Starting /dee2/code/volunteer_pipeline.sh SRR7171098 current disk space = 3087076184064 free memory = 1580075384 SRR7171098 SRAfilesize e5344d0a7168ae1660b7cb95b43a52b0 SRR7171098.sra SRR7171098.sra file validated SRR7171098 is paired end SRR7171098 is conventional basespace SRR7171098 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.81 18.0 18.0 30.0 18.0 32.0 2 30.271 31.0 29.0 33.0 27.0 33.0 3 31.8305 33.0 31.0 33.0 29.0 33.0 4 32.45375 33.0 33.0 33.0 31.0 34.0 5 33.07275 33.0 33.0 34.0 33.0 34.0 6 37.22675 38.0 37.0 38.0 36.0 38.0 7 37.44925 38.0 38.0 38.0 37.0 38.0 8 37.53375 38.0 38.0 38.0 37.0 38.0 9 37.56375 38.0 38.0 38.0 37.0 38.0 10-14 37.54285 38.0 38.0 38.0 37.4 38.0 15-19 37.5124 38.0 38.0 38.0 37.4 38.0 20-24 37.443799999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.361799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.40554999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.124700000000004 38.0 38.0 38.0 36.6 38.0 40-44 37.28995 38.0 38.0 38.0 37.0 38.0 45-49 37.24855 38.0 38.0 38.0 37.0 38.0 50-54 36.54225 38.0 37.8 38.0 33.8 38.0 55-59 36.9233 38.0 38.0 38.0 35.2 38.0 60-64 36.893550000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.81335 38.0 38.0 38.0 35.0 38.0 70-74 36.65665 38.0 38.0 38.0 34.0 38.0 75-79 36.63190000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.5263 38.0 38.0 38.0 34.0 38.0 85-89 36.179899999999996 38.0 37.0 38.0 33.6 38.0 90-94 35.91335 38.0 37.0 38.0 32.6 38.0 95-99 36.1004 38.0 37.0 38.0 33.4 38.0 100-104 35.9947 38.0 37.0 38.0 32.8 38.0 105-109 35.8057 38.0 37.0 38.0 31.8 38.0 110-114 35.39305 38.0 36.0 38.0 30.0 38.0 115-119 35.09375 38.0 35.8 38.0 28.6 38.0 120-124 35.077000000000005 38.0 35.6 38.0 28.2 38.0 125-129 34.63865 38.0 34.8 38.0 26.6 38.0 130-134 31.17595 34.6 27.4 38.0 17.6 38.0 135-139 33.59475 37.8 33.6 38.0 22.6 38.0 140-144 33.01375 37.8 33.0 38.0 17.4 38.0 145-149 32.1077 37.2 31.2 38.0 13.4 38.0 150-151 27.529249999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 3.0 15 2.0 16 4.0 17 4.0 18 3.0 19 5.0 20 5.0 21 6.0 22 4.0 23 6.0 24 11.0 25 6.0 26 19.0 27 20.0 28 36.0 29 33.0 30 46.0 31 80.0 32 104.0 33 158.0 34 272.0 35 534.0 36 1260.0 37 1371.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.073961499493414 14.311043566362716 11.57548125633232 28.039513677811552 2 20.785392696348172 17.03351675837919 36.643321660830416 25.53776888444222 3 17.299999999999997 24.025 28.825 29.849999999999998 4 21.825 32.1 24.075 22.0 5 21.25 36.4 25.074999999999996 17.275 6 17.75 36.25 25.825 20.175 7 14.625 23.599999999999998 43.6 18.175 8 16.400000000000002 23.025000000000002 32.5 28.075 9 18.0 23.95 33.45 24.6 10-14 20.45 29.134999999999998 27.229999999999997 23.185 15-19 20.19 27.79 28.63 23.39 20-24 20.13 28.235 27.985 23.65 25-29 19.935 28.595 28.225 23.244999999999997 30-34 19.605 28.74 28.375 23.28 35-39 19.88 28.744999999999997 27.755000000000003 23.62 40-44 20.02 28.505000000000003 28.255000000000003 23.22 45-49 20.150000000000002 28.285 28.035 23.53 50-54 19.825 28.735 28.349999999999998 23.09 55-59 20.19 28.499999999999996 28.634999999999998 22.675 60-64 19.895 28.199999999999996 28.725 23.18 65-69 19.509999999999998 28.265 28.78 