Starting /dee2/code/volunteer_pipeline.sh SRR7171097 current disk space = 3087487807488 free memory = 1582557908 SRR7171097 SRAfilesize 58a78d53ef0aae476c230cf2a435bead SRR7171097.sra SRR7171097.sra file validated SRR7171097 is paired end SRR7171097 is conventional basespace SRR7171097 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171097_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.08425 18.0 18.0 32.0 18.0 33.0 2 28.27675 29.0 27.0 31.0 18.0 33.0 3 29.7745 31.0 29.0 33.0 27.0 33.0 4 30.0795 31.0 29.0 33.0 27.0 33.0 5 32.24525 33.0 32.0 33.0 32.0 33.0 6 36.31225 38.0 36.0 38.0 33.0 38.0 7 36.9715 38.0 37.0 38.0 35.0 38.0 8 37.45675 38.0 38.0 38.0 37.0 38.0 9 37.46875 38.0 38.0 38.0 37.0 38.0 10-14 37.45945 38.0 38.0 38.0 37.0 38.0 15-19 37.5178 38.0 38.0 38.0 37.4 38.0 20-24 37.48955 38.0 38.0 38.0 37.2 38.0 25-29 37.49765 38.0 38.0 38.0 37.4 38.0 30-34 37.4723 38.0 38.0 38.0 37.2 38.0 35-39 37.216499999999996 38.0 38.0 38.0 36.6 38.0 40-44 37.39375 38.0 38.0 38.0 37.0 38.0 45-49 37.3537 38.0 38.0 38.0 37.0 38.0 50-54 36.61685 38.0 37.8 38.0 33.6 38.0 55-59 37.1134 38.0 38.0 38.0 36.0 38.0 60-64 37.09495 38.0 38.0 38.0 36.0 38.0 65-69 37.0173 38.0 38.0 38.0 36.0 38.0 70-74 36.8189 38.0 38.0 38.0 35.0 38.0 75-79 36.83255 38.0 38.0 38.0 35.2 38.0 80-84 36.8269 38.0 38.0 38.0 35.2 38.0 85-89 36.46755 38.0 38.0 38.0 34.2 38.0 90-94 36.179 38.0 37.2 38.0 33.4 38.0 95-99 36.38605 38.0 37.4 38.0 34.0 38.0 100-104 36.3895 38.0 37.2 38.0 34.0 38.0 105-109 36.17755 38.0 37.0 38.0 33.6 38.0 110-114 35.7749 38.0 36.8 38.0 31.4 38.0 115-119 35.3329 38.0 36.0 38.0 29.2 38.0 120-124 35.436150000000005 38.0 36.0 38.0 30.2 38.0 125-129 35.1379 38.0 35.6 38.0 29.0 38.0 130-134 31.84345 35.2 28.4 38.0 20.4 38.0 135-139 34.26105 38.0 33.8 38.0 24.6 38.0 140-144 33.6638 38.0 33.8 38.0 21.8 38.0 145-149 32.73049999999999 38.0 33.0 38.0 15.8 38.0 150-151 28.176125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 1.0 18 5.0 19 3.0 20 4.0 21 2.0 22 5.0 23 9.0 24 9.0 25 14.0 26 19.0 27 17.0 28 23.0 29 37.0 30 52.0 31 53.0 32 77.0 33 139.0 34 225.0 35 479.0 36 1320.0 37 1499.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.48707551951343 13.482007095793207 8.9204257475925 34.11049163710086 2 21.030257564391096 17.829457364341085 35.533883470867714 25.6064016004001 3 17.775 26.200000000000003 27.700000000000003 28.325 4 22.575 32.25 24.375 20.8 5 21.125 36.875 25.1 16.900000000000002 6 18.4 36.199999999999996 24.325 21.075 7 14.000000000000002 23.65 43.8 18.55 8 16.05 24.099999999999998 30.8 29.049999999999997 9 18.425 22.5 32.300000000000004 26.775 10-14 20.395 29.675 26.825 23.105 15-19 20.380000000000003 28.76 27.205000000000002 23.655 20-24 19.645000000000003 28.994999999999997 28.249999999999996 23.11 25-29 20.424999999999997 29.060000000000002 26.83 23.685000000000002 30-34 20.205000000000002 28.82 27.694999999999997 23.28 35-39 19.615 28.910000000000004 27.725 23.75 40-44 20.07 28.439999999999998 28.095 23.395 45-49 20.419999999999998 28.749999999999996 27.36 23.47 50-54 20.19 28.77 27.894999999999996 23.145 55-59 19.96 