0 38.0 26.0 38.0 140-144 33.5736 38.0 33.0 38.0 21.8 38.0 145-149 32.3467 38.0 33.0 38.0 12.4 38.0 150-151 27.191875000000003 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 3.0 13 1.0 14 2.0 15 2.0 16 1.0 17 4.0 18 5.0 19 5.0 20 15.0 21 3.0 22 4.0 23 9.0 24 6.0 25 15.0 26 16.0 27 21.0 28 15.0 29 31.0 30 46.0 31 49.0 32 83.0 33 130.0 34 212.0 35 333.0 36 787.0 37 2193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.174999999999997 25.0 6.875000000000001 41.949999999999996 2 20.7 22.05 45.475 11.774999999999999 3 14.549999999999999 27.450000000000003 36.875 21.125 4 20.025000000000002 36.05 25.474999999999998 18.45 5 23.674999999999997 39.45 20.9 15.975 6 18.2 39.85 24.325 17.625 7 18.875 21.099999999999998 41.099999999999994 18.925 8 18.2 24.725 31.424999999999997 25.650000000000002 9 19.85 24.05 32.25 23.849999999999998 10-14 22.985 28.384999999999998 26.950000000000003 21.68 15-19 22.145 28.03 28.83 20.995 20-24 23.085 27.97 28.384999999999998 20.560000000000002 25-29 22.43 28.665000000000003 28.015 20.89 30-34 22.715 27.87 28.689999999999998 20.724999999999998 35-39 22.23 27.99 28.82 20.96 40-44 22.805 28.395 28.144999999999996 20.655 45-49 22.425 28.449999999999996 28.51 20.615 50-54 22.915 27.875 28.384999999999998 20.825 55-59 22.96 27.560000000000002 28.299999999999997 21.18 60-64 22.8 27.779999999999998 28.134999999999998 21.285 65-69 22.91 27.575 28.265 21.25 70-74 23.03 28.46 27.785 20.724999999999998 75-79 22.994999999999997 28.765 27.705000000000002 20.535 80-84 23.544999999999998 28.599999999999998 27.134999999999998 20.72 85-89 23.455000000000002 27.855 27.994999999999997 20.695 90-94 23.805 28.105000000000004 27.79 20.3 95-99 23.65 28.345 27.22 20.785 100-104 23.91 28.255000000000003 27.42 20.415 105-109 24.18 28.265 27.825 19.73 110-114 24.295 28.925 27.744999999999997 19.035 115-119 24.675 29.315 26.805 19.205 120-124 25.165 28.77 27.229999999999997 18.834999999999997 125-129 25.35 28.765 27.665 18.22 130-134 25.525 28.33 27.21 18.935 135-139 26.41 28.470000000000002 26.52 18.6 140-144 26.095000000000002 28.165000000000003 27.169999999999998 18.57 145-149 26.8 28.694999999999997 26.419999999999998 18.085 150-151 26.887499999999996 29.425 26.174999999999997 17.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 3.5 25 5.0 26 8.0 27 10.0 28 11.0 29 13.0 30 17.5 31 25.5 32 40.0 33 51.0 34 56.0 35 76.0 36 97.0 37 116.5 38 128.0 39 152.5 40 193.5 41 221.0 42 269.5 43 294.0 44 290.5 45 278.0 46 270.5 47 245.5 48 213.0 49 189.5 50 148.5 51 121.5 52 97.5 53 85.5 54 76.0 55 59.5 56 40.5 57 24.0 58 17.5 59 15.5 60 11.5 61 5.5 62 4.5 63 3.0 64 0.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9010989010989 96.75 2 0.7922310247891643 1.55 3 0.1277791975466394 0.375 4 0.025555839509327882 0.1 5 0.025555839509327882 0.125 6 0.051111679018655765 0.3 7 0.025555839509327882 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.051111679018655765 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATC 14 0.35000000000000003 Illumina Single End PCR Primer 1 (97% over 35bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.375 0.0 0.0 0.0 0.0 2 0.375 0.0 0.0 0.0 0.0 3 0.375 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.375 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.375 0.0 0.0 0.0 0.0 8 0.375 0.0 0.0 0.0 0.0 9 0.375 0.0 0.0 0.0 0.0 10-11 0.375 0.0 0.0 0.0 0.0 12-13 0.375 0.0 0.0 0.0 0.0 14-15 0.375 0.0 0.0 0.0 0.0 16-17 0.375 0.0 0.0 0.0 0.0 18-19 0.375 0.0 0.0 0.0 0.0 20-21 0.375 0.0 0.0 0.0 0.0 22-23 0.375 0.0 0.0 0.0 0.0 24-25 0.375 0.0 0.0 0.0 0.0 26-27 0.375 0.0 0.0 0.0 0.0 28-29 0.375 0.0 0.0 0.0 0.0 30-31 0.375 0.0 0.0 0.0 0.0 32-33 0.375 0.0 0.0 0.0 0.0 34-35 0.375 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.375 