Starting /dee2/code/volunteer_pipeline.sh SRR7171096 current disk space = 3087612846080 free memory = 1582757860 SRR7171096 SRAfilesize 4a266d7dfb1e3599dcd7d666c1256333 SRR7171096.sra SRR7171096.sra file validated SRR7171096 is paired end SRR7171096 is conventional basespace SRR7171096 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171096_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.338 18.0 18.0 33.0 18.0 33.0 2 25.96975 27.0 18.0 31.0 18.0 33.0 3 28.77725 29.0 27.0 31.0 25.0 33.0 4 31.06425 31.0 30.0 33.0 29.0 33.0 5 32.2995 33.0 32.0 33.0 32.0 33.0 6 33.15775 37.0 31.0 38.0 16.0 38.0 7 35.73325 37.0 36.0 38.0 30.0 38.0 8 36.56775 38.0 37.0 38.0 34.0 38.0 9 37.0905 38.0 38.0 38.0 36.0 38.0 10-14 37.32625 38.0 38.0 38.0 36.6 38.0 15-19 37.43825 38.0 38.0 38.0 37.0 38.0 20-24 37.4538 38.0 38.0 38.0 37.0 38.0 25-29 37.4606 38.0 38.0 38.0 37.2 38.0 30-34 37.431 38.0 38.0 38.0 37.0 38.0 35-39 36.9203 38.0 38.0 38.0 35.0 38.0 40-44 37.2753 38.0 38.0 38.0 37.0 38.0 45-49 37.231399999999994 38.0 38.0 38.0 37.0 38.0 50-54 34.747049999999994 37.4 33.2 38.0 28.4 38.0 55-59 36.205 37.8 36.0 38.0 33.0 38.0 60-64 36.98 38.0 38.0 38.0 36.0 38.0 65-69 36.95 38.0 38.0 38.0 35.8 38.0 70-74 36.76645 38.0 38.0 38.0 35.0 38.0 75-79 36.7343 38.0 38.0 38.0 35.0 38.0 80-84 36.6722 38.0 38.0 38.0 34.8 38.0 85-89 36.44495 38.0 38.0 38.0 34.0 38.0 90-94 36.2701 38.0 37.8 38.0 34.0 38.0 95-99 36.37675 38.0 38.0 38.0 34.0 38.0 100-104 36.0835 38.0 37.0 38.0 33.0 38.0 105-109 36.1123 38.0 37.0 38.0 33.4 38.0 110-114 35.75574999999999 38.0 36.6 38.0 32.0 38.0 115-119 35.43365 38.0 36.2 38.0 30.6 38.0 120-124 35.2769 38.0 36.0 38.0 29.4 38.0 125-129 35.09385 38.0 36.0 38.0 28.4 38.0 130-134 29.528 33.0 22.6 37.6 16.2 38.0 135-139 33.729049999999994 37.2 33.8 38.0 23.0 38.0 140-144 33.7082 38.0 34.0 38.0 21.8 38.0 145-149 32.657000000000004 38.0 32.8 38.0 16.6 38.0 150-151 28.66275 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 1.0 9 0.0 10 3.0 11 0.0 12 0.0 13 1.0 14 4.0 15 2.0 16 2.0 17 2.0 18 4.0 19 5.0 20 9.0 21 8.0 22 7.0 23 2.0 24 12.0 25 14.0 26 19.0 27 11.0 28 27.0 29 48.0 30 52.0 31 84.0 32 95.0 33 150.0 34 260.0 35 542.0 36 1568.0 37 1065.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.332179930795846 12.882619110992813 10.007985094490286 40.777215863721054 2 17.133566783391696 17.408704352176088 35.26763381690846 30.190095047523762 3 18.05 24.474999999999998 31.075000000000003 26.400000000000002 4 21.85 30.349999999999998 25.525 22.275 5 19.325 36.175000000000004 25.924999999999997 18.575 6 18.2 36.5 26.8 18.5 7 13.925 23.549999999999997 44.224999999999994 18.3 8 16.35 24.325 31.474999999999998 27.85 9 17.025000000000002 23.549999999999997 34.599999999999994 24.825 10-14 19.525000000000002 29.865000000000002 26.424999999999997 24.185000000000002 15-19 19.475 28.89 27.334999999999997 24.3 20-24 19.215 28.994999999999997 28.125 23.665 25-29 19.885 28.804999999999996 28.050000000000004 23.26 30-34 19.395 29.255 28.04 23.31 35-39 19.755 29.15 27.49 23.605 40-44 19.935 29.705 27.315 23.044999999999998 45-49 20.119999999999997 28.610000000000003 27.994999999999997 23.275000000000002 50-54 19.66 28.355000000000004 28.645 