23.445 70-74 20.365 27.88 28.98 22.775000000000002 75-79 19.715 28.275 28.585 23.425 80-84 20.345 27.62 28.79 23.244999999999997 85-89 19.759999999999998 28.62 28.375 23.244999999999997 90-94 20.805 28.505000000000003 27.755000000000003 22.935 95-99 19.994999999999997 28.49 28.625 22.89 100-104 20.525 29.049999999999997 27.82 22.605 105-109 20.225 27.87 28.405 23.5 110-114 20.34 28.025 28.384999999999998 23.25 115-119 20.87 28.110000000000003 27.99 23.03 120-124 20.485 28.084999999999997 28.18 23.25 125-129 21.36 27.584999999999997 27.495000000000005 23.56 130-134 20.849999999999998 28.78 27.325 23.044999999999998 135-139 20.685000000000002 28.485 27.189999999999998 23.64 140-144 20.76 28.15 27.715 23.375 145-149 20.78 28.285 27.66 23.275000000000002 150-151 21.25 27.712500000000002 27.8625 23.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 2.0 5 1.5 6 0.5 7 1.5 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 2.0 15 1.5 16 0.5 17 1.0 18 1.0 19 2.0 20 2.0 21 0.5 22 0.5 23 2.5 24 5.0 25 7.5 26 9.0 27 10.0 28 12.0 29 16.0 30 23.0 31 32.0 32 40.5 33 51.0 34 60.0 35 78.5 36 106.5 37 129.0 38 147.0 39 169.0 40 197.5 41 222.0 42 242.0 43 257.0 44 270.0 45 265.0 46 242.0 47 229.0 48 202.5 49 170.5 50 159.5 51 127.5 52 103.0 53 93.5 54 72.0 55 56.5 56 48.5 57 39.5 58 25.5 59 16.5 60 11.5 61 7.5 62 6.0 63 5.5 64 2.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.3 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.8375 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.987500000000001 0.0 0.0 0.0 0.0 136-137 7.574999999999999 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171098 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93975 33.0 33.0 34.0 32.0 34.0 2 32.50775 33.0 33.0 34.0 31.0 34.0 3 32.954 34.0 33.0 34.0 32.0 34.0 4 33.0205 34.0 33.0 34.0 32.0 34.0 5 33.03025 34.0 33.0 34.0 33.0 34.0 6 37.25175 38.0 38.0 38.0 37.0 38.0 7 37.252 38.0 38.0 38.0 37.0 38.0 8 37.32625 38.0 38.0 38.0 37.0 38.0 9 37.303 38.0 38.0 38.0 37.0 38.0 10-14 37.28035 38.0 38.0 38.0 37.4 38.0 15-19 37.212300000000006 38.0 38.0 38.0 37.0 38.0 20-24 35.70095 38.0 36.6 38.0 29.0 38.0 25-29 36.5933 38.0 38.0 38.0 34.8 38.0 30-34 37.082049999999995 38.0 38.0 38.0 36.8 38.0 35-39 37.190200000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.2239 38.0 38.0 38.0 37.0 38.0 45-49 37.192049999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.19185 38.0 38.0 38.0 37.0 38.0 55-59 37.138 38.0 38.0 38.0 36.8 38.0 60-64 37.09085 38.0 38.0 38.0 36.8 38.0 65-69 36.99475 38.0 38.0 38.0 36.0 38.0 70-74 36.974599999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.511100000000006 38.0 37.8 38.0 33.8 38.0 80-84 35.2255 37.8 35.4 38.0 28.4 38.0 85-89 36.77085 38.0 38.0 38.0 35.8 38.0 90-94 36.7211 38.0 38.0 38.0 35.4 38.0 95-99 36.55625 38.0 38.0 38.0 34.4 38.0 100-104 36.515249999999995 38.0 38.0 38.0 34.6 38.0 105-109 35.1023 38.0 35.4 38.0 28.6 38.0 110-114 35.948249999999994 38.0 37.0 38.0 33.0 38.0 115-119 35.6495 38.0 36.6 38.0 31.0 38.0 120-124 35.66705 38.0 36.8 38.0 31.8 38.0 125-129 35.328500000000005 38.0 36.0 38.0 29.8 38.0 130-134 35.15605000000001 38.0 36.0 38.0 29.6 38.0 135-139 34.7675 38.0 35.4 38.0 28.4 38.0 140-144 32.4927 36.6 30.0 38.0 23.6 38.0 145-149 31.039700000000003 35.8 29.8 38.0 10.8 38.0 150-151 27.096375000000002 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 2.0 5 1.0 6 0.0 7 1.0 8 3.0 9 1.0 10 2.0 11 1.0 12 2.0 13 1.0 14 0.0 15 4.0 16 4.0 17 3.0 18 5.0 19 1.0 20 3.0 21 5.0 22 5.0 23 5.0 24 8.0 25 22.0 26 18.0 27 18.0 28 29.0 29 41.0 30 31.0 31 47.0 32 79.0 33 126.0 34 205.0 35 359.0 36 997.0 37 1962.