Starting /dee2/code/volunteer_pipeline.sh SRR7171101 current disk space = 3087016800256 free memory = 1582421548 SRR7171101 SRAfilesize a12f794cc6ac6087be2fc895c37d57cf SRR7171101.sra SRR7171101.sra file validated SRR7171101 is paired end SRR7171101 is conventional basespace SRR7171101 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.85125 30.0 18.0 32.0 18.0 33.0 2 31.35675 33.0 31.0 33.0 28.0 33.0 3 31.9615 33.0 31.0 33.0 29.0 33.0 4 32.2425 33.0 33.0 33.0 31.0 34.0 5 32.83775 33.0 33.0 34.0 31.0 34.0 6 36.9265 38.0 37.0 38.0 35.0 38.0 7 37.12525 38.0 38.0 38.0 36.0 38.0 8 37.4405 38.0 38.0 38.0 37.0 38.0 9 36.10225 38.0 38.0 38.0 31.0 38.0 10-14 37.380050000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.52035 38.0 38.0 38.0 38.0 38.0 20-24 37.5798 38.0 38.0 38.0 38.0 38.0 25-29 37.55215 38.0 38.0 38.0 38.0 38.0 30-34 37.55405 38.0 38.0 38.0 38.0 38.0 35-39 37.4995 38.0 38.0 38.0 38.0 38.0 40-44 37.4574 38.0 38.0 38.0 37.8 38.0 45-49 37.280649999999994 38.0 38.0 38.0 37.0 38.0 50-54 35.9486 38.0 35.6 38.0 30.8 38.0 55-59 37.23774999999999 38.0 38.0 38.0 36.6 38.0 60-64 37.1971 38.0 38.0 38.0 36.4 38.0 65-69 37.1736 38.0 38.0 38.0 36.8 38.0 70-74 37.1607 38.0 38.0 38.0 36.6 38.0 75-79 37.06825 38.0 38.0 38.0 36.0 38.0 80-84 36.4994 38.0 38.0 38.0 33.8 38.0 85-89 36.849599999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.776 38.0 38.0 38.0 35.0 38.0 95-99 36.71065 38.0 38.0 38.0 34.8 38.0 100-104 36.634249999999994 38.0 38.0 38.0 34.6 38.0 105-109 36.70005 38.0 38.0 38.0 34.6 38.0 110-114 36.245799999999996 38.0 37.6 38.0 34.0 38.0 115-119 36.08725 38.0 37.0 38.0 33.0 38.0 120-124 35.90715 38.0 36.8 38.0 31.8 38.0 125-129 35.60665 38.0 36.6 38.0 31.2 38.0 130-134 34.18795 38.0 33.8 38.0 24.4 38.0 135-139 34.8035 38.0 35.4 38.0 28.6 38.0 140-144 34.2183 38.0 34.4 38.0 25.8 38.0 145-149 33.5007 38.0 33.0 38.0 21.6 38.0 150-151 27.754875 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 2.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 5.0 20 0.0 21 5.0 22 4.0 23 5.0 24 12.0 25 11.0 26 11.0 27 19.0 28 21.0 29 21.0 30 36.0 31 48.0 32 79.0 33 113.0 34 157.0 35 347.0 36 927.0 37 2166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.306889352818374 12.056367432150312 17.249478079331944 38.38726513569937 2 19.975 18.775 36.15 25.1 3 19.400000000000002 23.875 25.35 31.374999999999996 4 22.650000000000002 33.800000000000004 21.825 21.725 5 21.727158948685858 35.5694618272841 24.405506883604506 18.29787234042553 6 17.5 35.85 27.500000000000004 19.15 7 14.75 20.225 45.7 19.325 8 18.825 23.375 30.075000000000003 27.725 9 17.625 25.2 31.974999999999998 25.2 10-14 19.875 29.654999999999998 26.76 23.71 15-19 19.31 28.655 28.1 23.935000000000002 20-24 18.93 29.115000000000002 28.705000000000002 23.25 25-29 19.405 28.765 27.884999999999998 23.945 30-34 18.945 29.485 28.22 23.35 35-39 20.195 28.935 27.639999999999997 23.23 40-44 20.011000550027504 29.27646382319116 27.49137456872844 23.221161058052903 45-49 19.38 29.054999999999996 27.744999999999997 23.82 50-54 19.6 29.365000000000002 28.035 23.0 55-59 19.81 28.610000000000003 28.455000000000002 23.125 60-64 19.814999999999998 28.58 28.38 23.225 65-69 19.939999999999998 28.860000000000003 27.685 23.515 70-74 20.485 28.825 27.834999999999997 22.855 75-79 19.545 28.73 27.975 23.75 80-84 19.905 28.525 27.845 23.724999999999998 85-89 19.99 28.810000000000002 27.865000000000002 23.335 90-94 20.380000000000003 28.24 27.575 23.805 95-99 19.99 27.939999999999998 28.315 23.755000000000003 100-104 20.580000000000002 29.01 27.055 23.355 105-109 20.995 28.375 27.775 22.855 110-114 20.44 28.175 28.01 23.375 115-119 20.285 28.925 27.815 22.975 120-124 20.34 28.33 27.415 23.915 125-129 20.54 28.765 27.755000000000003 