Starting /dee2/code/volunteer_pipeline.sh SRR7171095 current disk space = 3087716618240 free memory = 1579974792 SRR7171095 SRAfilesize 077dbace40be65b89061dd85756c120a SRR7171095.sra SRR7171095.sra file validated SRR7171095 is paired end SRR7171095 is conventional basespace SRR7171095 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171095_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.25775 32.0 30.0 33.0 18.0 34.0 2 31.07625 33.0 31.0 33.0 27.0 34.0 3 32.2505 33.0 33.0 33.0 29.0 34.0 4 32.53825 33.0 33.0 34.0 31.0 34.0 5 32.82625 33.0 33.0 34.0 31.0 34.0 6 35.69375 38.0 37.0 38.0 29.0 38.0 7 37.02225 38.0 38.0 38.0 36.0 38.0 8 37.279 38.0 38.0 38.0 37.0 38.0 9 37.52075 38.0 38.0 38.0 37.0 38.0 10-14 37.583450000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.55415 38.0 38.0 38.0 38.0 38.0 20-24 37.595600000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.589800000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5296 38.0 38.0 38.0 38.0 38.0 35-39 37.527550000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.5082 38.0 38.0 38.0 38.0 38.0 45-49 37.47265 38.0 38.0 38.0 37.8 38.0 50-54 37.386199999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.31545 38.0 38.0 38.0 37.0 38.0 60-64 37.34505 38.0 38.0 38.0 37.0 38.0 65-69 36.4985 38.0 37.8 38.0 33.6 38.0 70-74 36.312200000000004 38.0 37.0 38.0 30.8 38.0 75-79 37.09855 38.0 38.0 38.0 36.0 38.0 80-84 37.096000000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.90665 38.0 38.0 38.0 36.0 38.0 90-94 36.84665 38.0 38.0 38.0 35.6 38.0 95-99 36.7766 38.0 38.0 38.0 35.0 38.0 100-104 36.7063 38.0 38.0 38.0 34.8 38.0 105-109 36.59695000000001 38.0 38.0 38.0 34.4 38.0 110-114 36.51945 38.0 38.0 38.0 34.4 38.0 115-119 36.283699999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.17945 38.0 37.6 38.0 33.8 38.0 125-129 35.66175 38.0 36.6 38.0 31.2 38.0 130-134 35.16335 38.0 36.0 38.0 29.8 38.0 135-139 34.98915 38.0 35.8 38.0 29.0 38.0 140-144 34.56545 38.0 35.4 38.0 27.6 38.0 145-149 33.68325 38.0 33.6 38.0 22.6 38.0 150-151 28.232875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 0.0 19 6.0 20 1.0 21 3.0 22 4.0 23 4.0 24 8.0 25 11.0 26 8.0 27 12.0 28 26.0 29 32.0 30 35.0 31 51.0 32 67.0 33 104.0 34 155.0 35 282.0 36 752.0 37 2431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.60420405024353 13.02230197385286 9.894898743911817 33.4785952319918 2 21.210605302651324 18.234117058529264 35.44272136068034 25.11255627813907 3 18.775 24.45 26.775 30.0 4 21.875 31.825 23.3 23.0 5 20.974999999999998 35.949999999999996 25.25 17.825 6 18.275 34.875 26.35 20.5 7 14.224999999999998 22.55 44.5 18.725 8 17.474999999999998 23.549999999999997 30.775000000000002 28.199999999999996 9 17.349999999999998 23.799999999999997 33.975 24.875 10-14 20.28 28.999999999999996 26.91 23.810000000000002 15-19 20.21 28.46 27.334999999999997 23.995 20-24 20.4 27.825 28.02 23.755000000000003 25-29 20.215 28.634999999999998 27.889999999999997 23.26 30-34 20.115 28.804999999999996 27.37 23.71 35-39 20.01 27.794999999999998 28.105000000000004 24.09 40-44 20.77 28.895 26.955000000000002 23.380000000000003 45-49 20.43 28.544999999999998 27.24 23.785 50-54 20.115 28.139999999999997 28.275 23.47 55-59 20.585 28.205000000000002 27.355 23.855 60-64 20.035 28.555000000000003 27.73 23.68 65-69 20.565 28.599999999999998 27.27 23.565 70-74 19.78 28.544999999999998 27.644999999999996 