Starting /dee2/code/volunteer_pipeline.sh SRR7171094 current disk space = 3088225947648 free memory = 1574632244 SRR7171094 SRAfilesize 5fa9a91583a89f12409bbb64d070d205 SRR7171094.sra SRR7171094.sra file validated SRR7171094 is paired end SRR7171094 is conventional basespace SRR7171094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.09475 18.0 18.0 18.0 18.0 32.0 2 27.6465 27.0 27.0 30.0 25.0 31.0 3 29.489 30.0 29.0 31.0 25.0 33.0 4 31.25925 33.0 31.0 33.0 29.0 33.0 5 31.834 33.0 31.0 33.0 29.0 33.0 6 35.14025 37.0 35.0 38.0 29.0 38.0 7 36.54075 38.0 37.0 38.0 34.0 38.0 8 37.1965 38.0 38.0 38.0 36.0 38.0 9 37.453 38.0 38.0 38.0 37.0 38.0 10-14 37.47085 38.0 38.0 38.0 37.2 38.0 15-19 37.499399999999994 38.0 38.0 38.0 37.6 38.0 20-24 37.54625 38.0 38.0 38.0 38.0 38.0 25-29 37.5464 38.0 38.0 38.0 38.0 38.0 30-34 37.47859999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.464999999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.408699999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.39475 38.0 38.0 38.0 37.0 38.0 50-54 37.2906 38.0 38.0 38.0 37.0 38.0 55-59 37.115 38.0 38.0 38.0 36.4 38.0 60-64 37.1057 38.0 38.0 38.0 36.2 38.0 65-69 36.06205 38.0 37.2 38.0 31.6 38.0 70-74 36.35844999999999 38.0 37.4 38.0 31.2 38.0 75-79 36.8903 38.0 38.0 38.0 35.8 38.0 80-84 36.8405 38.0 38.0 38.0 35.8 38.0 85-89 36.6631 38.0 38.0 38.0 35.0 38.0 90-94 36.5617 38.0 38.0 38.0 34.6 38.0 95-99 36.5138 38.0 38.0 38.0 34.6 38.0 100-104 36.410900000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.30329999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.1623 38.0 37.8 38.0 33.8 38.0 115-119 35.932050000000004 38.0 37.0 38.0 33.0 38.0 120-124 35.834050000000005 38.0 37.0 38.0 32.0 38.0 125-129 35.311 38.0 36.0 38.0 30.4 38.0 130-134 34.80105 38.0 35.4 38.0 28.2 38.0 135-139 34.56735 38.0 35.2 38.0 27.6 38.0 140-144 33.8833 38.0 33.4 38.0 24.0 38.0 145-149 33.035849999999996 38.0 33.0 38.0 16.4 38.0 150-151 27.654874999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 0.0 15 3.0 16 3.0 17 2.0 18 11.0 19 8.0 20 2.0 21 7.0 22 5.0 23 1.0 24 9.0 25 12.0 26 19.0 27 24.0 28 22.0 29 26.0 30 41.0 31 48.0 32 84.0 33 106.0 34 170.0 35 358.0 36 1012.0 37 2018.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.47191011235955 30.413687436159346 10.955056179775282 36.15934627170582 2 19.929982495623904 17.65441360340085 36.18404601150287 26.231557889472366 3 17.325 25.074999999999996 28.65 28.95 4 20.7 31.324999999999996 24.2 23.775 5 21.4 35.275 24.125 19.2 6 15.425 38.375 26.424999999999997 19.775000000000002 7 13.725000000000001 24.125 44.224999999999994 17.925 8 15.45 25.575 31.674999999999997 27.3 9 15.8 25.7 33.375 25.124999999999996 10-14 18.655 31.4 26.72 23.225 15-19 19.275000000000002 30.25 26.955000000000002 23.52 20-24 18.985 30.0 27.665 23.35 25-29 19.17 30.15 27.425 23.255 30-34 19.03 30.645 26.955000000000002 23.369999999999997 35-39 19.275000000000002 29.86 27.36 23.505000000000003 40-44 19.725 29.67 26.935 23.669999999999998 45-49 20.0 29.415000000000003 26.72 23.865 50-54 19.63 29.81 26.924999999999997 23.635 55-59 19.439999999999998 29.23 27.665 23.665 60-64 19.314999999999998 28.910000000000004 27.595 24.18 65-69 19.33 29.53 27.32 23.82 70-74 19.06 29.57 27.265 24.104999999999997 75-79 19.685 29.34 27.229999999999997 23.745 80-84 19.725 29.049999999999997 27.305 23.919999999999998 