22.939999999999998 130-134 20.5 28.64 27.384999999999998 23.474999999999998 135-139 20.544999999999998 28.23 27.74 23.485 140-144 20.855 28.82 27.125 23.200000000000003 145-149 20.815 28.57 27.200000000000003 23.415 150-151 19.7871008140263 28.453350031308705 28.10269254852849 23.656856606136508 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.5 21 3.5 22 3.0 23 2.5 24 4.5 25 5.5 26 5.5 27 8.0 28 10.0 29 14.5 30 27.0 31 34.0 32 37.0 33 59.5 34 78.5 35 88.5 36 99.0 37 113.5 38 134.5 39 166.5 40 191.0 41 237.5 42 261.0 43 261.0 44 276.0 45 251.0 46 234.5 47 230.5 48 221.5 49 197.5 50 167.5 51 136.0 52 104.5 53 81.5 54 59.0 55 51.5 56 42.0 57 27.5 58 21.0 59 14.5 60 7.5 61 5.0 62 4.5 63 2.0 64 3.0 65 4.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5033979360684621 1.0 3 0.05033979360684621 0.15 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.625 0.0 0.0 0.0 0.0 136-137 3.9250000000000003 0.0 0.0 0.0 0.0 138-139 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATCT 10 0.0068396386 144.9375 3 >>END_MODULE SRR7171101 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43875 33.0 33.0 34.0 31.0 34.0 2 30.50625 33.0 31.0 34.0 18.0 34.0 3 32.18525 33.0 32.0 34.0 27.0 34.0 4 32.6465 33.0 33.0 34.0 32.0 34.0 5 32.85325 33.0 33.0 34.0 32.0 34.0 6 37.153 38.0 38.0 38.0 37.0 38.0 7 37.2625 38.0 38.0 38.0 37.0 38.0 8 37.317 38.0 38.0 38.0 37.0 38.0 9 37.29325 38.0 38.0 38.0 37.0 38.0 10-14 37.202000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.231100000000005 38.0 38.0 38.0 37.0 38.0 20-24 36.24035 38.0 37.6 38.0 32.2 38.0 25-29 37.0338 38.0 38.0 38.0 36.0 38.0 30-34 37.2191 38.0 38.0 38.0 37.0 38.0 35-39 37.24765 38.0 38.0 38.0 37.0 38.0 40-44 37.19125 38.0 38.0 38.0 37.0 38.0 45-49 36.509949999999996 38.0 37.8 38.0 34.0 38.0 50-54 37.0823 38.0 38.0 38.0 36.6 38.0 55-59 37.0574 38.0 38.0 38.0 36.0 38.0 60-64 36.1124 38.0 37.0 38.0 30.8 38.0 65-69 36.94585 38.0 38.0 38.0 36.0 38.0 70-74 36.914 38.0 38.0 38.0 36.0 38.0 75-79 36.92425 38.0 38.0 38.0 36.0 38.0 80-84 35.2642 38.0 35.2 38.0 29.4 38.0 85-89 36.53995 38.0 37.8 38.0 34.6 38.0 90-94 36.665000000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.5543 38.0 38.0 38.0 34.8 38.0 100-104 36.3584 38.0 38.0 38.0 34.0 38.0 105-109 35.5276 38.0 37.0 38.0 29.8 38.0 110-114 34.34490000000001 38.0 34.0 38.0 25.0 38.0 115-119 35.7084 38.0 37.0 38.0 31.4 38.0 120-124 35.53445 38.0 36.6 38.0 31.0 38.0 125-129 35.26950000000001 38.0 36.0 38.0 29.8 38.0 130-134 34.815250000000006 38.0 36.0 38.0 27.8 38.0 135-139 34.295899999999996 38.0 35.0 38.0 26.2 38.0 140-144 33.4802 38.0 33.0 38.0 20.8 38.0 145-149 32.620549999999994 38.0 33.0 38.0 13.2 38.0 150-151 26.26775 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 1.0 16 4.0 17 3.0 18 7.0 19 4.0 20 9.0 21 2.0 22 6.0 23 11.0 24 11.0 25 14.0 26 17.0 27 25.0 28 22.0 29 52.0 30 52.0 31 56.0 32 83.0 33 133.0 34 178.0 35 320.0 36 989.0 37 1981.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.800000000000004 17.5 20.849999999999998 28.849999999999998 2 25.650000000000002 23.125 34.55 16.675 3 22.55 26.424999999999997 30.25 20.775 4 23.799999999999997 33.85 24.15 18.2 5 24.099999999999998 35.825 23.425 16.650000000000002 6 19.475 37.925 23.35 19.25 7 18.275 18.35 43.25 20.125 8 20.225 25.85 27.375 26.55 9 22.55 25.474999999999998 28.925 23.05 10-14 22.84 28.93 25.935000000000002 22.295 15-19 22.835 27.860000000000003 28.77 20.535 20-24 22.57 28.305000000000003 27.765 21.36 25-29 22.63 28.994999999999997 28.09 20.285 30-34 22.395 28.33 28.585 20.69 35-39 22.685 28.355000000000004 28.285 20.674999999999997 40-44 22.564999999999998 28.305000000000003 28.299999999999997 20.830000000000002 45-49 22.5 29.315 28.000000000000004 20.185 50-54 22.689999999999998 28.21 28.68 