24.03 75-79 20.294999999999998 28.965000000000003 27.155 23.585 80-84 20.28 28.54 26.995 24.185000000000002 85-89 20.385 29.04 27.425 23.150000000000002 90-94 20.974999999999998 28.444999999999997 27.650000000000002 22.93 95-99 20.71207120712071 28.02280228022802 27.71777177717772 23.547354735473547 100-104 20.965 28.975 26.950000000000003 23.11 105-109 20.52 28.92 27.215 23.345 110-114 20.544999999999998 28.310000000000002 27.365000000000002 23.78 115-119 21.005 28.560000000000002 26.775 23.66 120-124 21.205 29.025000000000002 26.400000000000002 23.369999999999997 125-129 21.625 28.12 26.07 24.185000000000002 130-134 21.025 28.555000000000003 26.790000000000003 23.630000000000003 135-139 21.43 28.17 26.69 23.71 140-144 21.865000000000002 28.345 26.125 23.665 145-149 20.86 28.185 26.575 24.38 150-151 21.52152152152152 28.465965965965967 25.43793793793794 24.574574574574577 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 3.5 22 2.0 23 2.0 24 3.0 25 5.0 26 8.0 27 11.0 28 14.5 29 17.0 30 20.5 31 28.0 32 37.5 33 39.5 34 54.0 35 76.0 36 95.0 37 116.0 38 143.0 39 153.5 40 165.5 41 213.5 42 240.0 43 244.5 44 249.5 45 249.0 46 262.0 47 248.0 48 224.0 49 187.5 50 155.0 51 138.5 52 116.0 53 105.5 54 80.5 55 60.5 56 58.0 57 53.0 58 36.0 59 25.5 60 15.5 61 10.5 62 10.5 63 6.0 64 1.5 65 2.0 66 2.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5545752457776657 1.0999999999999999 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0125 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.037500000000000006 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.0875 0.0 0.0 0.025 0.0 74-75 0.1375 0.0 0.0 0.025 0.0 76-77 0.2 0.0 0.0 0.025 0.0 78-79 0.275 0.0 0.0 0.025 0.0 80-81 0.3125 0.0 0.0 0.025 0.0 82-83 0.35 0.0 0.0 0.025 0.0 84-85 0.425 0.0 0.0 0.025 0.0 86-87 0.5625 0.0 0.0 0.025 0.0 88-89 0.6625000000000001 0.0 0.0 0.025 0.0 90-91 0.7625 0.0 0.0 0.025 0.0 92-93 1.0 0.0 0.0 0.025 0.0 94-95 1.1875 0.0 0.0 0.025 0.0 96-97 1.3625 0.0 0.0 0.025 0.0 98-99 1.6 0.0 0.0 0.025 0.0 100-101 1.9375 0.0 0.0 0.025 0.0 102-103 2.3 0.0 0.0 0.025 0.0 104-105 2.6 0.0 0.0 0.025 0.0 106-107 2.8875 0.0 0.0 0.025 0.0 108-109 3.4375 0.0 0.0 0.025 0.0 110-111 3.8 0.0 0.0 0.025 0.0 112-113 4.2875 0.0 0.0 0.025 0.0 114-115 4.9375 0.0 0.0 0.025 0.0 116-117 5.5625 0.0 0.0 0.025 0.0 118-119 6.1 0.0 0.0 0.025 0.0 120-121 6.625 0.0 0.0 0.025 0.0 122-123 7.2 0.0 0.0 0.025 0.0 124-125 7.7125 0.0 0.0 0.025 0.0 126-127 8.425 0.0 0.0 0.025 0.0 128-129 9.325 0.0 0.0 0.025 0.0 130-131 9.975 0.0 0.0 0.025 0.0 132-133 10.625 0.0 0.0 0.025 0.0 134-135 11.45 0.0 0.0 0.025 0.0 136-137 12.1375 0.0 0.0 0.025 0.0 138-139 13.0625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAGC 10 0.006836113 144.9625 7 >>END_MODULE SRR7171095 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171095_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10075 33.0 33.0 34.0 30.0 34.0 2 32.7445 33.0 33.0 34.0 32.0 34.0 3 32.87 33.0 33.0 34.0 32.0 34.0 4 32.89225 33.0 33.0 34.0 32.0 34.0 5 32.88 34.0 33.0 34.0 32.0 34.0 6 37.118 38.0 38.0 38.0 37.0 38.0 7 37.23 38.0 38.0 38.0 37.0 38.0 8 37.17575 38.0 38.0 38.0 37.0 38.0 9 37.1595 38.0 38.0 38.0 37.0 38.0 10-14 36.93575 38.0 38.0 38.0 35.8 38.0 15-19 37.0355 38.0 38.0 38.0 36.4 38.0 20-24 35.1186 37.8 34.8 38.0 26.8 38.0 25-29 36.842200000000005 38.0 37.8 38.0 35.6 38.0 30-34 37.071299999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.042 