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.475 20.75 10.575 21.2 2 25.124999999999996 25.7 31.75 17.424999999999997 3 21.2 26.575 32.35 19.875 4 22.586293146573286 34.817408704352175 22.736368184092047 19.85992996498249 5 24.012006003001503 38.344172086043024 20.560280140070038 17.083541770885443 6 19.075 38.9 23.025000000000002 19.0 7 19.075 20.549999999999997 39.7 20.674999999999997 8 19.85 24.474999999999998 28.9 26.775 9 21.575 24.175 30.025000000000002 24.224999999999998 10-14 23.71 29.325000000000003 25.955000000000002 21.01 15-19 22.720000000000002 28.505000000000003 27.584999999999997 21.19 20-24 23.165 28.76 27.74 20.335 25-29 22.75 28.13 28.62 20.5 30-34 22.485 28.57 28.144999999999996 20.8 35-39 22.259999999999998 27.884999999999998 28.560000000000002 21.295 40-44 22.39 28.22 28.375 21.015 45-49 23.125 27.639999999999997 28.76 20.474999999999998 50-54 22.325 28.58 28.48 20.615 55-59 22.900000000000002 27.505000000000003 28.249999999999996 21.345 60-64 23.07 28.28 27.855 20.794999999999998 65-69 22.745 28.07 28.075 21.11 70-74 23.05 28.499999999999996 27.715 20.735 75-79 22.905 28.389999999999997 27.61 21.095 80-84 22.755 28.525 27.644999999999996 21.075 85-89 22.845 27.975 28.050000000000004 21.13 90-94 23.16 28.055000000000003 27.455000000000002 21.33 95-99 23.669999999999998 27.77 27.93 20.630000000000003 100-104 23.115 28.175 27.884999999999998 20.825 105-109 23.43 27.860000000000003 28.744999999999997 19.965 110-114 23.785 28.485 27.605 20.125 115-119 23.68 28.549999999999997 27.615000000000002 20.155 120-124 24.18 28.43 27.474999999999998 19.915 125-129 24.09 28.78 27.075 20.055 130-134 24.485 27.965 27.63 19.919999999999998 135-139 24.775 28.485 27.005000000000003 19.735 140-144 24.490000000000002 28.355000000000004 27.72 19.435 145-149 25.06 29.175 26.935 18.83 150-151 25.4625 28.6875 26.9125 18.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.5 22 1.0 23 2.5 24 5.0 25 5.0 26 8.0 27 10.0 28 8.5 29 10.5 30 16.5 31 21.5 32 29.5 33 46.0 34 60.0 35 84.5 36 97.5 37 102.5 38 127.0 39 160.0 40 196.0 41 226.5 42 256.0 43 271.5 44 268.0 45 246.0 46 267.0 47 258.5 48 204.5 49 182.5 50 168.5 51 145.5 52 115.0 53 93.5 54 81.0 55 72.5 56 44.5 57 26.5 58 20.0 59 15.0 60 11.0 61 6.0 62 6.0 63 5.0 64 2.0 65 1.5 66 3.0 67 2.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5291005291005291 1.05 3 0.12597631645250693 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.225 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.6625 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.824999999999999 0.0 0.0 0.0 0.0 128-129 6.137499999999999 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.0625 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 8.1375 0.0 0.0 0.0 0.0 138-139 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra Read 883203 spots for SRR7171098.sra Written 883203 spots for SRR7171098.sra Read 883187 spots for SRR7171098.sra Written 883187 spots for SRR7171098.sra SRR ids: ['SRR7171098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_41ov8av_ SRR7171098.sra spots: 17663756 blocks: [[1, 883187], [883188, 1766374], [1766375, 2649561], [2649562, 3532748], [3532749, 4415935], [4415936, 5299122], [5299123, 6182309], [6182310, 7065496], [7065497, 7948683], [7948684, 8831870], [8831871, 9715057], [9715058, 10598244], [10598245, 11481431], [11481432, 12364618], [12364619, 13247805], [13247806, 14130992], [14130993, 15014179], [15014180, 15897366], [15897367, 16780553], [16780554, 17663756]] SRR7171098 file size 5963966 SRR7171098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171098 SRR7171098_1.fastq SRR7171098_2.fastq Input file: SRR7171098_1.fastq Paired file: SRR7171098_2.fastq trimmed: SRR7171098-trimmed-pair1.fastq, SRR7171098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:35:53 2025 >> started Fri Feb 14 04:36:12 2025 >> done (19.315s) 17663756 read pairs processed; of these: 19462 ( 0.11%) short read pairs filtered out after trimming by size control 23760 ( 0.13%) empty read pairs filtered out after trimming by size control 17620534 (99.76%) read pairs available; of these: 10928345 (62.02%) trimmed read pairs available after processing 6692189 (37.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 14 0.00% 20 16 0.00% 21 18 0.00% 22 15 0.00% 23 22 0.00% 24 33 0.00% 25 20 0.00% 26 17 0.00% 27 27 0.00% 28 20 0.00% 29 20 0.00% 30 18 0.00% 31 12 0.00% 32 26 0.00% 33 22 0.00% 34 18 0.00% 35 28 0.00% 36 26 0.00% 37 26 0.00% 38 24 0.00% 39 35 0.00% 40 34 0.00% 41 55 0.00% 42 64 0.00% 43 49 0.00% 44 54 0.00% 45 59 0.00% 46 68 0.00% 47 73 0.00% 48 92 0.00% 49 110 0.00% 50 111 0.00% 51 135 0.00% 52 147 0.00% 53 162 0.00% 54 203 0.00% 55 220 0.00% 56 212 0.00% 57 239 0.00% 58 280 0.00% 59 356 0.00% 60 328 0.00% 61 417 0.00% 62 466 0.00% 63 482 0.00% 64 598 0.00% 65 645 0.00% 66 661 0.00% 67 759 0.00% 68 830 0.00% 69 959 0.01% 70 1096 0.01% 71 1203 0.01% 72 1362 0.01% 73 1583 0.01% 74 1792 0.01% 75 2050 0.01% 76 2324 0.01% 77 2587 0.01% 78 2769 0.02% 79 2984 0.02% 80 3433 0.02% 81 4044 0.02% 82 4364 0.02% 83 5061 0.03% 84 6448 0.04% 85 7210 0.04% 86 8058 0.05% 87 8883 0.05% 88 9473 0.05% 89 9880 0.06% 90 10526 0.06% 91 11425 0.06% 92 11989 0.07% 93 13317 0.08% 94 14327 0.08% 95 15375 0.09% 96 16204 0.09% 97 17024 0.10% 98 17982 0.10% 99 19136 0.11% 100 20203 0.11% 101 21346 0.12% 102 22996 0.13% 103 24561 0.14% 104 26282 0.15% 105 27738 0.16% 106 29384 0.17% 107 30131 0.17% 108 31757 0.18% 109 33061 0.19% 110 34177 0.19% 111 36163 0.21% 112 37904 0.22% 113 39598 0.22% 114 41321 0.23% 115 43337 0.25% 116 44683 0.25% 117 46203 0.26% 118 47626 0.27% 119 48702 0.28% 120 50505 0.29% 121 52716 0.30% 122 54309 0.31% 123 56995 0.32% 124 59031 0.34% 125 60817 0.35% 126 63666 0.36% 127 65709 0.37% 128 67426 0.38% 129 70111 0.40% 130 72309 0.41% 131 74719 0.42% 132 79056 0.45% 133 83097 0.47% 134 87791 0.50% 135 92566 0.53% 136 97689 0.55% 137 104020 0.59% 138 111120 0.63% 139 120015 0.68% 140 129515 0.74% 141 142851 