28.505000000000003 27.76 23.775 60-64 20.48 28.08 27.71 23.73 65-69 19.985 28.470000000000002 27.445000000000004 24.099999999999998 70-74 19.869999999999997 28.689999999999998 28.01 23.43 75-79 19.925 28.955 27.67 23.45 80-84 20.165 28.749999999999996 27.125 23.96 85-89 20.34 28.52 27.105 24.035 90-94 21.125 28.42 26.805 23.65 95-99 20.305 28.645 27.445000000000004 23.605 100-104 20.65 28.71 27.634999999999998 23.005 105-109 20.685000000000002 28.904999999999998 27.255000000000003 23.155 110-114 21.224999999999998 28.499999999999996 27.224999999999998 23.05 115-119 20.91 28.499999999999996 27.01 23.580000000000002 120-124 20.845 28.310000000000002 26.825 24.02 125-129 20.645 28.04 27.339999999999996 23.974999999999998 130-134 20.97 28.055000000000003 27.575 23.400000000000002 135-139 21.404999999999998 28.050000000000004 26.939999999999998 23.605 140-144 21.17 28.294999999999998 26.855 23.68 145-149 21.044999999999998 28.535 26.650000000000002 23.77 150-151 21.125 28.9375 25.9625 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 1.5 19 2.5 20 2.0 21 1.5 22 1.0 23 2.0 24 2.0 25 4.5 26 9.5 27 8.0 28 8.5 29 18.0 30 24.0 31 23.0 32 27.5 33 43.0 34 67.0 35 84.0 36 102.0 37 121.5 38 128.5 39 154.5 40 189.0 41 200.0 42 229.0 43 265.5 44 260.5 45 259.5 46 246.0 47 221.0 48 221.5 49 208.0 50 185.0 51 156.5 52 116.5 53 90.0 54 77.0 55 59.5 56 48.0 57 34.5 58 21.0 59 23.0 60 22.5 61 12.0 62 4.5 63 4.0 64 2.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4275653923541248 0.8500000000000001 3 0.05030181086519115 0.15 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.6125 0.0 0.0 0.0 0.0 128-129 4.925 0.0 0.0 0.0 0.0 130-131 5.375 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.55 0.0 0.0 0.0 0.0 136-137 7.0375 0.0 0.0 0.0 0.0 138-139 7.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAGT 10 0.006577216 146.82278 1 >>END_MODULE SRR7171097 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171097_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70675 33.0 33.0 34.0 32.0 34.0 2 32.17975 33.0 33.0 34.0 28.0 34.0 3 32.704 33.0 33.0 34.0 31.0 34.0 4 32.80975 34.0 33.0 34.0 32.0 34.0 5 32.7975 34.0 33.0 34.0 32.0 34.0 6 37.09375 38.0 38.0 38.0 36.0 38.0 7 37.0775 38.0 38.0 38.0 37.0 38.0 8 37.02875 38.0 38.0 38.0 36.0 38.0 9 37.1225 38.0 38.0 38.0 37.0 38.0 10-14 37.08095 38.0 38.0 38.0 37.0 38.0 15-19 37.009299999999996 38.0 38.0 38.0 36.8 38.0 20-24 35.19205 38.0 35.4 38.0 27.6 38.0 25-29 36.28744999999999 38.0 37.8 38.0 33.2 38.0 30-34 36.73845 38.0 38.0 38.0 35.6 38.0 35-39 36.8553 38.0 38.0 38.0 36.0 38.0 40-44 36.8935 38.0 38.0 38.0 36.2 38.0 45-49 36.905150000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.901349999999994 38.0 38.0 38.0 36.0 38.0 55-59 36.83095 38.0 38.0 38.0 36.0 38.0 60-64 36.7962 38.0 38.0 38.0 36.0 38.0 65-69 36.6415 38.0 38.0 38.0 35.8 38.0 70-74 36.6255 38.0 38.0 38.0 35.6 38.0 75-79 36.1648 38.0 37.6 38.0 31.2 38.0 80-84 34.66825 37.8 34.6 38.0 27.0 38.0 85-89 36.365500000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.34145 38.0 38.0 38.0 34.0 38.0 95-99 