23.34 55-59 20.62 28.410000000000004 27.685 23.285 60-64 19.994999999999997 28.59 28.084999999999997 23.330000000000002 65-69 19.744999999999997 29.49 27.46 23.305 70-74 20.555 28.625 27.560000000000002 23.26 75-79 19.869999999999997 29.14 27.51 23.48 80-84 19.505 29.185 27.68 23.630000000000003 85-89 20.275000000000002 28.95 27.700000000000003 23.075000000000003 90-94 20.119999999999997 28.595 27.47 23.815 95-99 20.465 28.660000000000004 27.634999999999998 23.24 100-104 20.04 28.765 26.945000000000004 24.25 105-109 20.57 28.845 27.500000000000004 23.085 110-114 20.79 28.084999999999997 27.675 23.45 115-119 20.5 28.815 27.169999999999998 23.515 120-124 20.560000000000002 28.255000000000003 27.38 23.805 125-129 20.599999999999998 28.694999999999997 27.42 23.285 130-134 20.805 28.22 27.229999999999997 23.745 135-139 20.565 28.549999999999997 27.250000000000004 23.635 140-144 21.535 28.17 27.175 23.119999999999997 145-149 20.925 28.199999999999996 27.1 23.775 150-151 20.25 28.375 26.887499999999996 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 2.0 19 2.5 20 2.5 21 3.5 22 4.0 23 3.0 24 3.5 25 4.5 26 9.0 27 15.0 28 19.0 29 21.5 30 23.5 31 28.5 32 39.5 33 54.5 34 75.0 35 94.0 36 105.0 37 109.0 38 132.0 39 172.0 40 191.0 41 205.5 42 226.0 43 248.0 44 261.5 45 256.0 46 242.5 47 226.0 48 212.0 49 193.0 50 161.5 51 128.0 52 104.0 53 91.0 54 76.0 55 63.5 56 59.0 57 48.0 58 27.0 59 15.5 60 13.0 61 8.5 62 4.5 63 2.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6554071086463322 1.3 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9249999999999999 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.625 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.137499999999999 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 4.862500000000001 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.45 0.0 0.0 0.0 0.0 134-135 5.925 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTACA 10 0.0068396386 144.9375 6 AATAGTA 10 0.0068396386 144.9375 4 ATAGTAT 10 0.0068396386 144.9375 5 >>END_MODULE SRR7171096 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171096_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.048 33.0 33.0 34.0 32.0 34.0 2 33.06875 34.0 33.0 34.0 32.0 34.0 3 32.9995 34.0 33.0 34.0 32.0 34.0 4 33.00725 34.0 33.0 34.0 32.0 34.0 5 33.12575 34.0 33.0 34.0 33.0 34.0 6 37.229 38.0 38.0 38.0 37.0 38.0 7 36.09 38.0 38.0 38.0 33.0 38.0 8 37.014 38.0 38.0 38.0 36.0 38.0 9 37.1775 38.0 38.0 38.0 37.0 38.0 10-14 37.23094999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.211000000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.0683 38.0 38.0 38.0 36.8 38.0 25-29 36.88265 38.0 38.0 38.0 36.0 38.0 30-34 37.11615 38.0 38.0 38.0 37.0 38.0 35-39 37.136250000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.1259 38.0 38.0 38.0 37.0 38.0 45-49 35.89125 38.0 36.4 38.0 30.4 38.0 50-54 37.035849999999996 38.0 38.0 38.0 36.8 38.0 55-59 36.9902 38.0 38.0 38.0 36.2 38.0 60-64 36.93625 38.0 38.0 38.0 36.0 38.0 65-69 36.9566 38.0 38.0 38.0 36.0 38.0 70-74 36.8391 38.0 38.0 38.0 35.8 38.0 75-79 36.8254 38.0 38.0 38.0 36.0 38.0 80-84 36.744899999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.68435000000001 