Starting /dee2/code/volunteer_pipeline.sh SRR7171099 current disk space = 3087168483328 free memory = 1580093700 SRR7171099 SRAfilesize b0e4b7edff8be9313c03ffeb3cb6a507 SRR7171099.sra SRR7171099.sra file validated SRR7171099 is paired end SRR7171099 is conventional basespace SRR7171099 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.90725 32.0 25.0 33.0 18.0 33.0 2 24.54525 25.0 18.0 30.0 18.0 33.0 3 27.64825 29.0 25.0 31.0 18.0 33.0 4 30.50925 31.0 29.0 33.0 27.0 33.0 5 31.2995 33.0 31.0 33.0 29.0 33.0 6 34.8065 37.0 35.0 38.0 29.0 38.0 7 36.31525 38.0 36.0 38.0 33.0 38.0 8 37.219 38.0 38.0 38.0 36.0 38.0 9 37.486 38.0 38.0 38.0 37.0 38.0 10-14 37.4776 38.0 38.0 38.0 37.2 38.0 15-19 37.52955000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.53660000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.48975 38.0 38.0 38.0 38.0 38.0 30-34 37.34465 38.0 38.0 38.0 37.6 38.0 35-39 37.31385 38.0 38.0 38.0 37.2 38.0 40-44 37.26055 38.0 38.0 38.0 37.0 38.0 45-49 37.240050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.152499999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.036950000000004 38.0 38.0 38.0 36.6 38.0 60-64 37.017700000000005 38.0 38.0 38.0 36.0 38.0 65-69 35.9094 38.0 37.2 38.0 30.8 38.0 70-74 36.0959 38.0 37.2 38.0 30.6 38.0 75-79 36.745 38.0 38.0 38.0 35.6 38.0 80-84 36.61945 38.0 38.0 38.0 35.8 38.0 85-89 36.481049999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.338499999999996 38.0 38.0 38.0 34.4 38.0 95-99 36.18755 38.0 38.0 38.0 34.0 38.0 100-104 36.24935000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.06505 38.0 38.0 38.0 34.0 38.0 110-114 36.027699999999996 38.0 38.0 38.0 33.8 38.0 115-119 35.65554999999999 38.0 37.8 38.0 32.4 38.0 120-124 35.608850000000004 38.0 37.0 38.0 31.8 38.0 125-129 35.027550000000005 38.0 36.2 38.0 29.8 38.0 130-134 34.54585 38.0 35.4 38.0 26.4 38.0 135-139 34.3849 38.0 35.2 38.0 27.0 38.0 140-144 33.71725 38.0 33.4 38.0 22.2 38.0 145-149 32.83875 38.0 33.0 38.0 15.4 38.0 150-151 27.800125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 3.0 8 5.0 9 3.0 10 3.0 11 1.0 12 5.0 13 1.0 14 2.0 15 2.0 16 4.0 17 8.0 18 8.0 19 12.0 20 5.0 21 9.0 22 7.0 23 10.0 24 3.0 25 16.0 26 13.0 27 20.0 28 28.0 29 34.0 30 31.0 31 76.0 32 68.0 33 102.0 34 183.0 35 280.0 36 925.0 37 2131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.502170028082716 12.305335716109267 11.360735256573909 26.831758999234108 2 22.11105552776388 15.007503751875939 34.967483741870936 27.913956978489246 3 16.725 23.25 30.25 29.775000000000002 4 21.45 29.175 26.224999999999998 23.150000000000002 5 21.099999999999998 34.0 25.525 19.375 6 17.45 34.425 27.85 20.275000000000002 7 13.575000000000001 23.7 45.550000000000004 17.175 8 15.825 23.799999999999997 33.525 26.85 9 16.175 24.2 34.125 25.5 10-14 18.98 30.03 27.415 23.575 15-19 18.740000000000002 29.395 28.18 23.685000000000002 20-24 19.16 29.13 28.294999999999998 23.415 25-29 19.465 28.835 28.084999999999997 23.615 30-34 19.575 29.165000000000003 28.035 23.225 35-39 19.43 28.970000000000002 27.83 23.77 40-44 19.445 29.42 27.884999999999998 23.25 45-49 20.630000000000003 28.854999999999997 26.995 23.52 50-54 19.705000000000002 28.365000000000002 27.98 23.95 55-59 19.655 28.53 27.595 24.22 60-64 20.125 28.825 27.36 23.69 65-69 20.28 28.549999999999997 27.725 23.445 70-74 19.975 28.349999999999998 