36.096849999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.1146 38.0 38.0 38.0 34.0 38.0 105-109 34.58975 37.8 34.6 38.0 27.0 38.0 110-114 35.4542 38.0 36.8 38.0 30.4 38.0 115-119 35.1554 38.0 36.2 38.0 28.8 38.0 120-124 35.159800000000004 38.0 36.0 38.0 29.6 38.0 125-129 34.679700000000004 38.0 35.4 38.0 26.4 38.0 130-134 34.49185 38.0 35.0 38.0 25.8 38.0 135-139 34.133599999999994 38.0 33.8 38.0 24.8 38.0 140-144 31.499450000000003 35.6 29.0 37.6 19.0 38.0 145-149 30.0142 34.8 28.6 38.0 8.4 38.0 150-151 26.46325 33.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 3.0 5 0.0 6 2.0 7 1.0 8 2.0 9 7.0 10 5.0 11 1.0 12 1.0 13 2.0 14 2.0 15 6.0 16 4.0 17 5.0 18 6.0 19 5.0 20 3.0 21 4.0 22 12.0 23 9.0 24 19.0 25 17.0 26 29.0 27 36.0 28 41.0 29 43.0 30 52.0 31 66.0 32 95.0 33 128.0 34 206.0 35 369.0 36 1089.0 37 1717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.875 19.575 12.4 22.15 2 26.1 24.075 31.25 18.575 3 21.175 27.0 32.725 19.1 4 24.831207801950487 33.33333333333333 22.48062015503876 19.35483870967742 5 23.980995248812203 38.084521130282575 20.80520130032508 17.129282320580145 6 19.075 38.725 23.175 19.025 7 19.275000000000002 19.475 40.975 20.275000000000002 8 20.45 24.75 27.35 27.450000000000003 9 22.2 25.025 28.575 24.2 10-14 23.47 28.689999999999998 26.474999999999998 21.365000000000002 15-19 22.97 28.065 27.884999999999998 21.08 20-24 23.44 28.58 27.255000000000003 20.724999999999998 25-29 23.01 28.235 27.725 21.029999999999998 30-34 22.5 28.29 28.23 20.979999999999997 35-39 22.81 27.985 28.38 20.825 40-44 22.98 28.470000000000002 27.465 21.085 45-49 23.36 27.765 27.905 20.97 50-54 22.75 27.61 28.655 20.985 55-59 23.015 27.145000000000003 28.595 21.245 60-64 22.994999999999997 27.415 27.85 21.740000000000002 65-69 22.835 27.67 28.499999999999996 20.995 70-74 23.52 27.029999999999998 28.305000000000003 21.145 75-79 22.85 27.845 28.04 21.265 80-84 22.925 27.66 28.310000000000002 21.105 85-89 23.125 27.439999999999998 28.244999999999997 21.19 90-94 23.355 27.584999999999997 28.01 21.05 95-99 23.78 27.785 27.884999999999998 20.549999999999997 100-104 23.580000000000002 27.76 27.900000000000002 20.76 105-109 23.86 27.51 28.435 20.195 110-114 23.75 27.925 28.075 20.25 115-119 23.84 27.875 27.88 20.405 120-124 24.42 27.88 27.57 20.13 125-129 23.72 27.415 28.139999999999997 20.724999999999998 130-134 24.825 27.944999999999997 26.82 20.41 135-139 24.93 27.715 27.41 19.945 140-144 24.69 27.88 27.715 19.715 145-149 25.56 28.000000000000004 26.895000000000003 19.545 150-151 25.374999999999996 27.712500000000002 26.9125 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 3.0 24 3.5 25 4.0 26 4.0 27 7.0 28 10.0 29 12.0 30 14.5 31 21.5 32 34.0 33 44.0 34 59.5 35 71.5 36 82.5 37 102.0 38 116.5 39 146.0 40 178.5 41 212.5 42 245.5 43 247.5 44 268.0 45 279.5 46 266.5 47 246.0 48 220.0 49 214.5 50 186.0 51 144.5 52 120.0 53 102.5 54 89.5 55 63.5 56 38.0 57 30.5 58 29.0 59 24.5 60 17.0 61 13.0 62 8.5 63 5.5 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.654911838790932 1.3 3 0.0 0.0 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.8875000000000002 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 3.2 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.237500000000001 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.362500000000001 0.0 0.0 0.0 0.0 134-135 6.75 0.0 0.0 0.0 0.0 136-137 7.050000000000001 0.0 0.0 0.0 0.0 138-139 7.