Starting /dee2/code/volunteer_pipeline.sh SRR7171100 current disk space = 3088178008064 free memory = 1185344208 SRR7171100 SRAfilesize 06041748f07cc9c4c3b14ef075a00da9 SRR7171100.sra SRR7171100.sra file validated SRR7171100 is paired end SRR7171100 is conventional basespace SRR7171100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.6825 18.0 18.0 28.0 18.0 33.0 2 28.9685 30.0 27.0 31.0 25.0 33.0 3 30.797 31.0 29.0 33.0 27.0 33.0 4 32.1505 33.0 33.0 33.0 30.0 33.0 5 32.4985 33.0 33.0 34.0 31.0 34.0 6 36.63725 38.0 37.0 38.0 34.0 38.0 7 37.0935 38.0 38.0 38.0 36.0 38.0 8 37.26325 38.0 38.0 38.0 36.0 38.0 9 37.359 38.0 38.0 38.0 37.0 38.0 10-14 37.43294999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.407399999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.5113 38.0 38.0 38.0 37.2 38.0 25-29 37.1039 38.0 38.0 38.0 35.2 38.0 30-34 37.2222 38.0 38.0 38.0 36.2 38.0 35-39 36.259249999999994 38.0 36.6 38.0 31.2 38.0 40-44 37.2473 38.0 38.0 38.0 37.0 38.0 45-49 36.6839 38.0 37.4 38.0 33.8 38.0 50-54 37.1569 38.0 38.0 38.0 36.2 38.0 55-59 37.18485 38.0 38.0 38.0 36.2 38.0 60-64 36.48865 38.0 37.4 38.0 33.2 38.0 65-69 36.0351 38.0 36.4 38.0 30.2 38.0 70-74 36.442750000000004 38.0 37.6 38.0 32.8 38.0 75-79 36.790400000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.76005 38.0 38.0 38.0 35.0 38.0 85-89 35.56784999999999 38.0 35.8 38.0 30.2 38.0 90-94 35.7207 38.0 36.2 38.0 31.0 38.0 95-99 34.965900000000005 38.0 35.8 38.0 26.0 38.0 100-104 36.0715 38.0 37.0 38.0 32.4 38.0 105-109 36.15925 38.0 37.2 38.0 33.4 38.0 110-114 34.9747 38.0 35.6 38.0 26.2 38.0 115-119 32.19015 35.0 29.0 37.8 23.2 38.0 120-124 35.4551 38.0 36.0 38.0 30.6 38.0 125-129 34.999900000000004 38.0 35.4 38.0 28.2 38.0 130-134 34.0527 38.0 33.4 38.0 22.6 38.0 135-139 34.2625 38.0 33.2 38.0 25.4 38.0 140-144 33.58685 38.0 33.0 38.0 21.6 38.0 145-149 30.06875 36.0 26.4 38.0 9.8 38.0 150-151 26.4815 33.5 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 1.0 19 6.0 20 5.0 21 3.0 22 7.0 23 8.0 24 6.0 25 11.0 26 23.0 27 32.0 28 35.0 29 46.0 30 55.0 31 86.0 32 102.0 33 192.0 34 326.0 35 630.0 36 1436.0 37 979.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.18647166361974 17.36745886654479 9.01018542700444 39.43588404283103 2 19.3 18.925 37.6 24.175 3 17.925 24.375 27.675 30.025000000000002 4 22.575 31.424999999999997 23.05 22.95 5 20.635317658829415 36.16808404202101 24.68734367183592 18.509254627313656 6 17.825 35.65 26.724999999999998 19.8 7 14.224999999999998 22.825 43.65 19.3 8 17.9 22.825 31.624999999999996 27.650000000000002 9 17.0 23.125 34.4 25.474999999999998 10-14 20.205000000000002 29.45 26.525 23.82 15-19 19.78 28.925 27.339999999999996 23.955000000000002 20-24 19.939999999999998 28.08 28.000000000000004 23.98 25-29 19.814999999999998 28.77 27.644999999999996 23.77 30-34 20.22 28.535 27.72 23.525 35-39 20.21 28.439999999999998 27.52 23.830000000000002 40-44 20.105 28.865000000000002 28.110000000000003 22.919999999999998 45-49 20.345 28.515 27.544999999999998 23.595 50-54 19.925 28.62 27.85 23.605 55-59 19.965 28.754999999999995 28.02 23.26 60-64 20.44 