38.0 38.0 38.0 36.6 38.0 40-44 36.98584999999999 38.0 38.0 38.0 36.8 38.0 45-49 36.91785 38.0 38.0 38.0 36.2 38.0 50-54 36.29015 38.0 37.6 38.0 33.2 38.0 55-59 36.792649999999995 38.0 38.0 38.0 35.8 38.0 60-64 36.7683 38.0 38.0 38.0 36.0 38.0 65-69 36.6908 38.0 38.0 38.0 35.2 38.0 70-74 36.7125 38.0 38.0 38.0 35.4 38.0 75-79 36.625699999999995 38.0 38.0 38.0 35.2 38.0 80-84 35.6851 38.0 36.8 38.0 29.4 38.0 85-89 36.3753 38.0 38.0 38.0 34.2 38.0 90-94 36.42325 38.0 38.0 38.0 34.6 38.0 95-99 36.31935 38.0 38.0 38.0 34.0 38.0 100-104 36.0488 38.0 37.6 38.0 33.4 38.0 105-109 35.18364999999999 38.0 36.4 38.0 27.0 38.0 110-114 35.5729 38.0 37.0 38.0 31.0 38.0 115-119 35.4949 38.0 37.0 38.0 31.0 38.0 120-124 35.271 38.0 36.2 38.0 31.0 38.0 125-129 34.9722 38.0 36.0 38.0 28.6 38.0 130-134 34.21945000000001 38.0 34.6 38.0 24.2 38.0 135-139 33.5398 38.0 33.2 38.0 20.6 38.0 140-144 32.6486 38.0 33.0 38.0 14.8 38.0 145-149 31.55175 38.0 31.8 38.0 8.0 38.0 150-151 25.23225 32.0 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 6.0 5 5.0 6 2.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 2.0 13 0.0 14 3.0 15 2.0 16 3.0 17 3.0 18 4.0 19 5.0 20 6.0 21 9.0 22 2.0 23 14.0 24 13.0 25 18.0 26 22.0 27 32.0 28 37.0 29 56.0 30 57.0 31 75.0 32 110.0 33 124.0 34 194.0 35 329.0 36 843.0 37 2008.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 17.424999999999997 12.975 26.674999999999997 2 26.05 24.75 32.9 16.3 3 21.0 26.825 31.775 20.4 4 25.2 34.575 21.8 18.425 5 24.65 37.275000000000006 21.475 16.6 6 19.650000000000002 38.925 22.45 18.975 7 20.375 18.525 40.6 20.5 8 21.525 23.849999999999998 28.875 25.75 9 22.55 24.375 29.225 23.849999999999998 10-14 23.485 28.08 26.445 21.990000000000002 15-19 22.975 28.265 28.07 20.69 20-24 22.915 27.655 28.63 20.8 25-29 23.055 27.900000000000002 28.355000000000004 20.69 30-34 22.945 27.825 28.43 20.8 35-39 22.555 28.349999999999998 27.985 21.11 40-44 23.125 28.17 28.189999999999998 20.515 45-49 22.994999999999997 27.985 28.134999999999998 20.885 50-54 23.18 27.325 28.804999999999996 20.69 55-59 23.135 27.73 27.715 21.42 60-64 23.43 27.36 28.000000000000004 21.21 65-69 23.375 28.215 27.24 21.17 70-74 23.064999999999998 27.54 27.775 21.62 75-79 23.400000000000002 27.71 27.935 20.955 80-84 23.57 27.725 28.095 20.61 85-89 23.585 27.715 27.534999999999997 21.165 90-94 24.0 27.555000000000003 27.855 20.59 95-99 23.655 28.115000000000002 27.295 20.935000000000002 100-104 24.095 28.335 27.11 20.46 105-109 23.544999999999998 27.639999999999997 28.48 20.335 110-114 24.14 27.915 27.555000000000003 20.39 115-119 24.43 27.779999999999998 27.485 20.305 120-124 24.385 28.105000000000004 27.200000000000003 20.31 125-129 24.69 28.22 26.86 20.23 130-134 25.130000000000003 27.6 26.905 20.365 135-139 25.569999999999997 27.450000000000003 26.905 20.075000000000003 140-144 25.919999999999998 27.76 26.619999999999997 19.7 145-149 26.179999999999996 27.855 26.85 19.115 150-151 28.171128346259692 27.858393795346508 25.21891418563923 18.751563672754564 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 2.5 25 2.5 26 5.5 27 5.5 28 7.5 29 10.5 30 15.5 31 27.0 32 31.0 33 34.5 34 52.5 35 70.5 36 87.5 37 112.5 38 142.5 39 157.5 40 171.5 41 216.0 42 239.5 43 246.0 44 260.5 45 265.0 46 267.5 47 255.5 48 230.5 49 200.0 50 169.0 51 139.5 52 119.5 53 103.5 54 81.5 55 61.0 56 37.0 57 31.0 58 36.0 59 30.0 60 20.5 61 14.0 62 11.0 63 8.5 64 6.0 65 2.0 66 0.5 67 1.