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892175 spots for SRR7171097.sra Written 892175 spots for SRR7171097.sra Read 892179 spots for SRR7171097.sra Written 892179 spots for SRR7171097.sra SRR ids: ['SRR7171097.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zcyblv7u SRR7171097.sra spots: 17843504 blocks: [[1, 892175], [892176, 1784350], [1784351, 2676525], [2676526, 3568700], [3568701, 4460875], [4460876, 5353050], [5353051, 6245225], [6245226, 7137400], [7137401, 8029575], [8029576, 8921750], [8921751, 9813925], [9813926, 10706100], [10706101, 11598275], [11598276, 12490450], [12490451, 13382625], [13382626, 14274800], [14274801, 15166975], [15166976, 16059150], [16059151, 16951325], [16951326, 17843504]] SRR7171097 file size 6024877 SRR7171097 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171097 SRR7171097_1.fastq SRR7171097_2.fastq Input file: SRR7171097_1.fastq Paired file: SRR7171097_2.fastq trimmed: SRR7171097-trimmed-pair1.fastq, SRR7171097-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:25:40 2025 >> started Fri Feb 14 04:26:08 2025 >> done (27.951s) 17843504 read pairs processed; of these: 21264 ( 0.12%) short read pairs filtered out after trimming by size control 22004 ( 0.12%) empty read pairs filtered out after trimming by size control 17800236 (99.76%) read pairs available; of these: 10838633 (60.89%) trimmed read pairs available after processing 6961603 (39.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 6 0.00% 21 7 0.00% 22 7 0.00% 23 10 0.00% 24 12 0.00% 25 11 0.00% 26 13 0.00% 27 12 0.00% 28 11 0.00% 29 10 0.00% 30 15 0.00% 31 6 0.00% 32 10 0.00% 33 15 0.00% 34 11 0.00% 35 11 0.00% 36 15 0.00% 37 17 0.00% 38 18 0.00% 39 23 0.00% 40 28 0.00% 41 32 0.00% 42 40 0.00% 43 42 0.00% 44 35 0.00% 45 36 0.00% 46 56 0.00% 47 37 0.00% 48 66 0.00% 49 77 0.00% 50 90 0.00% 51 91 0.00% 52 98 0.00% 53 118 0.00% 54 118 0.00% 55 137 0.00% 56 135 0.00% 57 172 0.00% 58 188 0.00% 59 196 0.00% 60 244 0.00% 61 295 0.00% 62 398 0.00% 63 390 0.00% 64 425 0.00% 65 503 0.00% 66 555 0.00% 67 560 0.00% 68 644 0.00% 69 748 0.00% 70 870 0.00% 71 1012 0.01% 72 1200 0.01% 73 1415 0.01% 74 1562 0.01% 75 1773 0.01% 76 2169 0.01% 77 2331 0.01% 78 2234 0.01% 79 2656 0.01% 80 2706 0.02% 81 3353 0.02% 82 3749 0.02% 83 4290 0.02% 84 5741 0.03% 85 6210 0.03% 86 6781 0.04% 87 7300 0.04% 88 8014 0.05% 89 8362 0.05% 90 8941 0.05% 91 9707 0.05% 92 10517 0.06% 93 11598 0.07% 94 12486 0.07% 95 13313 0.07% 96 14172 0.08% 97 14624 0.08% 98 15165 0.09% 99 16189 0.09% 100 17251 0.10% 101 18276 0.10% 102 19601 0.11% 103 20777 0.12% 104 22358 0.13% 105 23853 0.13% 106 24964 0.14% 107 25694 0.14% 108 26661 0.15% 109 28302 0.16% 110 29089 0.16% 111 30696 0.17% 112 31986 0.18% 113 33720 0.19% 114 35406 0.20% 115 37051 0.21% 116 38856 0.22% 