0.81% 142 159999 0.91% 143 182955 1.04% 144 214004 1.21% 145 261020 1.48% 146 326730 1.85% 147 442842 2.51% 148 673213 3.82% 149 1284986 7.29% 150 4656141 26.42% 151 6692189 37.98% 17620534 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=33.43 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.5 sequence=ATTAATTAATGCCAATATAAATCAGCTTATTTATCACTAATATTCCAGGTAATAGAAGCACTAATTTCATAATCAGAAAGGTTTAGTAAGGTTTTTGCCCAACATAGTTGCCGGGTGGATCATAGTTGCACCCAATGAAGGTTCCTCCGGTGCTACACTTCACTTTAGCACATCCTAGGCGAGCAGAGTTACGCCAAACCACCTGAGTATAGTGCCCACACTGCTGGCCAGCGGCACATGAGTTGGAGTTGTAGTCGTAGTAAGCCTTCTCATCAACCCACAGTTTTACAGCATCTGTACCTGAAAGGTCCGCGCTGCTCCATGCAATGTTCTCCCCATAAGGTCCACCTGAATGGACAAGGTTGCAATCGCCGGCACGTTGGTTAGCATAATTTTGTGCATAGGCTTGCACTGTGGTGTCCCAGGTTAGTGGACCAACACCTACAGCTGCACGAGCTGCATTATGAGCATCAAGGTAATCTTGTGGGTTGTCTTGGGCACGAGAGGGAAG criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=30 prefix-density=0.28 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=38.27 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.2 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATA SRR7171098 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:36:58 Started mapping on | Feb 14 04:36:58 Finished on | Feb 14 04:39:04 Mapping speed, Million of reads per hour | 503.44 Number of input reads | 17620534 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16340968 Uniquely mapped reads % | 92.74% Average mapped length | 290.61 Number of splices: Total | 15153220 Number of splices: Annotated (sjdb) | 14744311 Number of splices: GT/AG | 14859116 Number of splices: GC/AG | 224527 Number of splices: AT/AC | 10649 Number of splices: Non-canonical | 58928 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 536621 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 129950 % of reads mapped to too many loci | 0.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 764186 764186 764186 N_multimapping 536621 536621 536621 N_noFeature 790378 16054985 917819 N_ambiguous 292842 1252 133566 UnstrandedReadsAssigned:15257748 PositiveStrandReadsAssigned:284731 NegativeStrandReadsAssigned:15289583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171098-trimmed-pair1.fastq SRR7171098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,620,534 reads, 15,287,747 reads pseudoaligned [quant] estimated average fragment length: 219.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR7171098.ke.tsv 34699 SRR7171098.se.tsv 87100 total ==> SRR7171098.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.34 857 28.1926 Potri.005G024800.1.v4.1 1035 816.335 250 18.1275 Potri.004G059700.1.v4.1 961 742.34 14 1.11633 Potri.007G009000.2.v4.1 1416 1197.34 0 0 Potri.003G141000.2.v4.1 2943 2724.34 918.417 19.9547 Potri.016G087400.1.v4.1 270 87.4822 797 539.268 Potri.015G069301.1.v4.1 564 347.907 0 0 Potri.010G195200.1.v4.1 1773 1554.34 182.931 6.96641 Potri.012G127500.1.v4.1 977 758.34 247 19.2796 ==> SRR7171098.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 804 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 373 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 86 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR7171098 completed mapping pipeline successfully