28.865000000000002 27.07 23.625 65-69 20.595 28.235 27.57 23.599999999999998 70-74 20.36 28.62 27.215 23.805 75-79 20.66 28.52 27.345000000000002 23.474999999999998 80-84 20.512051205120514 28.622862286228624 27.362736273627362 23.502350235023503 85-89 20.192019201920193 28.012801280128013 28.002800280028 23.792379237923793 90-94 20.18 27.435 28.335 24.05 95-99 20.495 28.02 28.075 23.41 100-104 20.705000000000002 28.23 27.860000000000003 23.205000000000002 105-109 20.59 28.134999999999998 27.74 23.535 110-114 21.065 28.125 27.08 23.73 115-119 20.895 28.48 27.150000000000002 23.474999999999998 120-124 21.235 28.215 26.355 24.195 125-129 21.365000000000002 27.875 26.825 23.935000000000002 130-134 20.745 29.060000000000002 25.89 24.305 135-139 21.355 27.85 26.900000000000002 23.895 140-144 21.175 28.035 27.05 23.74 145-149 21.5 28.62 26.185000000000002 23.695 150-151 20.64266066516629 27.369342335583895 27.419354838709676 24.568642160540136 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 4.0 25 6.0 26 9.5 27 14.0 28 20.0 29 25.5 30 22.5 31 29.0 32 40.5 33 51.0 34 67.5 35 80.0 36 94.5 37 113.5 38 133.5 39 166.0 40 179.5 41 190.5 42 220.0 43 233.5 44 240.5 45 240.5 46 232.5 47 232.5 48 232.5 49 224.0 50 194.5 51 135.0 52 105.5 53 99.5 54 86.5 55 69.0 56 52.5 57 43.5 58 35.0 59 27.5 60 18.0 61 9.5 62 3.5 63 2.0 64 2.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.01 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39439818319455 98.475 2 0.40373454453696694 0.8 3 0.10093363613424174 0.3 4 0.0757002271006813 0.3 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.0375 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 7.1125 0.0 0.0 0.0 0.0 134-135 7.6625 0.0 0.0 0.0 0.0 136-137 8.162500000000001 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90975 33.0 33.0 34.0 32.0 34.0 2 32.799 33.0 33.0 34.0 32.0 34.0 3 32.98475 34.0 33.0 34.0 32.0 34.0 4 32.971 34.0 33.0 34.0 32.0 34.0 5 32.9095 34.0 33.0 34.0 32.0 34.0 6 37.11525 38.0 38.0 38.0 37.0 38.0 7 37.16725 38.0 38.0 38.0 37.0 38.0 8 37.19 38.0 38.0 38.0 37.0 38.0 9 37.1535 38.0 38.0 38.0 37.0 38.0 10-14 37.0475 38.0 38.0 38.0 36.4 38.0 15-19 37.1043 38.0 38.0 38.0 36.6 38.0 20-24 36.7642 38.0 38.0 38.0 35.4 38.0 25-29 37.055350000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.095150000000004 38.0 38.0 38.0 36.6 38.0 35-39 37.028499999999994 38.0 38.0 38.0 36.4 38.0 40-44 36.879000000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.77065 38.0 38.0 38.0 35.6 38.0 50-54 36.89639999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.92605 38.0 38.0 38.0 36.0 38.0 60-64 36.754 38.0 38.0 38.0 35.4 38.0 65-69 36.79205 38.0 38.0 38.0 35.8 38.0 70-74 36.765299999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.6338 38.0 38.0 38.0 34.8 38.0 80-84 36.477999999999994 38.0 38.0 38.0 34.2 38.0 85-89 36.508449999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.43325 38.0 38.0 38.0 34.0 38.0 95-99 36.33194999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.0793 38.0 37.4 38.0 33.2 38.0 105-109 35.819849999999995 38.0 37.0 38.0 32.2 38.0 110-114 35.727199999999996 38.0 37.0 38.0 31.4 38.0 115-119 35.461200000000005 38.0 36.8 38.0 31.0 38.0 120-124 35.3063 38.0 36.2 38.0 31.0 38.0 125-129 34.7296 38.0 35.8 38.0 27.6 38.0 130-134 34.4111 38.0 35.4 38.0 26.0 38.0 135-139 33.712250000000004 38.0 33.6 38.0 22.2 38.0 140-144 32.40875 38.0 32.6 38.0 14.0 38.0 145-149 31.446549999999995 38.0 31.8 38.0 8.4 38.0 150-151 24.849 31.0 15.