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.3875 0.0 0.0 0.0 0.0 48-49 0.4 0.0 0.0 0.0 0.0 50-51 0.4125 0.0 0.0 0.0 0.0 52-53 0.425 0.0 0.0 0.0 0.0 54-55 0.425 0.0 0.0 0.0 0.0 56-57 0.425 0.0 0.0 0.0 0.0 58-59 0.425 0.0 0.0 0.0 0.0 60-61 0.4375 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.475 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.5 0.0 0.0 0.0 0.0 72-73 0.525 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.7625 0.0 0.0 0.0 0.0 80-81 0.8375 0.0 0.0 0.0 0.0 82-83 1.025 0.0 0.0 0.0 0.0 84-85 1.15 0.0 0.0 0.0 0.0 86-87 1.275 0.0 0.0 0.0 0.0 88-89 1.375 0.0 0.0 0.0 0.0 90-91 1.5750000000000002 0.0 0.0 0.0 0.0 92-93 1.8875000000000002 0.0 0.0 0.0 0.0 94-95 2.1125 0.0 0.0 0.0 0.0 96-97 2.4625000000000004 0.0 0.0 0.0 0.0 98-99 2.75 0.0 0.0 0.0 0.0 100-101 3.2125 0.0 0.0 0.0 0.0 102-103 3.5999999999999996 0.0 0.0 0.0 0.0 104-105 3.925 0.0 0.0 0.0 0.0 106-107 4.199999999999999 0.0 0.0 0.0 0.0 108-109 4.575 0.0 0.0 0.0 0.0 110-111 4.949999999999999 0.0 0.0 0.0 0.0 112-113 5.325 0.0 0.0 0.0 0.0 114-115 5.762499999999999 0.0 0.0 0.0 0.0 116-117 6.3125 0.0 0.0 0.0 0.0 118-119 6.7125 0.0 0.0 0.0 0.0 120-121 7.1875 0.0 0.0 0.0 0.0 122-123 7.637499999999999 0.0 0.0 0.0 0.0 124-125 8.25 0.0 0.0 0.0 0.0 126-127 9.037500000000001 0.0 0.0 0.0 0.0 128-129 9.65 0.0 0.0 0.0 0.0 130-131 10.25 0.0 0.0 0.0 0.0 132-133 10.725 0.0 0.0 0.0 0.0 134-135 11.287500000000001 0.0 0.0 0.0 0.0 136-137 11.95 0.0 0.0 0.0 0.0 138-139 12.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTAT 10 0.006830828 145.0 1 CTTTGTC 10 0.006830828 145.0 2 TTTGTCA 10 0.006830828 145.0 3 AGTTAAG 10 0.006830828 145.0 5 >>END_MODULE Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra Read 448768 spots for SRR7171093.sra Written 448768 spots for SRR7171093.sra SRR ids: ['SRR7171093.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jsz6b915 SRR7171093.sra spots: 8975360 blocks: [[1, 448768], [448769, 897536], [897537, 1346304], [1346305, 1795072], [1795073, 2243840], [2243841, 2692608], [2692609, 3141376], [3141377, 3590144], [3590145, 4038912], [4038913, 4487680], [4487681, 4936448], [4936449, 5385216], [5385217, 5833984], [5833985, 6282752], [6282753, 6731520], [6731521, 7180288], [7180289, 7629056], [7629057, 8077824], [8077825, 8526592], [8526593, 8975360]] SRR7171093 file size 3021755 SRR7171093 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171093 SRR7171093_1.fastq SRR7171093_2.fastq Input file: SRR7171093_1.fastq Paired file: SRR7171093_2.fastq trimmed: SRR7171093-trimmed-pair1.fastq, SRR7171093-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:53:28 2025 >> started Fri Feb 14 03:53:38 2025 >> done (10.093s) 8975360 read pairs processed; of these: 6588 ( 0.07%) short read pairs filtered out after trimming by size control 57793 ( 0.64%) empty read pairs filtered out after trimming by size control 8910979 (99.28%) read pairs available; of these: 5411745 (60.73%) trimmed read pairs available after processing 3499234 (39.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 25 0.00% 20 10 0.00% 21 15 0.00% 22 15 0.00% 23 27 0.00% 24 19 0.00% 25 12 0.00% 26 26 0.00% 27 32 0.00% 28 23 0.00% 29 18 0.00% 30 26 0.00% 31 51 0.00% 32 25 0.00% 33 19 0.00% 34 30 0.00% 35 29 0.00% 36 29 0.00% 37 45 0.00% 38 53 0.00% 39 70 0.00% 40 71 0.00% 41 71 0.00% 42 91 0.00% 43 94 0.00% 44 89 0.00% 45 93 0.00% 46 90 0.00% 47 166 0.00% 48 176 0.00% 49 153 0.00% 50 176 0.00% 51 218 0.00% 52 218 0.00% 53 251 0.00% 54 284 0.00% 55 277 0.00% 56 328 0.00% 57 381 0.00% 58 392 0.00% 59 452 0.01% 60 538 0.01% 61 612 0.01% 62 661 0.01% 63 743 0.01% 64 838 0.01% 65 885 0.01% 66 934 0.01% 67 1039 0.01% 68 1131 0.01% 69 1312 0.01% 70 1472 0.02% 71 1661 0.02% 72 1860 0.02% 73 2154 0.02% 74 2312 0.03% 75 