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59718026183283 98.9 2 0.25176233635448136 0.5 3 0.050352467270896276 0.15 4 0.050352467270896276 0.2 5 0.050352467270896276 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.875 0.0 0.0 0.0 0.0 102-103 2.2249999999999996 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 2.775 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.675 0.0 0.0 0.0 0.0 112-113 4.1625 0.0 0.0 0.0 0.0 114-115 4.762499999999999 0.0 0.0 0.0 0.0 116-117 5.3875 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.4875 0.0 0.0 0.0 0.0 122-123 7.0875 0.0 0.0 0.0 0.0 124-125 7.6 0.0 0.0 0.0 0.0 126-127 8.3375 0.0 0.0 0.0 0.0 128-129 9.175 0.0 0.0 0.0 0.0 130-131 9.8625 0.0 0.0 0.0 0.0 132-133 10.55 0.0 0.0 0.0 0.0 134-135 11.3125 0.0 0.0 0.0 0.0 136-137 12.0 0.0 0.0 0.0 0.0 138-139 12.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra Read 916889 spots for SRR7171095.sra Written 916889 spots for SRR7171095.sra Read 916878 spots for SRR7171095.sra Written 916878 spots for SRR7171095.sra SRR ids: ['SRR7171095.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hzbdf8ht SRR7171095.sra spots: 18337571 blocks: [[1, 916878], [916879, 1833756], [1833757, 2750634], [2750635, 3667512], [3667513, 4584390], [4584391, 5501268], [5501269, 6418146], [6418147, 7335024], [7335025, 8251902], [8251903, 9168780], [9168781, 10085658], [10085659, 11002536], [11002537, 11919414], [11919415, 12836292], [12836293, 13753170], [13753171, 14670048], [14670049, 15586926], [15586927, 16503804], [16503805, 17420682], [17420683, 18337571]] SRR7171095 file size 6192300 SRR7171095 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171095 SRR7171095_1.fastq SRR7171095_2.fastq Input file: SRR7171095_1.fastq Paired file: SRR7171095_2.fastq trimmed: SRR7171095-trimmed-pair1.fastq, SRR7171095-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:15:10 2025 >> started Fri Feb 14 04:15:29 2025 >> done (18.982s) 18337571 read pairs processed; of these: 17174 ( 0.09%) short read pairs filtered out after trimming by size control 24014 ( 0.13%) empty read pairs filtered out after trimming by size control 18296383 (99.78%) read pairs available; of these: 11567882 (63.22%) trimmed read pairs available after processing 6728501 (36.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 12 0.00% 20 16 0.00% 21 13 0.00% 22 15 0.00% 23 10 0.00% 24 11 0.00% 25 9 0.00% 26 16 0.00% 27 13 0.00% 28 17 0.00% 29 13 0.00% 30 26 0.00% 31 17 0.00% 32 19 0.00% 33 25 0.00% 34 23 0.00% 35 25 0.00% 36 22 0.00% 37 28 0.00% 38 30 0.00% 39 52 0.00% 40 40 0.00% 41 54 0.00% 42 72 0.00% 43 72 0.00% 44 109 0.00% 45 102 0.00% 46 90 0.00% 47 122 0.00% 48 144 0.00% 49 151 0.00% 50 194 0.00% 51 235 0.00% 52 279 0.00% 53 246 0.00% 54 254 0.00% 55 338 0.00% 56 402 0.00% 57 365 0.00% 58 474 0.00% 59 581 0.00% 60 636 0.00% 61 754 0.00% 62 900 0.00% 63 901 0.00% 64 998 0.01% 65 1072 0.01% 66 1225 0.01% 67 1391 0.01% 68 1560 0.01% 69 1767 0.01% 70 1916 0.01% 71 2461 0.01% 72 2681 0.01% 73 2976 0.02% 74 3465 0.02% 75 3753 0.02% 76 4502 0.02% 77 4909 0.03% 78 5039 0.03% 79 5678 0.03% 80 6273 0.03% 81 7017 0.04% 82 7990 0.04% 83 8897 0.05% 84 10785 0.06% 85 11804 0.06% 86 12632 0.07% 87 13756 0.08% 88 14454 0.08% 89 15642 0.09% 90 16612 0.09% 91 18049 0.10% 92 19343 0.11% 93 21351 0.12% 94 22373 