85-89 20.125 29.565 26.540000000000003 23.77 90-94 19.57 28.854999999999997 27.339999999999996 24.235 95-99 20.00700070007001 28.77287728772877 27.04770477047705 24.172417241724172 100-104 20.015 29.185 26.56 24.240000000000002 105-109 20.355 28.955 26.634999999999998 24.055 110-114 20.599999999999998 28.37 27.200000000000003 23.830000000000002 115-119 20.66 28.794999999999998 26.745 23.799999999999997 120-124 20.59 29.020000000000003 26.05 24.34 125-129 20.195 28.215 27.250000000000004 24.34 130-134 20.285 28.485 26.85 24.38 135-139 20.52 28.705000000000002 26.205000000000002 24.57 140-144 21.13 27.98 25.94 24.95 145-149 20.72 28.48 25.83 24.97 150-151 21.200750469043154 28.242651657285805 26.40400250156348 24.152595372107566 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.5 23 4.0 24 4.5 25 7.5 26 10.0 27 13.5 28 24.5 29 33.0 30 34.0 31 45.0 32 69.0 33 82.0 34 99.5 35 124.0 36 127.5 37 129.5 38 153.5 39 176.0 40 187.0 41 182.0 42 185.5 43 209.0 44 216.5 45 209.5 46 217.5 47 220.0 48 199.5 49 172.5 50 155.0 51 132.5 52 106.5 53 99.5 54 84.0 55 69.5 56 55.0 57 36.5 58 28.0 59 22.5 60 17.0 61 16.0 62 12.0 63 5.5 64 1.5 65 1.0 66 2.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80771182141045 97.375 2 0.989345509893455 1.95 3 0.15220700152207 0.44999999999999996 4 0.025367833587011668 0.1 5 0.025367833587011668 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.4875 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.7374999999999998 0.0 0.0 0.0 0.0 102-103 2.1 0.0 0.0 0.0 0.0 104-105 2.45 0.0 0.0 0.0 0.0 106-107 2.9125 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 3.9625000000000004 0.0 0.0 0.0 0.0 112-113 4.35 0.0 0.0 0.0 0.0 114-115 4.9 0.0 0.0 0.0 0.0 116-117 5.637499999999999 0.0 0.0 0.0 0.0 118-119 6.2375 0.0 0.0 0.0 0.0 120-121 6.625 0.0 0.0 0.0 0.0 122-123 7.025 0.0 0.0 0.0 0.0 124-125 7.575 0.0 0.0 0.0 0.0 126-127 8.025 0.0 0.0 0.0 0.0 128-129 8.425 0.0 0.0 0.0 0.0 130-131 9.1875 0.0 0.0 0.0 0.0 132-133 9.8875 0.0 0.0 0.0 0.0 134-135 10.55 0.0 0.0 0.0 0.0 136-137 11.425 0.0 0.0 0.0 0.0 138-139 12.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46475 33.0 32.0 34.0 25.0 34.0 2 32.4835 33.0 33.0 34.0 31.0 34.0 3 32.71475 33.0 33.0 34.0 32.0 34.0 4 32.8045 33.0 33.0 34.0 32.0 34.0 5 32.903 34.0 33.0 34.0 32.0 34.0 6 37.13825 38.0 38.0 38.0 37.0 38.0 7 37.1695 38.0 38.0 38.0 37.0 38.0 8 37.1485 38.0 38.0 38.0 37.0 38.0 9 37.1525 38.0 38.0 38.0 37.0 38.0 10-14 36.8995 38.0 38.0 38.0 36.2 38.0 15-19 36.957300000000004 38.0 38.0 38.0 36.6 38.0 20-24 35.3629 38.0 35.2 38.0 27.0 38.0 25-29 36.86965 38.0 37.8 38.0 36.2 38.0 30-34 37.01005 38.0 38.0 38.0 36.8 38.0 35-39 36.964099999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.9261 38.0 38.0 38.0 36.8 38.0 45-49 36.73395 38.0 38.0 38.0 35.8 38.0 50-54 36.21545 38.0 37.6 38.0 33.2 38.0 55-59 36.7652 38.0 38.0 38.0 36.0 38.0 60-64 36.779399999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.5758 38.0 38.0 38.0 35.0 38.0 70-74 36.59265 38.0 38.0 38.0 35.2 38.0 75-79 36.49245 38.0 38.0 38.0 35.0 38.0 80-84 35.62485 38.0 37.0 38.0 29.2 38.0 85-89 36.29875 38.0 38.0 38.0 34.2 38.0 90-94 36.2713 38.0 38.0 38.0 34.2 38.0 95-99 36.1666 38.0 38.0 38.0 34.0 38.0 100-104 35.91465 38.0 37.6 38.0 33.2 38.0 105-109 35.1178 38.0 36.4 38.0 27.0 38.0 110-114 35.348749999999995 38.0 36.8 38.0 30.6 38.0 115-119 35.20885 38.0 36.8 