28.115000000000002 23.56 75-79 20.215 28.325 28.095 23.365 80-84 19.895 27.950000000000003 28.194999999999997 23.96 85-89 19.63 28.525 28.15 23.695 90-94 20.515 27.87 27.82 23.794999999999998 95-99 20.257025702570257 28.542854285428543 27.49274927492749 23.707370737073706 100-104 19.575 28.485 27.88 24.060000000000002 105-109 20.294999999999998 28.1 27.529999999999998 24.075 110-114 20.544999999999998 28.285 27.279999999999998 23.89 115-119 20.31 28.49 27.37 23.830000000000002 120-124 20.645 28.065 27.04 24.25 125-129 20.54 29.015 26.185000000000002 24.26 130-134 20.79 28.395 26.76 24.055 135-139 21.029999999999998 28.24 26.245 24.485 140-144 20.77 28.595 26.055 24.58 145-149 21.245 28.58 25.945 24.23 150-151 21.093456774677843 28.199674715375956 26.598273489303143 24.10859502064306 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 11.0 1 9.5 2 7.5 3 5.0 4 1.5 5 1.5 6 2.0 7 1.0 8 1.5 9 1.5 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 0.5 18 0.0 19 1.0 20 3.0 21 3.5 22 3.0 23 2.5 24 5.0 25 8.0 26 9.5 27 14.5 28 21.5 29 23.5 30 27.5 31 38.5 32 39.5 33 46.5 34 65.0 35 88.0 36 97.0 37 114.0 38 140.0 39 168.5 40 183.0 41 183.5 42 210.0 43 223.0 44 216.5 45 218.0 46 235.0 47 211.0 48 189.5 49 195.0 50 176.0 51 149.0 52 134.5 53 119.0 54 98.0 55 86.5 56 71.0 57 47.5 58 27.0 59 20.5 60 16.5 61 9.5 62 6.0 63 5.0 64 2.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14624098867148 95.3 2 1.4675592173017509 2.85 3 0.23171987641606592 0.675 4 0.051493305870236865 0.2 5 0.025746652935118432 0.125 6 0.025746652935118432 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051493305870236865 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 15 0.375 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 13 0.325 TruSeq Adapter, Index 7 (97% over 36bp) GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 6 0.15 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.47500000000000003 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.699999999999999 0.0 0.0 0.0 0.0 118-119 5.075 0.0 0.0 0.0 0.0 120-121 5.6 0.0 0.0 0.0 0.0 122-123 6.1375 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 8.05 0.0 0.0 0.0 0.0 130-131 8.8125 0.0 0.0 0.0 0.0 132-133 9.425 0.0 0.0 0.0 0.0 134-135 10.149999999999999 0.0 0.0 0.0 0.0 136-137 11.075 0.0 0.0 0.0 0.0 138-139 11.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCGAT 10 0.0063429717 148.58975 1 CCCGATT 10 0.0068484643 144.875 2 GATTCAG 10 0.0068484643 144.875 5 >>END_MODULE SRR7171099 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4435 33.0 32.0 34.0 25.0 34.0 2 32.25975 33.0 33.0 34.0 28.0 34.0 3 32.5135 33.0 33.0 34.0 32.0 34.0 4 32.53375 33.0 33.0 34.0 32.0 34.0 5 32.61825 34.0 33.0 34.0 32.0 34.0 6 36.75375 38.0 38.0 38.0 36.0 38.0 7 36.78525 38.0 38.0 38.0 36.0 38.0 8 36.70975 38.0 38.0 38.0 36.0 38.0 9 36.7555 38.0 38.0 38.0 36.0 38.0 10-14 36.5894 38.0 38.0 38.0 35.0 38.0 15-19 36.5809 38.0 38.0 38.0 35.4 38.0 20-24 34.844049999999996 38.0 34.8 38.0 26.4 38.0 25-29 36.3909 38.0 37.8 38.0 34.2 38.0 30-34 36.6534 38.0 38.0 38.0 36.0 38.0 35-39 36.6029 38.0 38.0 38.0 36.0 38.0 40-44 36.550799999999995 38.0 38.0 38.0 35.6 38.0 45-49 36.379999999999995 38.0 38.0 38.0 34.6 38.0 50-54 35.811749999999996 38.0 37.4 38.0 31.4 38.0 55-59 36.3645 38.0 38.0 38.0 34.4 38.0 60-64 36.3563 38.0 38.0 38.0 34.2 38.0 65-69 36.2104 38.0 38.0 38.0 34.0 38.0 70-74 