38.0 38.0 38.0 35.6 38.0 90-94 36.544799999999995 38.0 38.0 38.0 34.8 38.0 95-99 36.49059999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.1967 38.0 38.0 38.0 34.0 38.0 105-109 36.07125 38.0 37.8 38.0 33.6 38.0 110-114 34.09590000000001 37.8 33.8 38.0 23.2 38.0 115-119 35.718849999999996 38.0 36.8 38.0 32.2 38.0 120-124 35.5085 38.0 36.6 38.0 31.4 38.0 125-129 35.201649999999994 38.0 36.0 38.0 29.2 38.0 130-134 35.0494 38.0 36.0 38.0 29.0 38.0 135-139 34.4351 38.0 34.4 38.0 26.8 38.0 140-144 33.80935000000001 38.0 33.0 38.0 23.0 38.0 145-149 32.770700000000005 38.0 33.0 38.0 13.2 38.0 150-151 27.589375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 1.0 6 1.0 7 0.0 8 5.0 9 1.0 10 1.0 11 3.0 12 4.0 13 2.0 14 1.0 15 1.0 16 6.0 17 1.0 18 8.0 19 5.0 20 5.0 21 7.0 22 7.0 23 4.0 24 6.0 25 12.0 26 13.0 27 20.0 28 25.0 29 37.0 30 49.0 31 62.0 32 85.0 33 112.0 34 169.0 35 278.0 36 756.0 37 2301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.1 19.900000000000002 10.6 23.400000000000002 2 27.474999999999998 24.25 31.125000000000004 17.150000000000002 3 21.125 27.900000000000002 32.875 18.099999999999998 4 22.91718789091819 35.90192644483363 23.267450587940957 17.91343507630723 5 22.325 37.125 22.675 17.875 6 20.025000000000002 37.675 24.099999999999998 18.2 7 18.85 20.275000000000002 40.325 20.549999999999997 8 21.5 23.275000000000002 28.375 26.85 9 21.775 24.474999999999998 29.549999999999997 24.2 10-14 23.285 28.685 26.35 21.68 15-19 23.655 27.950000000000003 27.67 20.724999999999998 20-24 23.54 28.24 27.805000000000003 20.415 25-29 23.425 28.535 27.61 20.43 30-34 22.994999999999997 27.889999999999997 28.585 20.53 35-39 22.775000000000002 27.900000000000002 28.275 21.05 40-44 23.605 27.865000000000002 28.09 20.44 45-49 22.75 27.985 28.255000000000003 21.01 50-54 23.24 28.299999999999997 27.744999999999997 20.715 55-59 23.09 28.025 28.285 20.599999999999998 60-64 23.135 27.875 28.025 20.965 65-69 23.400000000000002 28.08 28.144999999999996 20.375 70-74 23.51 27.955000000000002 27.925 20.61 75-79 23.105 28.194999999999997 27.87 20.830000000000002 80-84 23.385 27.785 27.865000000000002 20.965 85-89 23.169999999999998 27.839999999999996 27.955000000000002 21.035 90-94 23.830000000000002 28.000000000000004 27.884999999999998 20.285 95-99 23.085 28.15 28.015 20.75 100-104 23.75 27.894999999999996 27.450000000000003 20.905 105-109 23.79 28.275 27.785 20.150000000000002 110-114 23.46 28.23 27.67 20.64 115-119 23.835 28.605000000000004 27.245 20.315 120-124 24.34 28.215 27.644999999999996 19.8 125-129 24.205 27.875 28.685 19.235 130-134 25.155 27.950000000000003 27.450000000000003 19.445 135-139 25.074999999999996 27.985 27.744999999999997 19.195 140-144 25.25 27.935 27.560000000000002 19.255 145-149 25.695 28.139999999999997 27.48 18.685 150-151 26.187500000000004 27.775 27.275 18.7625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 1.0 23 3.5 24 4.5 25 4.5 26 6.0 27 5.5 28 8.0 29 12.5 30 17.0 31 19.0 32 27.5 33 41.0 34 43.5 35 59.0 36 90.5 37 122.5 38 144.5 39 168.0 40 195.0 41 227.5 42 248.5 43 264.0 44 271.0 45 254.5 46 243.5 47 239.5 48 223.5 49 201.0 50 176.5 51 140.0 52 120.5 53 102.5 54 76.0 55 58.0 