Starting /dee2/code/volunteer_pipeline.sh SRR7171102 current disk space = 3086716653568 free memory = 1579995800 SRR7171102 SRAfilesize 796dec5b2ff7fb0f11f1b339482ad51c SRR7171102.sra SRR7171102.sra file validated SRR7171102 is paired end SRR7171102 is conventional basespace SRR7171102 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171102_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.9615 25.0 18.0 32.0 18.0 33.0 2 23.83825 25.0 18.0 29.0 18.0 33.0 3 28.037 29.0 27.0 31.0 18.0 33.0 4 30.73025 31.0 30.0 33.0 27.0 33.0 5 31.497 33.0 31.0 33.0 29.0 33.0 6 35.299 37.0 35.0 38.0 31.0 38.0 7 36.02275 38.0 36.0 38.0 33.0 38.0 8 36.615 38.0 37.0 38.0 34.0 38.0 9 37.10625 38.0 38.0 38.0 36.0 38.0 10-14 37.2442 38.0 38.0 38.0 36.2 38.0 15-19 37.37285 38.0 38.0 38.0 37.0 38.0 20-24 37.423 38.0 38.0 38.0 37.0 38.0 25-29 37.160199999999996 38.0 38.0 38.0 35.8 38.0 30-34 37.17915000000001 38.0 38.0 38.0 36.2 38.0 35-39 36.1555 38.0 36.8 38.0 31.0 38.0 40-44 37.142399999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.694900000000004 38.0 37.8 38.0 34.2 38.0 50-54 37.06595 38.0 38.0 38.0 35.8 38.0 55-59 37.041399999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.4248 38.0 37.4 38.0 32.6 38.0 65-69 36.141000000000005 38.0 36.8 38.0 30.2 38.0 70-74 36.404 38.0 37.6 38.0 33.2 38.0 75-79 36.69404999999999 38.0 38.0 38.0 34.8 38.0 80-84 36.6333 38.0 38.0 38.0 34.4 38.0 85-89 35.69175 38.0 36.8 38.0 30.0 38.0 90-94 35.7993 38.0 36.4 38.0 31.4 38.0 95-99 34.4726 37.8 34.2 38.0 25.4 38.0 100-104 35.987550000000006 38.0 37.0 38.0 32.2 38.0 105-109 35.87635 38.0 37.0 38.0 32.0 38.0 110-114 34.39665 38.0 34.4 38.0 25.2 38.0 115-119 32.61065 36.2 29.2 38.0 23.4 38.0 120-124 35.172399999999996 38.0 36.0 38.0 28.6 38.0 125-129 34.98865 38.0 35.6 38.0 28.4 38.0 130-134 33.4294 37.8 32.4 38.0 21.4 38.0 135-139 33.9737 38.0 33.0 38.0 24.2 38.0 140-144 33.334799999999994 38.0 33.0 38.0 20.4 38.0 145-149 30.0217 36.0 27.2 38.0 8.0 38.0 150-151 25.82475 33.5 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 0.0 14 3.0 15 3.0 16 2.0 17 1.0 18 3.0 19 2.0 20 7.0 21 6.0 22 9.0 23 6.0 24 8.0 25 18.0 26 19.0 27 43.0 28 32.0 29 61.0 30 65.0 31 90.0 32 138.0 33 203.0 34 294.0 35 653.0 36 1508.0 37 820.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.80523479599692 10.469591993841416 8.160123171670516 34.565050038491144 2 18.875 15.45 34.2 31.474999999999998 3 18.079519879969993 22.43060765191298 31.15778944736184 28.33208302075519 4 20.925 31.8 24.975 22.3 5 21.280320080020005 34.28357089272318 26.156539134783696 18.27956989247312 6 18.2 34.975 25.174999999999997 21.65 7 13.900000000000002 22.875 45.975 17.25 8 15.675 23.799999999999997 31.825 28.7 9 16.900000000000002 23.25 33.475 26.375 10-14 19.57 29.375 27.779999999999998 23.275000000000002 15-19 20.34 28.57 28.515 22.575 20-24 20.064999999999998 28.37 28.075 23.49 25-29 19.470000000000002 28.970000000000002 28.16 23.400000000000002 30-34 19.285 28.720000000000002 28.53 23.465 35-39 19.59 28.544999999999998 27.935 23.93 40-44 19.665 28.49 27.77 24.075 45-49 19.925 28.95 