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 3.0 5 0.0 6 3.0 7 1.0 8 0.0 9 1.0 10 3.0 11 4.0 12 2.0 13 1.0 14 4.0 15 6.0 16 1.0 17 6.0 18 3.0 19 9.0 20 6.0 21 7.0 22 3.0 23 9.0 24 19.0 25 22.0 26 24.0 27 25.0 28 33.0 29 38.0 30 62.0 31 78.0 32 82.0 33 108.0 34 186.0 35 339.0 36 814.0 37 2094.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.225 19.45 13.8 27.525 2 25.575 26.125 32.074999999999996 16.225 3 19.650000000000002 28.575 31.674999999999997 20.1 4 25.4 33.85 22.625 18.125 5 24.4 35.475 23.225 16.900000000000002 6 19.75 38.375 22.75 19.125 7 19.675 19.5 39.900000000000006 20.925 8 21.55 25.124999999999996 27.425 25.900000000000002 9 21.224999999999998 26.974999999999998 27.675 24.125 10-14 22.89 29.189999999999998 26.384999999999998 21.535 15-19 23.044999999999998 28.060000000000002 28.02 20.875 20-24 22.905 27.994999999999997 28.255000000000003 20.845 25-29 22.915 28.07 28.13 20.885 30-34 23.535 28.02 27.79 20.655 35-39 22.919999999999998 27.92 28.544999999999998 20.615 40-44 22.58 28.585 27.965 20.87 45-49 23.345 28.194999999999997 27.634999999999998 20.825 50-54 23.09 27.985 27.495000000000005 21.43 55-59 22.925 27.83 28.16 21.085 60-64 23.25 26.865 28.560000000000002 21.325 65-69 23.49 27.37 27.715 21.425 70-74 23.13 27.245 28.110000000000003 21.515 75-79 23.355 27.415 28.015 21.215 80-84 23.47 27.400000000000002 27.625 21.505 85-89 23.54 27.935 27.889999999999997 20.635 90-94 23.625 27.92 27.589999999999996 20.865000000000002 95-99 22.939999999999998 28.38 27.675 21.005 100-104 23.655 27.779999999999998 27.57 20.995 105-109 23.95 27.43 27.925 20.695 110-114 24.12 27.800000000000004 27.48 20.599999999999998 115-119 24.66 28.375 27.095000000000002 19.869999999999997 120-124 24.404999999999998 28.505000000000003 27.08 20.01 125-129 24.45 27.915 27.37 20.265 130-134 24.865000000000002 27.315 27.73 20.09 135-139 24.94 27.12 27.97 19.97 140-144 25.505 27.595 26.974999999999998 19.925 145-149 25.85 27.82 27.045 19.285 150-151 26.544136034008503 26.85671417854464 26.744186046511626 19.854963740935233 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.0 25 4.0 26 6.5 27 7.0 28 10.0 29 12.5 30 16.0 31 26.5 32 34.5 33 37.0 34 49.0 35 61.5 36 77.0 37 111.0 38 135.5 39 158.0 40 186.5 41 201.5 42 243.5 43 264.5 44 246.5 45 258.5 46 260.5 47 242.0 48 234.0 49 222.0 50 182.0 51 148.0 52 125.0 53 100.0 54 88.5 55 72.5 56 48.5 57 37.0 58 29.5 59 20.0 60 13.5 61 6.5 62 4.5 63 3.5 64 2.0 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69765066394281 96.625 2 0.9448416751787538 1.8499999999999999 3 0.15321756894790603 0.44999999999999996 4 0.10214504596527069 0.4 5 0.02553626149131767 0.125 6 0.05107252298263534 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02553626149131767 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.925 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.9625 0.0 0.0 0.0 0.0 122-123 5.3875 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.1625 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.875 0.0 0.0 0.0 0.0 134-135 8.475 0.0 0.0 0.0 0.0 136-137 9.0625 0.0 0.0 0.0 0.0 138-139 9.