20.419999999999998 55-59 22.7 28.67 28.015 20.615 60-64 22.98 27.705000000000002 28.01 21.305 65-69 22.805 28.08 28.634999999999998 20.48 70-74 23.235 28.694999999999997 27.455000000000002 20.615 75-79 22.720000000000002 28.46 28.325 20.495 80-84 23.445 28.225 27.825 20.505000000000003 85-89 23.119999999999997 28.46 27.52 20.9 90-94 23.849999999999998 27.82 27.950000000000003 20.380000000000003 95-99 22.67 28.285 28.28 20.765 100-104 23.41 27.955000000000002 28.09 20.544999999999998 105-109 23.59 27.485 28.544999999999998 20.380000000000003 110-114 23.54 27.839999999999996 28.13 20.49 115-119 23.18 28.58 28.060000000000002 20.18 120-124 23.189999999999998 28.294999999999998 28.525 19.99 125-129 23.22 28.050000000000004 28.384999999999998 20.345 130-134 24.09 28.03 27.595 20.285 135-139 23.06 27.575 28.794999999999998 20.57 140-144 23.68 27.805000000000003 28.52 19.994999999999997 145-149 24.04 28.07 27.505000000000003 20.385 150-151 24.32364729458918 28.2064128256513 27.59268537074148 19.877254509018037 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 5.0 23 4.5 24 2.5 25 2.0 26 5.0 27 9.0 28 11.0 29 15.5 30 20.5 31 24.5 32 32.0 33 43.0 34 54.0 35 74.5 36 102.0 37 123.5 38 141.0 39 182.5 40 211.0 41 228.5 42 251.0 43 260.5 44 275.5 45 278.5 46 261.0 47 249.5 48 225.0 49 179.0 50 139.5 51 110.0 52 101.5 53 90.0 54 75.0 55 59.0 56 40.5 57 28.5 58 21.0 59 17.0 60 12.5 61 8.0 62 5.0 63 5.5 64 4.5 65 1.5 66 0.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64806435394671 99.1 2 0.2513826043237808 0.5 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025138260432378077 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 1.9500000000000002 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.0999999999999996 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764513 spots for SRR7171101.sra Written 764513 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra Read 764507 spots for SRR7171101.sra Written 764507 spots for SRR7171101.sra SRR ids: ['SRR7171101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w_lvennd SRR7171101.sra spots: 15290146 blocks: [[1, 764507], [764508, 1529014], [1529015, 2293521], [2293522, 3058028], [3058029, 3822535], [3822536, 4587042], [4587043, 5351549], [5351550, 6116056], [6116057, 6880563], [6880564, 7645070], [7645071, 8409577], [8409578, 9174084], [9174085, 9938591], [9938592, 10703098], [10703099, 11467605], [11467606, 12232112], [12232113, 12996619], [12996620, 13761126], [13761127, 14525633], [14525634, 15290146]] SRR7171101 file size 5159628 SRR7171101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171101 SRR7171101_1.fastq SRR7171101_2.fastq Input file: SRR7171101_1.fastq Paired file: SRR7171101_2.fastq trimmed: SRR7171101-trimmed-pair1.fastq, SRR7171101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:50:55 2025 >> started Fri Feb 14 04:51:12 2025 >> done (17.124s) 15290146 read pairs processed; of these: 11541 ( 0.08%) short read pairs filtered out after trimming by size control 41854 ( 0.27%) empty read pairs filtered out after trimming by size control 15236751 (99.65%) read pairs available; of these: 8590602 (56.38%) trimmed read pairs available after processing 6646149 (43.