36.178000000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.1142 38.0 38.0 38.0 33.8 38.0 80-84 35.243399999999994 38.0 36.6 38.0 28.6 38.0 85-89 35.81555 38.0 38.0 38.0 33.0 38.0 90-94 35.888299999999994 38.0 38.0 38.0 33.8 38.0 95-99 35.785450000000004 38.0 38.0 38.0 33.2 38.0 100-104 35.542 38.0 37.2 38.0 31.8 38.0 105-109 34.8393 38.0 36.4 38.0 25.4 38.0 110-114 35.00095 38.0 36.4 38.0 29.0 38.0 115-119 34.85355 38.0 36.0 38.0 28.4 38.0 120-124 34.638149999999996 38.0 36.0 38.0 27.0 38.0 125-129 34.3966 38.0 35.8 38.0 26.2 38.0 130-134 33.528800000000004 38.0 33.4 38.0 19.8 38.0 135-139 33.01175 38.0 33.0 38.0 15.8 38.0 140-144 32.0561 38.0 32.8 38.0 12.8 38.0 145-149 31.0394 38.0 31.0 38.0 3.8 38.0 150-151 25.157249999999998 32.5 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 9.0 4 7.0 5 2.0 6 1.0 7 4.0 8 2.0 9 3.0 10 6.0 11 0.0 12 3.0 13 4.0 14 4.0 15 6.0 16 11.0 17 6.0 18 8.0 19 10.0 20 11.0 21 13.0 22 12.0 23 14.0 24 16.0 25 16.0 26 33.0 27 30.0 28 35.0 29 52.0 30 53.0 31 67.0 32 106.0 33 155.0 34 207.0 35 348.0 36 733.0 37 1990.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 20.599999999999998 11.5 20.674999999999997 2 27.425 24.45 29.95 18.175 3 22.6 26.25 33.025 18.125 4 26.05 33.275 22.275 18.4 5 24.75 37.775 21.349999999999998 16.125 6 20.200000000000003 38.05 23.474999999999998 18.275 7 21.224999999999998 19.925 37.05 21.8 8 20.3 24.95 28.199999999999996 26.55 9 21.375 24.525 31.075000000000003 23.025000000000002 10-14 24.715 28.335 26.055 20.895 15-19 24.005000000000003 27.474999999999998 27.810000000000002 20.71 20-24 23.96 28.21 27.169999999999998 20.66 25-29 23.685000000000002 28.935 26.755000000000003 20.625 30-34 23.75 27.250000000000004 28.199999999999996 20.8 35-39 23.59 28.18 27.345000000000002 20.885 40-44 23.549999999999997 27.97 27.534999999999997 20.945 45-49 23.724999999999998 27.97 27.750000000000004 20.555 50-54 23.665 27.77 27.615000000000002 20.95 55-59 24.08 27.189999999999998 28.050000000000004 20.68 60-64 24.060000000000002 26.795 27.805000000000003 21.34 65-69 23.575 28.134999999999998 27.91 20.380000000000003 70-74 24.485 27.744999999999997 26.88 20.89 75-79 23.849999999999998 27.705000000000002 27.21 21.235 80-84 23.455000000000002 28.845 27.134999999999998 20.565 85-89 23.865 28.01 27.29 20.835 90-94 23.865 27.67 28.03 20.435 95-99 23.94 27.935 27.725 20.4 100-104 24.34 27.634999999999998 27.675 20.349999999999998 105-109 24.335 26.985 27.875 20.805 110-114 23.96 27.99 27.68 20.369999999999997 115-119 24.72 28.23 27.24 19.81 120-124 25.124999999999996 28.16 26.99 19.725 125-129 24.884999999999998 28.15 27.05 19.915 130-134 25.61 27.605 27.215 19.57 135-139 25.619999999999997 27.884999999999998 27.155 19.34 140-144 26.450000000000003 27.97 26.729999999999997 18.85 145-149 26.365 27.21 27.065 19.36 150-151 27.029393370856784 27.979987492182612 26.34146341463415 18.649155722326455 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.0 24 4.0 25 5.0 26 7.0 27 10.5 28 9.5 29 10.0 30 16.5 31 25.5 32 33.5 33 39.0 34 50.5 35 67.5 36 75.5 37 92.0 38 115.0 39 138.0 40 173.0 41 196.5 42 226.0 43 244.5 44 245.5 45 251.0 46 236.0 47 242.0 48 240.0 49 209.5 50 185.5 51 150.5 52 129.0 53 115.0 54 109.0 55 92.5 56 59.5 57 43.0 58 39.5 59 30.5 60 17.0 61 18.0 62 15.5 63 7.5 64 4.5 65 2.0 66 1.0 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.51814001021972 