Starting /dee2/code/volunteer_pipeline.sh SRR7171103 current disk space = 3086871736320 free memory = 1582399612 SRR7171103 SRAfilesize 21a1d58b39a3455e4f8cde349ed65945 SRR7171103.sra SRR7171103.sra file validated SRR7171103 is paired end SRR7171103 is conventional basespace SRR7171103 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.0575 18.0 18.0 30.0 18.0 32.0 2 30.4255 31.0 29.0 33.0 27.0 33.0 3 31.96575 33.0 31.0 33.0 29.0 33.0 4 32.548 33.0 33.0 33.0 31.0 34.0 5 33.15275 33.0 33.0 34.0 33.0 34.0 6 37.24825 38.0 38.0 38.0 36.0 38.0 7 37.5355 38.0 38.0 38.0 37.0 38.0 8 37.649 38.0 38.0 38.0 38.0 38.0 9 37.682 38.0 38.0 38.0 38.0 38.0 10-14 37.590700000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.612700000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5173 38.0 38.0 38.0 37.0 38.0 25-29 37.50685 38.0 38.0 38.0 37.2 38.0 30-34 37.54295 38.0 38.0 38.0 37.2 38.0 35-39 37.34325 38.0 38.0 38.0 36.8 38.0 40-44 37.4268 38.0 38.0 38.0 37.0 38.0 45-49 37.419900000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.72965 38.0 38.0 38.0 34.2 38.0 55-59 37.0261 38.0 38.0 38.0 36.0 38.0 60-64 37.0113 38.0 38.0 38.0 36.0 38.0 65-69 36.95715 38.0 38.0 38.0 36.0 38.0 70-74 36.8168 38.0 38.0 38.0 35.2 38.0 75-79 36.773849999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.66065 38.0 38.0 38.0 34.6 38.0 85-89 36.325 38.0 37.4 38.0 34.0 38.0 90-94 36.128699999999995 38.0 37.0 38.0 33.4 38.0 95-99 36.2499 38.0 37.0 38.0 34.0 38.0 100-104 36.1539 38.0 37.0 38.0 33.8 38.0 105-109 35.95345 38.0 37.0 38.0 33.0 38.0 110-114 35.633849999999995 38.0 36.8 38.0 30.6 38.0 115-119 35.2858 38.0 36.0 38.0 29.2 38.0 120-124 35.24159999999999 38.0 36.0 38.0 29.0 38.0 125-129 34.91855 38.0 35.6 38.0 27.8 38.0 130-134 31.57685 35.2 27.8 38.0 19.2 38.0 135-139 33.7962 38.0 33.6 38.0 23.0 38.0 140-144 33.4875 38.0 33.6 38.0 21.8 38.0 145-149 32.53705 38.0 32.8 38.0 14.6 38.0 150-151 27.943875 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 3.0 16 2.0 17 3.0 18 3.0 19 11.0 20 3.0 21 7.0 22 7.0 23 5.0 24 9.0 25 10.0 26 17.0 27 21.0 28 29.0 29 35.0 30 40.0 31 62.0 32 85.0 33 128.0 34 222.0 35 463.0 36 1291.0 37 1539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.624873609706775 12.386248736097068 12.56319514661274 36.42568250758342 2 21.03551775887944 17.38369184592296 36.61830915457729 24.96248124062031 3 17.7 24.775 28.125 29.4 4 20.474999999999998 31.775 24.875 22.875 5 22.15 35.55 24.349999999999998 17.95 6 18.05 35.3 27.175 19.475 7 13.775 22.275 45.95 18.0 8 16.675 25.525 31.125000000000004 26.674999999999997 9 16.650000000000002 23.724999999999998 34.449999999999996 25.174999999999997 10-14 19.75 30.175 26.790000000000003 23.285 15-19 19.715 28.895 27.950000000000003 23.44 20-24 19.72 29.01 27.875 23.395 25-29 19.645000000000003 28.935 28.28 23.14 30-34 19.72 29.12 27.779999999999998 23.380000000000003 35-39 20.005 29.360000000000003 27.47 23.165 40-44 19.625 29.465000000000003 27.900000000000002 23.01 45-49 20.165 29.12 27.115000000000002 23.599999999999998 50-54 19.66 29.275000000000002 27.505000000000003 23.56 55-59 19.830000000000002 28.82 27.875 23.474999999999998 60-64 19.825 29.244999999999997 27.6 23.330000000000002 65-69 19.900000000000002 29.095 27.82 23.185 70-74 19.63 28.810000000000002 27.665 23.895 75-79 19.825 28.915000000000003 28.02 23.24 80-84 19.81 29.005 27.450000000000003 23.735 85-89 20.135 28.895 27.474999999999998 23.494999999999997 90-94 19.91 28.78 27.200000000000003 24.11 95-99 20.369999999999997 28.515 28.225 22.89 100-104 20.119999999999997 28.655 27.735 23.49 105-109 20.435 28.015 28.18 23.369999999999997 110-114 20.7 28.52 27.855 22.925 115-119 21.235 29.044999999999998 26.605 23.115 120-124 