117 40043 0.22% 118 41387 0.23% 119 42605 0.24% 120 44507 0.25% 121 46163 0.26% 122 47995 0.27% 123 50499 0.28% 124 53152 0.30% 125 54910 0.31% 126 58029 0.33% 127 60126 0.34% 128 62376 0.35% 129 65056 0.37% 130 67551 0.38% 131 70415 0.40% 132 74871 0.42% 133 79431 0.45% 134 84708 0.48% 135 90026 0.51% 136 96452 0.54% 137 103931 0.58% 138 113023 0.63% 139 121935 0.69% 140 133089 0.75% 141 146533 0.82% 142 164885 0.93% 143 189145 1.06% 144 221346 1.24% 145 266671 1.50% 146 334596 1.88% 147 451258 2.54% 148 681915 3.83% 149 1292567 7.26% 150 4715649 26.49% 151 6961603 39.11% 17800236 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=304.40 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=10 prefix-density=0.85 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=14.24 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.0 sequence=CAGCATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7171097 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:26:51 Started mapping on | Feb 14 04:26:51 Finished on | Feb 14 04:28:52 Mapping speed, Million of reads per hour | 529.59 Number of input reads | 17800236 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16612239 Uniquely mapped reads % | 93.33% Average mapped length | 291.62 Number of splices: Total | 15695987 Number of splices: Annotated (sjdb) | 15346089 Number of splices: GT/AG | 15394213 Number of splices: GC/AG | 241080 Number of splices: AT/AC | 9584 Number of splices: Non-canonical | 51110 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 493776 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 93185 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.25% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714330 714330 714330 N_multimapping 493776 493776 493776 N_noFeature 648196 16326962 756305 N_ambiguous 288819 1244 110916 UnstrandedReadsAssigned:15675224 PositiveStrandReadsAssigned:284033 NegativeStrandReadsAssigned:15745018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171097 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171097-trimmed-pair1.fastq SRR7171097-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,800,236 reads, 15,748,279 reads pseudoaligned [quant] estimated average fragment length: 234.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7171097.ke.tsv 34699 SRR7171097.se.tsv 87100 total ==> SRR7171097.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.25 663 21.171 Potri.005G024800.1.v4.1 1035 801.247 184 13.0838 Potri.004G059700.1.v4.1 961 727.273 20 1.56681 Potri.007G009000.2.v4.1 1416 1182.25 0 0 Potri.003G141000.2.v4.1 2943 2709.25 696.313 14.6433 Potri.016G087400.1.v4.1 270 85.8583 931 617.804 Potri.015G069301.1.v4.1 564 335.063 0 0 Potri.010G195200.1.v4.1 1773 1539.25 35 1.29552 Potri.012G127500.1.v4.1 977 743.263 557 42.6969 ==> SRR7171097.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1410 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 28 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 157 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7171097 completed mapping pipeline successfully