56 48.0 57 38.5 58 25.0 59 19.5 60 17.5 61 11.0 62 7.5 63 3.5 64 1.0 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1139240506329 97.875 2 0.7341772151898734 1.4500000000000002 3 0.05063291139240507 0.15 4 0.05063291139240507 0.2 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.025316455696202535 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9249999999999999 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 5.025 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.775 0.0 0.0 0.0 0.0 132-133 6.137499999999999 0.0 0.0 0.0 0.0 134-135 6.6125 0.0 0.0 0.0 0.0 136-137 7.425 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGTC 10 0.0068378756 144.95 7 >>END_MODULE Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787301 spots for SRR7171096.sra Written 787301 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra Read 787287 spots for SRR7171096.sra Written 787287 spots for SRR7171096.sra SRR ids: ['SRR7171096.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_axe98413 SRR7171096.sra spots: 15745754 blocks: [[1, 787287], [787288, 1574574], [1574575, 2361861], [2361862, 3149148], [3149149, 3936435], [3936436, 4723722], [4723723, 5511009], [5511010, 6298296], [6298297, 7085583], [7085584, 7872870], [7872871, 8660157], [8660158, 9447444], [9447445, 10234731], [10234732, 11022018], [11022019, 11809305], [11809306, 12596592], [12596593, 13383879], [13383880, 14171166], [14171167, 14958453], [14958454, 15745754]] SRR7171096 file size 5314018 SRR7171096 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171096 SRR7171096_1.fastq SRR7171096_2.fastq Input file: SRR7171096_1.fastq Paired file: SRR7171096_2.fastq trimmed: SRR7171096-trimmed-pair1.fastq, SRR7171096-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:21:00 2025 >> started Fri Feb 14 04:21:26 2025 >> done (25.986s) 15745754 read pairs processed; of these: 21298 ( 0.14%) short read pairs filtered out after trimming by size control 23166 ( 0.15%) empty read pairs filtered out after trimming by size control 15701290 (99.72%) read pairs available; of these: 8749279 (55.72%) trimmed read pairs available after processing 6952011 (44.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 11 0.00% 21 11 0.00% 22 22 0.00% 23 15 0.00% 24 24 0.00% 25 17 0.00% 26 21 0.00% 27 15 0.00% 28 15 0.00% 29 16 0.00% 30 20 0.00% 31 22 0.00% 32 10 0.00% 33 29 0.00% 34 17 0.00% 35 15 0.00% 36 19 0.00% 37 21 0.00% 38 34 0.00% 39 29 0.00% 40 36 0.00% 41 41 0.00% 42 42 0.00% 43 40 0.00% 44 45 0.00% 45 46 0.00% 46 63 0.00% 47 57 0.00% 48 79 0.00% 49 83 0.00% 50 116 0.00% 51 129 0.00% 52 139 0.00% 53 126 0.00% 54 153 0.00% 55 168 0.00% 56 163 0.00% 57 205 0.00% 58 214 0.00% 59 288 0.00% 60 273 0.00% 61 344 0.00% 62 362 0.00% 63 460 0.00% 64 440 0.00% 65 516 0.00% 66 576 0.00% 67 582 0.00% 68 701 0.00% 69 774 0.00% 70 879 0.01% 71 1030 0.01% 72 1200 0.01% 73 1305 0.01% 74 1479 0.01% 75 1675 0.01% 76 1915 0.01% 77 2101 0.01% 78 2234 0.01% 79 2466 0.02% 80 2731 0.02% 81 3262 0.02% 82 3667 0.02% 83 4104 0.03% 84 5432 0.03% 85 6492 0.04% 86 7170 0.05% 87 7674 0.05% 88 8149 0.05% 89 8436 0.05% 90 9012 0.06% 91 9583 0.06% 92 10138 0.06% 93 11247 0.07% 94 11824 0.08% 95 