0.12% 95 24179 0.13% 96 25335 0.14% 97 26431 0.14% 98 27256 0.15% 99 28145 0.15% 100 30313 0.17% 101 31630 0.17% 102 33735 0.18% 103 35534 0.19% 104 37079 0.20% 105 39124 0.21% 106 40263 0.22% 107 40954 0.22% 108 42505 0.23% 109 43776 0.24% 110 45120 0.25% 111 47354 0.26% 112 49294 0.27% 113 50667 0.28% 114 52967 0.29% 115 54928 0.30% 116 56794 0.31% 117 57808 0.32% 118 59253 0.32% 119 60129 0.33% 120 62071 0.34% 121 64410 0.35% 122 65865 0.36% 123 68870 0.38% 124 71054 0.39% 125 73447 0.40% 126 75740 0.41% 127 78358 0.43% 128 80489 0.44% 129 82829 0.45% 130 85093 0.47% 131 87740 0.48% 132 91997 0.50% 133 97438 0.53% 134 101900 0.56% 135 108040 0.59% 136 114376 0.63% 137 122102 0.67% 138 128380 0.70% 139 136583 0.75% 140 143636 0.79% 141 154355 0.84% 142 167580 0.92% 143 183739 1.00% 144 208849 1.14% 145 244508 1.34% 146 295029 1.61% 147 390152 2.13% 148 593604 3.24% 149 1182036 6.46% 150 4906729 26.82% 151 6728501 36.78% 18296383 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=23 prefix-density=0.40 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=41.77 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=18 prefix-density=0.62 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=25.02 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.3 sequence=CTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCT SRR7171095 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:16:14 Started mapping on | Feb 14 04:16:14 Finished on | Feb 14 04:18:24 Mapping speed, Million of reads per hour | 506.67 Number of input reads | 18296383 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16900753 Uniquely mapped reads % | 92.37% Average mapped length | 288.43 Number of splices: Total | 15592234 Number of splices: Annotated (sjdb) | 15223458 Number of splices: GT/AG | 15304126 Number of splices: GC/AG | 229127 Number of splices: AT/AC | 9362 Number of splices: Non-canonical | 49619 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 489393 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 252744 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 924750 924750 924750 N_multimapping 489393 489393 489393 N_noFeature 861703 16590516 983713 N_ambiguous 290811 1391 101674 UnstrandedReadsAssigned:15748239 PositiveStrandReadsAssigned:308846 NegativeStrandReadsAssigned:15815366 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171095 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171095-trimmed-pair1.fastq SRR7171095-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,296,383 reads, 15,924,521 reads pseudoaligned [quant] estimated average fragment length: 226.863 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 994 rounds 52401 SRR7171095.ke.tsv 34699 SRR7171095.se.tsv 87100 total ==> SRR7171095.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.14 517 16.091 Potri.005G024800.1.v4.1 1035 809.137 162 11.1675 Potri.004G059700.1.v4.1 961 735.162 31 2.35203 Potri.007G009000.2.v4.1 1416 1190.14 0 0 Potri.003G141000.2.v4.1 2943 2717.14 805.731 16.5403 Potri.016G087400.1.v4.1 270 94.055 917.329 544.01 Potri.015G069301.1.v4.1 564 343.287 0 0 Potri.010G195200.1.v4.1 1773 1547.14 69 2.48762 Potri.012G127500.1.v4.1 977 751.152 60 4.45541 ==> SRR7171095.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1049 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR7171095 completed mapping pipeline successfully