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 15 0.00% 21 19 0.00% 22 18 0.00% 23 27 0.00% 24 23 0.00% 25 19 0.00% 26 18 0.00% 27 21 0.00% 28 16 0.00% 29 14 0.00% 30 18 0.00% 31 17 0.00% 32 22 0.00% 33 13 0.00% 34 13 0.00% 35 21 0.00% 36 26 0.00% 37 22 0.00% 38 23 0.00% 39 31 0.00% 40 25 0.00% 41 33 0.00% 42 31 0.00% 43 29 0.00% 44 29 0.00% 45 36 0.00% 46 41 0.00% 47 48 0.00% 48 43 0.00% 49 47 0.00% 50 54 0.00% 51 72 0.00% 52 73 0.00% 53 79 0.00% 54 92 0.00% 55 105 0.00% 56 119 0.00% 57 127 0.00% 58 153 0.00% 59 170 0.00% 60 189 0.00% 61 261 0.00% 62 246 0.00% 63 295 0.00% 64 283 0.00% 65 311 0.00% 66 333 0.00% 67 330 0.00% 68 408 0.00% 69 462 0.00% 70 571 0.00% 71 635 0.00% 72 699 0.00% 73 801 0.01% 74 887 0.01% 75 982 0.01% 76 1231 0.01% 77 1385 0.01% 78 1354 0.01% 79 1506 0.01% 80 1600 0.01% 81 1884 0.01% 82 2130 0.01% 83 2473 0.02% 84 3041 0.02% 85 3676 0.02% 86 3909 0.03% 87 4183 0.03% 88 4521 0.03% 89 4801 0.03% 90 5244 0.03% 91 5419 0.04% 92 5830 0.04% 93 6145 0.04% 94 6408 0.04% 95 6883 0.05% 96 7129 0.05% 97 7505 0.05% 98 7782 0.05% 99 8236 0.05% 100 8725 0.06% 101 8923 0.06% 102 9724 0.06% 103 10082 0.07% 104 11061 0.07% 105 11259 0.07% 106 11886 0.08% 107 12562 0.08% 108 12977 0.09% 109 13503 0.09% 110 14491 0.10% 111 14639 0.10% 112 15433 0.10% 113 16181 0.11% 114 16835 0.11% 115 18072 0.12% 116 18725 0.12% 117 19538 0.13% 118 20474 0.13% 119 21126 0.14% 120 22572 0.15% 121 23662 0.16% 122 24573 0.16% 123 25953 0.17% 124 27792 0.18% 125 29050 0.19% 126 30552 0.20% 127 32134 0.21% 128 34233 0.22% 129 36340 0.24% 130 38422 0.25% 131 40827 0.27% 132 43559 0.29% 133 47093 0.31% 134 50751 0.33% 135 55523 0.36% 136 60766 0.40% 137 66885 0.44% 138 73424 0.48% 139 81075 0.53% 140 89806 0.59% 141 100912 0.66% 142 114020 0.75% 143 130190 0.85% 144 153087 1.00% 145 184280 1.21% 146 235863 1.55% 147 322422 2.12% 148 494296 3.24% 149 997176 6.54% 150 4523354 29.69% 151 6646149 43.62% 15236751 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=19 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=11.29 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=3.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=0.48 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=11.18 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7171101 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:52:01 Started mapping on | Feb 14 04:52:02 Finished on | Feb 14 04:53:40 Mapping speed, Million of reads per hour | 559.72 Number of input reads | 15236751 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14050528 Uniquely mapped reads % | 92.21% Average mapped length | 294.42 Number of splices: Total | 13732220 Number of splices: Annotated (sjdb) | 13419228 Number of splices: GT/AG | 13481263 Number of splices: GC/AG | 199614 Number of splices: AT/AC | 8402 Number of splices: Non-canonical | 42941 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411722 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 75037 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 788761 788761 788761 N_multimapping 411722 411722 411722 N_noFeature 615960 13830588 686463 N_ambiguous 248185 1139 98035 UnstrandedReadsAssigned:13186383 PositiveStrandReadsAssigned:218801 NegativeStrandReadsAssigned:13266030 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7171101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171101-trimmed-pair1.fastq SRR7171101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,236,751 reads, 13,232,729 reads pseudoaligned [quant] estimated average fragment length: 259.443 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7171101.ke.tsv 34699 SRR7171101.se.tsv 87100 total ==> SRR7171101.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.56 1317 49.0733 Potri.005G024800.1.v4.1 1035 776.557 225 18.9964 Potri.004G059700.1.v4.1 961 702.578 21 1.95969 Potri.007G009000.2.v4.1 1416 1157.56 0 0 Potri.003G141000.2.v4.1 2943 2684.56 659.726 16.1122 Potri.016G087400.1.v4.1 270 74.5179 775 681.874 Potri.015G069301.1.v4.1 564 312.511 0 0 Potri.010G195200.1.v4.1 1773 1514.56 123 5.32454 Potri.012G127500.1.v4.1 977 718.557 94 8.57688 ==> SRR7171101.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 945 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7171101 completed mapping pipeline successfully