2414 0.03% 76 2885 0.03% 77 3123 0.04% 78 3235 0.04% 79 3470 0.04% 80 3954 0.04% 81 4322 0.05% 82 4927 0.06% 83 5525 0.06% 84 6494 0.07% 85 7174 0.08% 86 7667 0.09% 87 8154 0.09% 88 8566 0.10% 89 8806 0.10% 90 9714 0.11% 91 10322 0.12% 92 11186 0.13% 93 12351 0.14% 94 12717 0.14% 95 13922 0.16% 96 14219 0.16% 97 14885 0.17% 98 15591 0.17% 99 15732 0.18% 100 16988 0.19% 101 17328 0.19% 102 18733 0.21% 103 19295 0.22% 104 20584 0.23% 105 22016 0.25% 106 21860 0.25% 107 22183 0.25% 108 22976 0.26% 109 23774 0.27% 110 24501 0.27% 111 25114 0.28% 112 25949 0.29% 113 27123 0.30% 114 28112 0.32% 115 29504 0.33% 116 30808 0.35% 117 30639 0.34% 118 31318 0.35% 119 31201 0.35% 120 32301 0.36% 121 32310 0.36% 122 34262 0.38% 123 34676 0.39% 124 35648 0.40% 125 36449 0.41% 126 37267 0.42% 127 38024 0.43% 128 38142 0.43% 129 38930 0.44% 130 39822 0.45% 131 40779 0.46% 132 42326 0.47% 133 43978 0.49% 134 47029 0.53% 135 48564 0.54% 136 50624 0.57% 137 53740 0.60% 138 56330 0.63% 139 59796 0.67% 140 63460 0.71% 141 70011 0.79% 142 77148 0.87% 143 85790 0.96% 144 101462 1.14% 145 119134 1.34% 146 149128 1.67% 147 198429 2.23% 148 299387 3.36% 149 554889 6.23% 150 2127719 23.88% 151 3499234 39.27% 8910979 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.1 sequence=TACGCTTGTAAGGATTACAAGGTTTTTTCTTAGGACAATCTCGTTGGTAAATGCTACATCCACTGCCAGTTCGTGGGGCATAGGTAGGAGGCTGGCTTCTAGATGATACATCGCCAGTTGATGGGATATTGACGGTAACGCTATCTTTTCCATAGTCGACCAATTCTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=210.42 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.2 sequence=AAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=0.63 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=47.37 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.5 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGC SRR7171093 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:54:24 Started mapping on | Feb 14 03:54:24 Finished on | Feb 14 03:55:28 Mapping speed, Million of reads per hour | 501.24 Number of input reads | 8910979 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 8401455 Uniquely mapped reads % | 94.28% Average mapped length | 287.57 Number of splices: Total | 7843770 Number of splices: Annotated (sjdb) | 7655745 Number of splices: GT/AG | 7695115 Number of splices: GC/AG | 113719 Number of splices: AT/AC | 5652 Number of splices: Non-canonical | 29284 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236592 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 12323 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 280389 280389 280389 N_multimapping 236592 236592 236592 N_noFeature 345534 8204189 406018 N_ambiguous 191965 551 55010 UnstrandedReadsAssigned:7863956 PositiveStrandReadsAssigned:196715 NegativeStrandReadsAssigned:7940427 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7171093 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171093-trimmed-pair1.fastq SRR7171093-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,910,979 reads, 7,915,267 reads pseudoaligned [quant] estimated average fragment length: 220.767 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7171093.ke.tsv 34699 SRR7171093.se.tsv 87100 total ==> SRR7171093.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.23 381 19.1766 Potri.005G024800.1.v4.1 1035 815.233 143 15.8762 Potri.004G059700.1.v4.1 961 741.251 15 1.83155 Potri.007G009000.2.v4.1 1416 1196.23 0 0 Potri.003G141000.2.v4.1 2943 2723.23 481 15.9865 Potri.016G087400.1.v4.1 270 95.1868 719 683.668 Potri.015G069301.1.v4.1 564 349.254 0 0 Potri.010G195200.1.v4.1 1773 1553.23 56 3.26321 Potri.012G127500.1.v4.1 977 757.242 243 29.0445 ==> SRR7171093.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR7171093 completed mapping pipeline successfully