27.61 23.515 50-54 19.925 28.865000000000002 27.77 23.44 55-59 19.34 29.13 28.199999999999996 23.330000000000002 60-64 19.91 28.88 27.775 23.435 65-69 19.835 29.04 27.77 23.355 70-74 20.01 28.27 27.48 24.240000000000002 75-79 19.855 28.46 27.779999999999998 23.905 80-84 19.875993799689983 28.40642032101605 27.486374318715935 24.23121156057803 85-89 20.276013800690034 28.676433821691084 27.396369818490925 23.651182559127957 90-94 19.97 28.28 28.225 23.525 95-99 20.39 28.465 27.735 23.41 100-104 20.62 28.58 27.54 23.26 105-109 20.369999999999997 27.905 27.800000000000004 23.925 110-114 20.495 28.93 27.445000000000004 23.13 115-119 20.78 28.64 27.189999999999998 23.39 120-124 20.69 28.125 27.575 23.61 125-129 20.265 28.299999999999997 27.534999999999997 23.9 130-134 20.77 28.435 26.935 23.86 135-139 21.05 28.470000000000002 26.985 23.494999999999997 140-144 20.935000000000002 27.735 27.485 23.845 145-149 20.405 28.325 26.805 24.465 150-151 20.170063773915217 28.79829936226085 26.53495060647743 24.496686257346507 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 6.5 25 7.5 26 7.0 27 10.5 28 9.5 29 13.5 30 24.0 31 34.5 32 41.5 33 52.5 34 73.0 35 91.5 36 103.0 37 120.5 38 145.0 39 165.0 40 186.5 41 199.5 42 221.5 43 251.0 44 254.0 45 248.5 46 249.0 47 235.0 48 214.5 49 188.5 50 156.5 51 132.5 52 122.5 53 108.5 54 82.0 55 60.0 56 48.5 57 35.5 58 23.5 59 22.5 60 16.5 61 9.0 62 6.0 63 4.0 64 2.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.6813020439061317 1.35 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.225 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.9625 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.362500000000001 0.0 0.0 0.0 0.0 134-135 7.075 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCGGG 10 0.006832588 144.9875 8 >>END_MODULE SRR7171102 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171102_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8675 33.0 33.0 34.0 32.0 34.0 2 32.802 33.0 33.0 34.0 32.0 34.0 3 32.93575 34.0 33.0 34.0 32.0 34.0 4 32.964 34.0 33.0 34.0 32.0 34.0 5 32.89475 34.0 33.0 34.0 32.0 34.0 6 37.0825 38.0 38.0 38.0 37.0 38.0 7 37.10425 38.0 38.0 38.0 37.0 38.0 8 37.12775 38.0 38.0 38.0 37.0 38.0 9 37.089 38.0 38.0 38.0 37.0 38.0 10-14 37.0295 38.0 38.0 38.0 36.8 38.0 15-19 37.00935 38.0 38.0 38.0 36.8 38.0 20-24 36.54025 38.0 37.8 38.0 34.2 38.0 25-29 36.91785 38.0 38.0 38.0 36.4 38.0 30-34 36.98795 38.0 38.0 38.0 36.8 38.0 35-39 36.935500000000005 38.0 38.0 38.0 36.8 38.0 40-44 36.81305 38.0 38.0 38.0 36.0 38.0 45-49 36.65990000000001 38.0 38.0 38.0 35.4 38.0 50-54 36.7466 38.0 38.0 38.0 36.0 38.0 55-59 36.786649999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.72324999999999 38.0 38.0 38.0 35.6 38.0 65-69 36.68920000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.650200000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.5007 38.0 38.0 38.0 34.8 38.0 80-84 36.414849999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.446099999999994 38.0 38.0 38.0 34.6 38.0 90-94 36.311 38.0 38.0 38.0 34.0 38.0 95-99 