96.39999999999999 2 1.0986203372508943 2.15 3 0.25549310168625444 0.75 4 0.0510986203372509 0.2 5 0.02554931016862545 0.125 6 0.0 0.0 7 0.02554931016862545 0.17500000000000002 8 0.02554931016862545 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.47500000000000003 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.5375 0.0 0.0 0.0 0.0 126-127 7.074999999999999 0.0 0.0 0.0 0.0 128-129 7.7125 0.0 0.0 0.0 0.0 130-131 8.462499999999999 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.7125 0.0 0.0 0.0 0.0 136-137 10.6125 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCGAGT 10 0.006832588 144.9875 6 TCTTCAA 10 0.006832588 144.9875 7 >>END_MODULE Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802675 spots for SRR7171099.sra Written 802675 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra Read 802657 spots for SRR7171099.sra Written 802657 spots for SRR7171099.sra SRR ids: ['SRR7171099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rvvagke SRR7171099.sra spots: 16053158 blocks: [[1, 802657], [802658, 1605314], [1605315, 2407971], [2407972, 3210628], [3210629, 4013285], [4013286, 4815942], [4815943, 5618599], [5618600, 6421256], [6421257, 7223913], [7223914, 8026570], [8026571, 8829227], [8829228, 9631884], [9631885, 10434541], [10434542, 11237198], [11237199, 12039855], [12039856, 12842512], [12842513, 13645169], [13645170, 14447826], [14447827, 15250483], [15250484, 16053158]] SRR7171099 file size 5418188 SRR7171099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171099 SRR7171099_1.fastq SRR7171099_2.fastq Input file: SRR7171099_1.fastq Paired file: SRR7171099_2.fastq trimmed: SRR7171099-trimmed-pair1.fastq, SRR7171099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:40:27 2025 >> started Fri Feb 14 04:40:49 2025 >> done (22.009s) 16053158 read pairs processed; of these: 39526 ( 0.25%) short read pairs filtered out after trimming by size control 102821 ( 0.64%) empty read pairs filtered out after trimming by size control 15910811 (99.11%) read pairs available; of these: 10259278 (64.48%) trimmed read pairs available after processing 5651533 (35.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 15 0.00% 20 21 0.00% 21 21 0.00% 22 21 0.00% 23 40 0.00% 24 56 0.00% 25 48 0.00% 26 61 0.00% 27 60 0.00% 28 77 0.00% 29 72 0.00% 30 68 0.00% 31 65 0.00% 32 72 0.00% 33 66 0.00% 34 72 0.00% 35 54 0.00% 36 82 0.00% 37 79 0.00% 38 95 0.00% 39 87 0.00% 40 110 0.00% 41 109 0.00% 42 118 0.00% 43 129 0.00% 44 129 0.00% 45 158 0.00% 46 153 0.00% 47 166 0.00% 48 209 0.00% 49 222 0.00% 50 279 0.00% 51 265 0.00% 52 268 0.00% 53 324 0.00% 54 361 0.00% 55 383 0.00% 56 431 0.00% 57 528 0.00% 58 559 0.00% 59 602 0.00% 60 688 0.00% 61 786 0.00% 62 810 0.01% 63 902 0.01% 64 941 0.01% 65 1015 0.01% 66 1109 0.01% 67 1257 0.01% 68 1281 0.01% 69 1437 0.01% 70 1621 0.01% 71 1912 0.01% 72 2160 0.01% 73 2424 0.02% 74 2776 0.02% 75 3399 0.02% 76 4999 0.03% 77 5840 0.04% 78 4987 0.03% 79 4615 0.03% 80 5058 0.03% 81 5467 0.03% 82 6222 0.04% 83 6999 0.04% 84 9399 0.06% 85 10937 0.07% 86 12352 0.08% 87 14177 0.09% 88 15489 0.10% 89 16443 0.10% 90 17331 0.11% 91 18222 0.11% 92 18864 0.12% 93 19884 0.12% 94 20288 0.13% 95 21369 0.13% 96 21425 0.13% 97 22266 0.14% 98 22752 0.14% 99 23641 0.15% 100 25691 0.16% 101 26048 0.16% 102 28237 0.18% 103 30136 0.19% 104 31730 0.20% 105 33800 0.21% 106 34355 