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076550315 18.125 25-29 >>END_MODULE Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra Read 903061 spots for SRR7171100.sra Written 903061 spots for SRR7171100.sra Read 903055 spots for SRR7171100.sra Written 903055 spots for SRR7171100.sra SRR ids: ['SRR7171100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mwn894ax SRR7171100.sra spots: 18061106 blocks: [[1, 903055], [903056, 1806110], [1806111, 2709165], [2709166, 3612220], [3612221, 4515275], [4515276, 5418330], [5418331, 6321385], [6321386, 7224440], [7224441, 8127495], [8127496, 9030550], [9030551, 9933605], [9933606, 10836660], [10836661, 11739715], [11739716, 12642770], [12642771, 13545825], [13545826, 14448880], [14448881, 15351935], [15351936, 16254990], [16254991, 17158045], [17158046, 18061106]] SRR7171100 file size 6098615 SRR7171100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171100 SRR7171100_1.fastq SRR7171100_2.fastq Input file: SRR7171100_1.fastq Paired file: SRR7171100_2.fastq trimmed: SRR7171100-trimmed-pair1.fastq, SRR7171100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:36:20 2025 >> started Fri Feb 14 03:36:40 2025 >> done (19.990s) 18061106 read pairs processed; of these: 17913 ( 0.10%) short read pairs filtered out after trimming by size control 28630 ( 0.16%) empty read pairs filtered out after trimming by size control 18014563 (99.74%) read pairs available; of these: 11106597 (61.65%) trimmed read pairs available after processing 6907966 (38.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 5 0.00% 21 14 0.00% 22 7 0.00% 23 7 0.00% 24 7 0.00% 25 4 0.00% 26 9 0.00% 27 9 0.00% 28 6 0.00% 29 18 0.00% 30 19 0.00% 31 18 0.00% 32 9 0.00% 33 19 0.00% 34 16 0.00% 35 14 0.00% 36 25 0.00% 37 26 0.00% 38 26 0.00% 39 36 0.00% 40 38 0.00% 41 45 0.00% 42 54 0.00% 43 47 0.00% 44 62 0.00% 45 53 0.00% 46 72 0.00% 47 90 0.00% 48 102 0.00% 49 131 0.00% 50 146 0.00% 51 146 0.00% 52 169 0.00% 53 163 0.00% 54 188 0.00% 55 216 0.00% 56 254 0.00% 57 274 0.00% 58 337 0.00% 59 325 0.00% 60 446 0.00% 61 502 0.00% 62 573 0.00% 63 606 0.00% 64 681 0.00% 65 725 0.00% 66 812 0.00% 67 902 0.01% 68 985 0.01% 69 1172 0.01% 70 1329 0.01% 71 1638 0.01% 72 1845 0.01% 73 2109 0.01% 74 2337 0.01% 75 2806 0.02% 76 3787 0.02% 77 3612 0.02% 78 3420 0.02% 79 3731 0.02% 80 4073 0.02% 81 4751 0.03% 82 5494 0.03% 83 6222 0.03% 84 7612 0.04% 85 8650 0.05% 86 9148 0.05% 87 9754 0.05% 88 10546 0.06% 89 10991 0.06% 90 11868 0.07% 91 13246 0.07% 92 13858 0.08% 93 15806 0.09% 94 16577 0.09% 95 18127 0.10% 96 18640 0.10% 97 19768 0.11% 98 19858 0.11% 99 21279 0.12% 100 22637 0.13% 101 23899 0.13% 102 25430 0.14% 103 27057 0.15% 104 28304 0.16% 105 30079 0.17% 106 31392 0.17% 107 32121 