36.213300000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.007 38.0 37.6 38.0 33.4 38.0 105-109 35.82485 38.0 37.2 38.0 32.2 38.0 110-114 35.637649999999994 38.0 37.0 38.0 31.4 38.0 115-119 35.35935 38.0 37.0 38.0 31.0 38.0 120-124 35.230149999999995 38.0 36.6 38.0 30.6 38.0 125-129 34.6848 38.0 36.0 38.0 27.2 38.0 130-134 34.4083 38.0 35.8 38.0 26.2 38.0 135-139 33.64485 38.0 33.8 38.0 21.2 38.0 140-144 32.5904 38.0 32.6 38.0 14.4 38.0 145-149 31.58225 38.0 32.8 38.0 8.4 38.0 150-151 25.211375 32.5 16.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 3.0 5 4.0 6 3.0 7 3.0 8 1.0 9 2.0 10 2.0 11 0.0 12 5.0 13 3.0 14 3.0 15 3.0 16 8.0 17 4.0 18 3.0 19 7.0 20 3.0 21 7.0 22 4.0 23 8.0 24 14.0 25 15.0 26 34.0 27 25.0 28 40.0 29 40.0 30 55.0 31 59.0 32 79.0 33 109.0 34 193.0 35 300.0 36 747.0 37 2200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.4 19.55 9.075 21.975 2 24.55 23.425 32.975 19.05 3 20.549999999999997 26.075 33.525 19.85 4 24.55 34.125 22.825 18.5 5 23.125 38.275 22.575 16.025 6 20.4 38.15 23.200000000000003 18.25 7 19.1 20.150000000000002 40.025 20.724999999999998 8 20.375 24.7 29.049999999999997 25.874999999999996 9 21.725 24.6 28.425 25.25 10-14 23.125 29.195 26.275 21.404999999999998 15-19 23.305 28.43 27.689999999999998 20.575 20-24 22.99 29.25 27.450000000000003 20.31 25-29 23.195 28.51 27.725 20.57 30-34 22.95 28.285 28.225 20.54 35-39 22.66 28.515 28.08 20.745 40-44 23.73 28.21 27.755000000000003 20.305 45-49 23.225 28.18 28.075 20.52 50-54 23.29 28.225 28.115000000000002 20.369999999999997 55-59 23.13 27.91 28.189999999999998 20.77 60-64 23.43 28.025 27.99 20.555 65-69 22.66 27.6 28.89 20.849999999999998 70-74 23.095 27.534999999999997 28.275 21.095 75-79 23.74 27.93 27.52 20.810000000000002 80-84 23.685000000000002 27.97 27.639999999999997 20.705000000000002 85-89 23.46 27.860000000000003 28.22 20.46 90-94 23.875 28.075 27.725 20.325 95-99 24.215 28.105000000000004 27.755000000000003 19.925 100-104 23.77 27.994999999999997 27.555000000000003 20.68 105-109 23.935000000000002 28.27 27.57 20.225 110-114 24.44 28.025 27.675 19.86 115-119 24.09 28.835 27.029999999999998 20.044999999999998 120-124 24.81 27.884999999999998 27.63 19.675 125-129 25.03 28.18 27.084999999999997 19.705000000000002 130-134 25.840000000000003 27.1 27.169999999999998 19.89 135-139 25.019999999999996 28.43 27.175 19.375 140-144 25.465 28.155 27.07 19.31 145-149 26.125 28.17 26.685 19.02 150-151 26.92259597349006 27.710391396773794 26.27235213204952 19.094660497686633 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.5 24 5.0 25 4.5 26 5.5 27 7.0 28 12.5 29 11.5 30 17.5 31 30.5 32 35.0 33 39.5 34 60.0 35 76.5 36 77.5 37 111.5 38 138.0 39 152.5 40 176.5 41 199.5 42 249.0 43 275.0 44 275.0 45 272.5 46 255.0 47 238.0 48 218.5 49 205.0 50 171.0 51 129.0 52 113.0 53 98.5 54 86.0 55 69.5 56 50.5 57 34.0 58 26.5 59 21.5 60 13.5 61 8.0 62 5.5 63 5.5 64 3.5 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.6568974229408793 1.3 3 0.07579585649317837 0.22499999999999998 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025265285497726126 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6000000000000001 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.6625 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.2 0.0 0.0 0.0 0.0 128-129 5.8625 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 7.175000000000001 0.0 0.0 0.0 0.0 134-135 7.875 0.0 0.0 0.0 0.0 136-137 8.5375 0.0 0.0 0.0 0.0 138-139 9.