38.0 30.6 38.0 120-124 34.9797 38.0 36.0 38.0 28.8 38.0 125-129 34.7946 38.0 35.8 38.0 28.6 38.0 130-134 33.81564999999999 38.0 34.0 38.0 22.8 38.0 135-139 33.32955 38.0 33.0 38.0 19.6 38.0 140-144 32.432900000000004 38.0 33.0 38.0 14.0 38.0 145-149 31.42335 38.0 32.4 38.0 8.0 38.0 150-151 25.060125 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 11.0 4 2.0 5 1.0 6 2.0 7 0.0 8 3.0 9 0.0 10 1.0 11 2.0 12 1.0 13 2.0 14 4.0 15 4.0 16 3.0 17 4.0 18 8.0 19 8.0 20 4.0 21 10.0 22 7.0 23 21.0 24 7.0 25 14.0 26 26.0 27 22.0 28 38.0 29 47.0 30 51.0 31 54.0 32 93.0 33 112.0 34 220.0 35 359.0 36 897.0 37 1945.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.3 18.25 14.2 26.25 2 27.925 23.125 31.25 17.7 3 22.0 26.525 32.300000000000004 19.175 4 24.9 33.875 22.6 18.625 5 26.650000000000002 35.575 21.25 16.525000000000002 6 21.525 36.575 23.275000000000002 18.625 7 19.975 20.0 39.725 20.3 8 22.6 24.5 27.250000000000004 25.650000000000002 9 23.25 25.474999999999998 28.725 22.55 10-14 25.03 28.244999999999997 25.629999999999995 21.095 15-19 24.085 27.800000000000004 27.529999999999998 20.585 20-24 24.685000000000002 27.88 26.715 20.72 25-29 24.279999999999998 28.384999999999998 27.205000000000002 20.13 30-34 23.755000000000003 28.494999999999997 27.405 20.345 35-39 24.43 27.04 27.965 20.565 40-44 24.175 27.950000000000003 27.57 20.305 45-49 23.54 28.215 27.474999999999998 20.77 50-54 23.794999999999998 27.57 28.205000000000002 20.43 55-59 24.595 27.589999999999996 27.405 20.41 60-64 23.765 27.37 28.015 20.849999999999998 65-69 23.87 27.715 28.194999999999997 20.22 70-74 23.945 27.560000000000002 27.900000000000002 20.595 75-79 23.799999999999997 27.425 28.02 20.755000000000003 80-84 23.494999999999997 27.625 28.634999999999998 20.244999999999997 85-89 23.799999999999997 27.560000000000002 28.015 20.625 90-94 23.56 27.73 28.1 20.61 95-99 24.044999999999998 27.565 28.53 19.86 100-104 23.775 27.52 28.655 20.05 105-109 24.42 27.889999999999997 27.805000000000003 19.885 110-114 24.666233311665582 27.616380819040952 28.25641282064103 19.460973048652434 115-119 25.195 27.505000000000003 27.755000000000003 19.545 120-124 25.395 27.889999999999997 27.279999999999998 19.435 125-129 25.77 27.560000000000002 27.435 19.235 130-134 25.775 27.500000000000004 27.87 18.855 135-139 25.490000000000002 27.055 27.744999999999997 19.71 140-144 26.029999999999998 27.57 26.91 19.49 145-149 25.955000000000002 27.18 27.465 19.400000000000002 150-151 26.184819307240215 26.53495060647743 28.073027385269476 19.20720270101288 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 1.0 22 3.0 23 3.5 24 2.0 25 3.5 26 5.0 27 7.0 28 11.5 29 11.5 30 10.5 31 24.0 32 37.0 33 43.5 34 54.0 35 58.5 36 66.0 37 99.5 38 134.0 39 145.5 40 160.0 41 191.5 42 233.5 43 256.0 44 258.5 45 249.5 46 235.0 47 239.5 48 235.0 49 219.0 50 191.5 51 147.0 52 117.5 53 109.5 54 102.0 55 84.0 56 67.0 57 49.5 58 39.5 59 31.0 60 17.5 61 13.0 62 9.5 63 4.0 64 3.0 65 3.