0.18% 108 32845 0.18% 109 33965 0.19% 110 34829 0.19% 111 36689 0.20% 112 38437 0.21% 113 40389 0.22% 114 42374 0.24% 115 44199 0.25% 116 45826 0.25% 117 46663 0.26% 118 47826 0.27% 119 48113 0.27% 120 49713 0.28% 121 51658 0.29% 122 53492 0.30% 123 55862 0.31% 124 58467 0.32% 125 60491 0.34% 126 63165 0.35% 127 65359 0.36% 128 67332 0.37% 129 69268 0.38% 130 71497 0.40% 131 74394 0.41% 132 77731 0.43% 133 82623 0.46% 134 87799 0.49% 135 94474 0.52% 136 100005 0.56% 137 106942 0.59% 138 114272 0.63% 139 123146 0.68% 140 131935 0.73% 141 144987 0.80% 142 160198 0.89% 143 180562 1.00% 144 209404 1.16% 145 247910 1.38% 146 305496 1.70% 147 405232 2.25% 148 620026 3.44% 149 1207119 6.70% 150 4969455 27.59% 151 6907966 38.35% 18014563 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=13 prefix-density=0.69 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=26.26 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=45.93 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.8 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7171100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:37:32 Started mapping on | Feb 14 03:37:33 Finished on | Feb 14 03:39:40 Mapping speed, Million of reads per hour | 510.65 Number of input reads | 18014563 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16905874 Uniquely mapped reads % | 93.85% Average mapped length | 290.76 Number of splices: Total | 16652872 Number of splices: Annotated (sjdb) | 16293768 Number of splices: GT/AG | 16347982 Number of splices: GC/AG | 242326 Number of splices: AT/AC | 10729 Number of splices: Non-canonical | 51835 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415018 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 46185 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712504 712504 712504 N_multimapping 415018 415018 415018 N_noFeature 601028 16578721 699319 N_ambiguous 348999 1033 119467 UnstrandedReadsAssigned:15955847 PositiveStrandReadsAssigned:326120 NegativeStrandReadsAssigned:16087088 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171100-trimmed-pair1.fastq SRR7171100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,014,563 reads, 16,016,884 reads pseudoaligned [quant] estimated average fragment length: 230.482 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7171100.ke.tsv 34699 SRR7171100.se.tsv 87100 total ==> SRR7171100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.52 663 16.7955 Potri.005G024800.1.v4.1 1035 805.518 264 14.8492 Potri.004G059700.1.v4.1 961 731.542 29 1.79611 Potri.007G009000.2.v4.1 1416 1186.52 0 0 Potri.003G141000.2.v4.1 2943 2713.52 760.18 12.6928 Potri.016G087400.1.v4.1 270 87.3381 1277 662.46 Potri.015G069301.1.v4.1 564 338.584 0 0 Potri.010G195200.1.v4.1 1773 1543.52 56 1.6438 Potri.012G127500.1.v4.1 977 747.523 161 9.7583 ==> SRR7171100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1016 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 566 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 95 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7171100 completed mapping pipeline successfully