12627 0.08% 96 13085 0.08% 97 13738 0.09% 98 14453 0.09% 99 15320 0.10% 100 16374 0.10% 101 17140 0.11% 102 18702 0.12% 103 19852 0.13% 104 21151 0.13% 105 22948 0.15% 106 23300 0.15% 107 24285 0.15% 108 25546 0.16% 109 26228 0.17% 110 27371 0.17% 111 28369 0.18% 112 30306 0.19% 113 31519 0.20% 114 33156 0.21% 115 34429 0.22% 116 35707 0.23% 117 37011 0.24% 118 37389 0.24% 119 38380 0.24% 120 40111 0.26% 121 40646 0.26% 122 42029 0.27% 123 43615 0.28% 124 46052 0.29% 125 47993 0.31% 126 49669 0.32% 127 50595 0.32% 128 52086 0.33% 129 53663 0.34% 130 55119 0.35% 131 57002 0.36% 132 59744 0.38% 133 62836 0.40% 134 66533 0.42% 135 70468 0.45% 136 74395 0.47% 137 78648 0.50% 138 83142 0.53% 139 89672 0.57% 140 95453 0.61% 141 106153 0.68% 142 117336 0.75% 143 134372 0.86% 144 157825 1.01% 145 190526 1.21% 146 237951 1.52% 147 327094 2.08% 148 502434 3.20% 149 970299 6.18% 150 3994569 25.44% 151 6952011 44.28% 15701290 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=22.92 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=32.01 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.8 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171096 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:22:11 Started mapping on | Feb 14 04:22:11 Finished on | Feb 14 04:24:12 Mapping speed, Million of reads per hour | 467.15 Number of input reads | 15701290 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14627929 Uniquely mapped reads % | 93.16% Average mapped length | 291.92 Number of splices: Total | 13490014 Number of splices: Annotated (sjdb) | 13175394 Number of splices: GT/AG | 13226940 Number of splices: GC/AG | 206524 Number of splices: AT/AC | 8525 Number of splices: Non-canonical | 48025 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399724 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 66021 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 695583 695583 695583 N_multimapping 399724 399724 399724 N_noFeature 598228 14344114 687654 N_ambiguous 297084 956 102272 UnstrandedReadsAssigned:13732617 PositiveStrandReadsAssigned:282859 NegativeStrandReadsAssigned:13838003 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171096 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171096-trimmed-pair1.fastq SRR7171096-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,701,290 reads, 13,792,165 reads pseudoaligned [quant] estimated average fragment length: 229.313 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52401 SRR7171096.ke.tsv 34699 SRR7171096.se.tsv 87100 total ==> SRR7171096.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.69 631 21.0448 Potri.005G024800.1.v4.1 1035 806.687 345 25.5274 Potri.004G059700.1.v4.1 961 732.687 26 2.11811 Potri.007G009000.2.v4.1 1416 1187.69 0 0 Potri.003G141000.2.v4.1 2943 2714.69 826.476 18.172 Potri.016G087400.1.v4.1 270 84.5603 1018 718.579 Potri.015G069301.1.v4.1 564 338.862 0 0 Potri.010G195200.1.v4.1 1773 1544.69 43 1.66158 Potri.012G127500.1.v4.1 977 748.687 90 7.17522 ==> SRR7171096.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 809 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 9 SRR7171096 completed mapping pipeline successfully