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96070975918884 97.6 2 0.861850443599493 1.7000000000000002 3 0.10139416983523447 0.3 4 0.025348542458808618 0.1 5 0.025348542458808618 0.125 6 0.0 0.0 7 0.025348542458808618 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) GTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.7124999999999999 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 0.9125000000000001 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.4500000000000002 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.35 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.4125 0.0 0.0 0.0 0.0 110-111 3.9125 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.487500000000001 0.0 0.0 0.0 0.0 118-119 6.1125 0.0 0.0 0.0 0.0 120-121 6.5125 0.0 0.0 0.0 0.0 122-123 6.925 0.0 0.0 0.0 0.0 124-125 7.4375 0.0 0.0 0.0 0.0 126-127 7.9 0.0 0.0 0.0 0.0 128-129 8.337499999999999 0.0 0.0 0.0 0.0 130-131 9.05 0.0 0.0 0.0 0.0 132-133 9.75 0.0 0.0 0.0 0.0 134-135 10.425 0.0 0.0 0.0 0.0 136-137 11.3 0.0 0.0 0.0 0.0 138-139 12.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATTC 10 0.006830828 145.0 3 >>END_MODULE Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730387 spots for SRR7171094.sra Written 730387 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra Read 730375 spots for SRR7171094.sra Written 730375 spots for SRR7171094.sra SRR ids: ['SRR7171094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ydqt32lj SRR7171094.sra spots: 14607512 blocks: [[1, 730375], [730376, 1460750], [1460751, 2191125], [2191126, 2921500], [2921501, 3651875], [3651876, 4382250], [4382251, 5112625], [5112626, 5843000], [5843001, 6573375], [6573376, 7303750], [7303751, 8034125], [8034126, 8764500], [8764501, 9494875], [9494876, 10225250], [10225251, 10955625], [10955626, 11686000], [11686001, 12416375], [12416376, 13146750], [13146751, 13877125], [13877126, 14607512]] SRR7171094 file size 4928306 SRR7171094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171094 SRR7171094_1.fastq SRR7171094_2.fastq Input file: SRR7171094_1.fastq Paired file: SRR7171094_2.fastq trimmed: SRR7171094-trimmed-pair1.fastq, SRR7171094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:33:37 2025 >> started Fri Feb 14 03:33:53 2025 >> done (16.390s) 14607512 read pairs processed; of these: 18295 ( 0.13%) short read pairs filtered out after trimming by size control 64232 ( 0.44%) empty read pairs filtered out after trimming by size control 14524985 (99.44%) read pairs available; of these: 9415789 (64.82%) trimmed read pairs available after processing 5109196 (35.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 7 0.00% 21 7 0.00% 22 11 0.00% 23 13 0.00% 24 17 0.00% 25 4 0.00% 26 6 0.00% 27 15 0.00% 28 15 0.00% 29 18 0.00% 30 10 0.00% 31 20 0.00% 32 18 0.00% 33 17 0.00% 34 23 0.00% 35 18 0.00% 36 30 0.00% 37 30 0.00% 38 27 0.00% 39 35 0.00% 40 48 0.00% 41 68 0.00% 42 50 0.00% 43 59 0.00% 44 74 0.00% 45 97 0.00% 46 92 0.00% 47 117 0.00% 48 107 0.00% 49 194 0.00% 50 208 0.00% 51 195 0.00% 52 218 0.00% 53 241 0.00% 54 243 0.00% 55 258 0.00% 56 298 0.00% 57 326 0.00% 58 374 0.00% 59 450 0.00% 60 530 0.00% 61 589 0.00% 62 678 0.00% 63 768 0.01% 64 867 0.01% 65 945 0.01% 66 955 0.01% 67 1054 0.01% 68 1209 0.01% 69 1264 0.01% 70 1627 0.01% 71 1838 0.01% 72 2238 0.02% 73 2533 0.02% 74 3055 0.02% 75 4477 0.03% 76 9280 0.06% 77 6669 0.05% 78 4414 0.03% 79 4367 0.03% 80 4744 0.03% 81 5384 0.04% 82 6457 0.04% 83 7081 0.05% 84 8927 0.06% 85 9732 0.07% 86 10420 0.07% 87 11134 0.08% 88 12150 0.08% 89 12493 0.09% 90 13750 0.09% 91 14722 0.10% 92 15835 0.11% 93 17721 0.12% 94 18795 0.13% 95 20254 0.14% 96 20652 0.14% 97 21523 0.15% 98 22108 0.15% 99 23370 0.16% 100 25097 0.17% 101 25316 0.17% 102 27550 0.19% 103 29283 0.20% 