0.22% 107 34965 0.22% 108 36336 0.23% 109 38219 0.24% 110 39603 0.25% 111 40155 0.25% 112 42378 0.27% 113 44672 0.28% 114 45681 0.29% 115 47569 0.30% 116 49502 0.31% 117 50194 0.32% 118 51464 0.32% 119 52830 0.33% 120 54824 0.34% 121 56521 0.36% 122 58259 0.37% 123 61240 0.38% 124 63911 0.40% 125 65281 0.41% 126 67938 0.43% 127 69424 0.44% 128 71926 0.45% 129 74750 0.47% 130 76280 0.48% 131 79685 0.50% 132 82648 0.52% 133 88031 0.55% 134 92687 0.58% 135 99956 0.63% 136 104734 0.66% 137 112109 0.70% 138 118214 0.74% 139 125118 0.79% 140 131660 0.83% 141 141915 0.89% 142 153499 0.96% 143 169020 1.06% 144 191405 1.20% 145 225899 1.42% 146 270848 1.70% 147 359064 2.26% 148 544171 3.42% 149 1067556 6.71% 150 4236850 26.63% 151 5651533 35.52% 15910811 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=18 prefix-density=0.75 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.20 sequence-density-rank=20 fanout-score=19.64 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=8.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=19 prefix-density=1.32 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATTGTTATGTATTGGCCATGTCTGTGGCCTCTGGTGTGGTTTTAATGAAGTCTTATAATTAGTGTAGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=29.25 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7171099 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:41:34 Started mapping on | Feb 14 04:41:34 Finished on | Feb 14 04:43:44 Mapping speed, Million of reads per hour | 440.61 Number of input reads | 15910811 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14642028 Uniquely mapped reads % | 92.03% Average mapped length | 288.56 Number of splices: Total | 13560842 Number of splices: Annotated (sjdb) | 13295786 Number of splices: GT/AG | 13303768 Number of splices: GC/AG | 205228 Number of splices: AT/AC | 8980 Number of splices: Non-canonical | 42866 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377514 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 40726 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.17% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 958974 958974 958974 N_multimapping 377514 377514 377514 N_noFeature 438089 14233629 562015 N_ambiguous 385167 885 100316 UnstrandedReadsAssigned:13818772 PositiveStrandReadsAssigned:407514 NegativeStrandReadsAssigned:13979697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171099-trimmed-pair1.fastq SRR7171099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,910,811 reads, 13,925,622 reads pseudoaligned [quant] estimated average fragment length: 219.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52401 SRR7171099.ke.tsv 34699 SRR7171099.se.tsv 87100 total ==> SRR7171099.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.94 379 9.85188 Potri.005G024800.1.v4.1 1035 816.94 231 13.23 Potri.004G059700.1.v4.1 961 742.949 16 1.00762 Potri.007G009000.2.v4.1 1416 1197.94 0 0 Potri.003G141000.2.v4.1 2943 2724.94 850 14.5949 Potri.016G087400.1.v4.1 270 90.4093 1024 529.937 Potri.015G069301.1.v4.1 564 349.13 0 0 Potri.010G195200.1.v4.1 1773 1554.94 26 0.782344 Potri.012G127500.1.v4.1 977 758.945 76 4.68534 ==> SRR7171099.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 404 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 453 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7171099 completed mapping pipeline successfully