20.765 28.199999999999996 27.389999999999997 23.645 125-129 20.995 28.655 26.924999999999997 23.425 130-134 20.89 28.77 26.86 23.48 135-139 21.66 28.1 26.71 23.53 140-144 21.605 28.235 26.435 23.724999999999998 145-149 20.75 28.435 26.685 24.13 150-151 21.099999999999998 27.6625 27.5125 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 2.5 22 3.5 23 2.5 24 4.0 25 6.5 26 8.5 27 12.5 28 13.5 29 21.0 30 29.0 31 37.5 32 55.0 33 66.5 34 80.0 35 98.0 36 121.5 37 129.0 38 138.5 39 174.0 40 185.0 41 207.5 42 240.0 43 226.0 44 232.0 45 250.5 46 230.5 47 208.0 48 194.5 49 190.0 50 174.5 51 130.0 52 105.5 53 102.5 54 89.5 55 69.0 56 51.0 57 36.5 58 21.0 59 14.5 60 12.0 61 7.0 62 4.0 63 5.0 64 4.0 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13836796756209 97.8 2 0.6335529650278764 1.25 3 0.05068423720223011 0.15 4 0.10136847440446022 0.4 5 0.05068423720223011 0.25 6 0.025342118601115054 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 38bp) GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.85 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.887499999999999 0.0 0.0 0.0 0.0 120-121 5.175 0.0 0.0 0.0 0.0 122-123 5.525 0.0 0.0 0.0 0.0 124-125 6.0 0.0 0.0 0.0 0.0 126-127 6.4625 0.0 0.0 0.0 0.0 128-129 6.925 0.0 0.0 0.0 0.0 130-131 7.4125 0.0 0.0 0.0 0.0 132-133 8.075 0.0 0.0 0.0 0.0 134-135 8.712499999999999 0.0 0.0 0.0 0.0 136-137 9.4375 0.0 0.0 0.0 0.0 138-139 9.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171103 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03475 33.0 33.0 34.0 32.0 34.0 2 32.689 34.0 33.0 34.0 32.0 34.0 3 33.0565 34.0 33.0 34.0 32.0 34.0 4 33.10375 34.0 33.0 34.0 33.0 34.0 5 33.1365 34.0 33.0 34.0 33.0 34.0 6 37.3305 38.0 38.0 38.0 38.0 38.0 7 37.3515 38.0 38.0 38.0 38.0 38.0 8 37.37825 38.0 38.0 38.0 38.0 38.0 9 37.37575 38.0 38.0 38.0 38.0 38.0 10-14 37.3495 38.0 38.0 38.0 38.0 38.0 15-19 37.2744 38.0 38.0 38.0 37.6 38.0 20-24 36.0109 38.0 37.0 38.0 29.8 38.0 25-29 36.83925000000001 38.0 38.0 38.0 35.8 38.0 30-34 37.18055 38.0 38.0 38.0 37.0 38.0 35-39 37.2628 38.0 38.0 38.0 37.6 38.0 40-44 37.252449999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.2124 38.0 38.0 38.0 37.4 38.0 50-54 37.191 38.0 38.0 38.0 37.0 38.0 55-59 37.1673 38.0 38.0 38.0 37.0 38.0 60-64 37.11295 38.0 38.0 38.0 37.0 38.0 65-69 37.12745 38.0 38.0 38.0 37.0 38.0 70-74 37.0456 38.0 38.0 38.0 36.8 38.0 75-79 36.69615 38.0 38.0 38.0 35.4 38.0 80-84 35.36525 38.0 35.6 38.0 29.4 38.0 85-89 36.8324 38.0 38.0 38.0 36.0 38.0 90-94 36.80715 38.0 38.0 38.0 36.0 38.0 95-99 36.6729 38.0 38.0 38.0 35.2 38.0 100-104 36.60795 38.0 38.0 38.0 35.0 38.0 105-109 35.278099999999995 38.0 35.6 38.0 29.0 38.0 110-114 36.18044999999999 38.0 37.6 38.0 33.6 38.0 115-119 35.6316 38.0 36.8 38.0 31.0 38.0 120-124 35.73175 38.0 36.8 38.0 32.2 38.0 125-129 35.498599999999996 38.0 36.2 38.0 31.0 38.0 130-134 35.3637 38.0 36.0 38.0 31.0 38.0 135-139 34.971900000000005 38.0 36.0 38.0 29.6 38.0 140-144 32.7541 36.8 30.4 38.0 23.4 38.0 145-149 31.755200000000002 36.4 30.4 38.0 13.0 38.0 150-151 27.62875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 3.0 5 2.0 6 1.0 7 3.0 8 2.0 9 2.0 10 3.0 11 1.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 3.0 18 1.0 19 5.0 20 8.0 21 3.0 22 6.0 23 10.0 24 10.0 25 8.0 26 15.0 27 17.0 28 18.0 29 17.0 30 38.0 31 54.0 32 66.0 33 88.0 34 170.0 35 333.0 36 930.0 37 2167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.4 21.075 12.7 26.825 2 25.224999999999998 27.025 32.125 15.625 3 21.825 26.875 31.25 20.05 4 24.562281140570285 34.242121060530266 22.061030515257627 19.13456728364182 5 23.936968484242122 37.46873436718359 21.96098049024512 16.633316658329164 6 20.125 38.7 23.175 18.0 7 19.375 20.375 