104 31142 0.21% 105 33402 0.23% 106 34072 0.23% 107 34631 0.24% 108 36117 0.25% 109 37499 0.26% 110 37735 0.26% 111 38625 0.27% 112 40351 0.28% 113 43427 0.30% 114 44563 0.31% 115 47415 0.33% 116 48583 0.33% 117 48636 0.33% 118 49495 0.34% 119 50352 0.35% 120 51241 0.35% 121 53231 0.37% 122 54909 0.38% 123 57291 0.39% 124 59658 0.41% 125 61302 0.42% 126 64094 0.44% 127 65371 0.45% 128 66710 0.46% 129 68554 0.47% 130 70790 0.49% 131 72775 0.50% 132 75241 0.52% 133 80015 0.55% 134 84738 0.58% 135 88752 0.61% 136 92913 0.64% 137 99630 0.69% 138 104564 0.72% 139 110400 0.76% 140 116165 0.80% 141 124924 0.86% 142 134652 0.93% 143 148851 1.02% 144 169690 1.17% 145 201432 1.39% 146 241859 1.67% 147 324374 2.23% 148 497603 3.43% 149 988681 6.81% 150 3891411 26.79% 151 5109196 35.18% 14524985 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=15.47 fanout-score-rank=6 prefix-density=0.54 prefix-fanout=7.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=35.92 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.4 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=34 prefix-density=0.43 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=45.65 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.4 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCC SRR7171094 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:34:34 Started mapping on | Feb 14 03:34:34 Finished on | Feb 14 03:36:35 Mapping speed, Million of reads per hour | 432.15 Number of input reads | 14524985 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 13191745 Uniquely mapped reads % | 90.82% Average mapped length | 288.31 Number of splices: Total | 10426033 Number of splices: Annotated (sjdb) | 10200043 Number of splices: GT/AG | 10222985 Number of splices: GC/AG | 159611 Number of splices: AT/AC | 11003 Number of splices: Non-canonical | 32434 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402496 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 105979 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.44% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 951086 951086 951086 N_multimapping 402496 402496 402496 N_noFeature 419557 12930575 485910 N_ambiguous 311898 825 116751 UnstrandedReadsAssigned:12460290 PositiveStrandReadsAssigned:260345 NegativeStrandReadsAssigned:12589084 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171094-trimmed-pair1.fastq SRR7171094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,524,985 reads, 12,717,461 reads pseudoaligned [quant] estimated average fragment length: 213.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7171094.ke.tsv 34699 SRR7171094.se.tsv 87100 total ==> SRR7171094.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.4 236 7.55116 Potri.005G024800.1.v4.1 1035 822.405 515 36.1741 Potri.004G059700.1.v4.1 961 748.409 25 1.92964 Potri.007G009000.2.v4.1 1416 1203.4 0 0 Potri.003G141000.2.v4.1 2943 2730.4 239 5.05646 Potri.016G087400.1.v4.1 270 92.3445 1009.81 631.689 Potri.015G069301.1.v4.1 564 353.604 0 0 Potri.010G195200.1.v4.1 1773 1560.4 8 0.296162 Potri.012G127500.1.v4.1 977 764.405 452 34.1579 ==> SRR7171094.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 505 Potri.001G212900.v4.1 397 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 28 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7171094 completed mapping pipeline successfully