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755514 spots for SRR7171102.sra Written 755514 spots for SRR7171102.sra Read 755530 spots for SRR7171102.sra Written 755530 spots for SRR7171102.sra SRR ids: ['SRR7171102.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a7_fvgxa SRR7171102.sra spots: 15110296 blocks: [[1, 755514], [755515, 1511028], [1511029, 2266542], [2266543, 3022056], [3022057, 3777570], [3777571, 4533084], [4533085, 5288598], [5288599, 6044112], [6044113, 6799626], [6799627, 7555140], [7555141, 8310654], [8310655, 9066168], [9066169, 9821682], [9821683, 10577196], [10577197, 11332710], [11332711, 12088224], [12088225, 12843738], [12843739, 13599252], [13599253, 14354766], [14354767, 15110296]] SRR7171102 file size 5098683 SRR7171102 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171102 SRR7171102_1.fastq SRR7171102_2.fastq Input file: SRR7171102_1.fastq Paired file: SRR7171102_2.fastq trimmed: SRR7171102-trimmed-pair1.fastq, SRR7171102-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:59:36 2025 >> started Fri Feb 14 04:59:53 2025 >> done (16.498s) 15110296 read pairs processed; of these: 17931 ( 0.12%) short read pairs filtered out after trimming by size control 20511 ( 0.14%) empty read pairs filtered out after trimming by size control 15071854 (99.75%) read pairs available; of these: 9236421 (61.28%) trimmed read pairs available after processing 5835433 (38.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 7 0.00% 21 8 0.00% 22 17 0.00% 23 12 0.00% 24 24 0.00% 25 24 0.00% 26 19 0.00% 27 25 0.00% 28 21 0.00% 29 21 0.00% 30 20 0.00% 31 26 0.00% 32 21 0.00% 33 22 0.00% 34 20 0.00% 35 19 0.00% 36 12 0.00% 37 38 0.00% 38 33 0.00% 39 35 0.00% 40 37 0.00% 41 41 0.00% 42 44 0.00% 43 45 0.00% 44 56 0.00% 45 60 0.00% 46 62 0.00% 47 84 0.00% 48 69 0.00% 49 104 0.00% 50 109 0.00% 51 108 0.00% 52 121 0.00% 53 138 0.00% 54 118 0.00% 55 148 0.00% 56 161 0.00% 57 189 0.00% 58 211 0.00% 59 263 0.00% 60 323 0.00% 61 329 0.00% 62 365 0.00% 63 429 0.00% 64 405 0.00% 65 513 0.00% 66 537 0.00% 67 623 0.00% 68 645 0.00% 69 788 0.01% 70 989 0.01% 71 997 0.01% 72 1215 0.01% 73 1380 0.01% 74 1584 0.01% 75 1774 0.01% 76 1946 0.01% 77 2072 0.01% 78 2342 0.02% 79 2651 0.02% 80 2845 0.02% 81 3404 0.02% 82 3778 0.03% 83 4385 0.03% 84 5607 0.04% 85 6542 0.04% 86 7110 0.05% 87 7977 0.05% 88 8316 0.06% 89 8998 0.06% 90 9641 0.06% 91 10248 0.07% 92 10927 0.07% 93 11926 0.08% 94 12662 0.08% 95 13680 0.09% 96 14237 0.09% 97 14538 0.10% 98 15552 0.10% 99 16296 0.11% 100 17470 0.12% 101 18204 0.12% 102 19996 0.13% 103 21051 0.14% 104 22142 0.15% 105 23653 0.16% 106 24600 0.16% 107 25598 0.17% 108 26001 0.17% 109 27589 0.18% 110 28571 0.19% 111 29478 0.20% 112 30902 0.21% 113 32674 0.22% 114 34158 0.23% 115 35778 0.24% 116 37018 0.25% 117 38280 0.25% 118 38967 0.26% 119 39966 0.27% 120 41481 0.28% 121 42902 0.28% 122 44295 0.29% 123 46900 0.31% 124 48944 0.32% 125 50778 0.34% 126 53121 0.35% 127 54641 0.36% 128 56380 0.37% 129 58201 0.39% 130 59875 0.40% 131 62917 0.42% 132 66102 0.44% 133 70002 0.46% 134 73529 0.49% 135 78624 0.52% 136 83514 0.55% 137 89258 0.59% 138 94839 0.63% 139 102492 0.68% 140 109609 0.73% 141 120622 0.80% 142 132674 0.88% 143 149874 0.99% 144 173196 1.15% 145 204957 1.36% 146 251798 1.67% 147 334293 2.22% 148 511084 3.39% 149 994278 6.60% 150 4189964 27.80% 151 5835433 38.72% 15071854 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.66 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=67.22 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=15 prefix-density=0.82 prefix-fanout=2.4 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=25.73 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATG SRR7171102 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:00:38 Started mapping on | Feb 14 05:00:39 Finished on | Feb 14 05:02:24 Mapping speed, Million of reads per hour | 516.75 Number of input reads | 15071854 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14042122 Uniquely mapped reads % | 93.17% Average mapped length | 290.90 Number of splices: Total | 12880504 Number of splices: Annotated (sjdb) | 12557700 Number of splices: GT/AG | 12634381 Number of splices: GC/AG | 194398 Number of splices: AT/AC | 8136 Number of splices: Non-canonical | 43589 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 408661 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 35146 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.81% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 645296 645296 645296 N_multimapping 408661 408661 408661 N_noFeature 637018 13773579 739641 N_ambiguous 262342 1126 95736 UnstrandedReadsAssigned:13142762 PositiveStrandReadsAssigned:267417 NegativeStrandReadsAssigned:13206745 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171102 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171102-trimmed-pair1.fastq SRR7171102-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,071,854 reads, 13,171,003 reads pseudoaligned [quant] estimated average fragment length: 225.058 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7171102.ke.tsv 34699 SRR7171102.se.tsv 87100 total ==> SRR7171102.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.94 738 25.8954 Potri.005G024800.1.v4.1 1035 810.942 155 12.0314 Potri.004G059700.1.v4.1 961 736.957 11 0.93956 Potri.007G009000.2.v4.1 1416 1191.94 0 0 Potri.003G141000.2.v4.1 2943 2718.94 711.272 16.4668 Potri.016G087400.1.v4.1 270 86.8926 812 588.23 Potri.015G069301.1.v4.1 564 343.528 0 0 Potri.010G195200.1.v4.1 1773 1548.94 61.7704 2.51027 Potri.012G127500.1.v4.1 977 752.957 131 10.9515 ==> SRR7171102.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 720 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7171102 completed mapping pipeline successfully