39.800000000000004 20.45 8 21.25 25.2 27.675 25.874999999999996 9 22.0 24.825 29.799999999999997 23.375 10-14 24.044999999999998 28.645 26.395000000000003 20.915 15-19 23.14 28.33 27.72 20.810000000000002 20-24 22.994999999999997 28.634999999999998 27.544999999999998 20.825 25-29 23.400000000000002 28.24 27.375 20.985 30-34 23.145 27.889999999999997 28.01 20.955 35-39 23.18 28.09 27.825 20.905 40-44 23.275000000000002 28.044999999999998 27.689999999999998 20.990000000000002 45-49 23.935000000000002 28.525 27.145000000000003 20.395 50-54 23.345 27.775 28.000000000000004 20.880000000000003 55-59 23.535 27.07 28.189999999999998 21.205 60-64 23.599999999999998 27.825 28.185 20.39 65-69 23.395 27.805000000000003 27.66 21.14 70-74 23.61 27.66 27.839999999999996 20.89 75-79 23.535 27.650000000000002 27.705000000000002 21.11 80-84 22.525000000000002 28.58 27.589999999999996 21.305 85-89 23.669999999999998 27.935 27.265 21.13 90-94 23.515 28.03 27.534999999999997 20.919999999999998 95-99 23.94 28.689999999999998 27.435 19.935 100-104 23.955000000000002 27.79 27.915 20.34 105-109 23.799999999999997 27.939999999999998 28.225 20.035 110-114 24.135 28.84 27.105 19.919999999999998 115-119 24.485 28.57 27.169999999999998 19.775000000000002 120-124 24.59 28.48 27.395000000000003 19.535 125-129 25.080000000000002 27.935 27.58 19.405 130-134 24.565 28.470000000000002 27.455000000000002 19.509999999999998 135-139 25.435000000000002 27.694999999999997 27.605 19.265 140-144 25.5 27.87 27.229999999999997 19.400000000000002 145-149 25.64 28.299999999999997 27.07 18.990000000000002 150-151 25.837500000000002 28.6875 26.1125 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 5.0 25 5.0 26 5.0 27 7.0 28 10.5 29 13.0 30 13.5 31 18.5 32 29.0 33 41.5 34 46.5 35 63.5 36 100.5 37 122.5 38 131.5 39 156.0 40 189.5 41 212.5 42 222.0 43 235.0 44 252.0 45 264.0 46 258.5 47 236.5 48 225.0 49 215.0 50 182.0 51 147.5 52 124.5 53 109.5 54 102.5 55 78.5 56 47.5 57 34.0 58 28.0 59 20.0 60 13.0 61 10.0 62 6.5 63 3.0 64 3.0 65 3.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01215805471124 97.725 2 0.8358662613981762 1.6500000000000001 3 0.050658561296859174 0.15 4 0.050658561296859174 0.2 5 0.025329280648429587 0.125 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (97% over 34bp) CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.8499999999999996 0.0 0.0 0.0 0.0 110-111 3.2 0.0 0.0 0.0 0.0 112-113 3.6375 0.0 0.0 0.0 0.0 114-115 4.0 0.0 0.0 0.0 0.0 116-117 4.3625 0.0 0.0 0.0 0.0 118-119 4.887499999999999 0.0 0.0 0.0 0.0 120-121 5.262499999999999 0.0 0.0 0.0 0.0 122-123 5.625 0.0 0.0 0.0 0.0 124-125 6.125 0.0 0.0 0.0 0.0 126-127 6.7375 0.0 0.0 0.0 0.0 128-129 7.275 0.0 0.0 0.0 0.0 130-131 7.825 0.0 0.0 0.0 0.0 132-133 8.45 0.0 0.0 0.0 0.0 134-135 9.0 0.0 0.0 0.0 0.0 136-137 9.6 0.0 0.0 0.0 0.0 138-139 10.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAA 10 0.006830828 145.0 1 GATCAAC 10 0.006830828 145.0 5 ATCAACT 10 0.006830828 145.0 6 >>END_MODULE Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749927 spots for SRR7171103.sra Written 749927 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra Read 749917 spots for SRR7171103.sra Written 749917 spots for SRR7171103.sra SRR ids: ['SRR7171103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_krwi4acz SRR7171103.sra spots: 14998350 blocks: [[1, 749917], [749918, 1499834], [1499835, 2249751], [2249752, 2999668], [2999669, 3749585], [3749586, 4499502], [4499503, 5249419], [5249420, 5999336], [5999337, 6749253], [6749254, 7499170], [7499171, 8249087], [8249088, 8999004], [8999005, 9748921], [9748922, 10498838], [10498839, 11248755], [11248756, 11998672], [11998673, 12748589], [12748590, 13498506], [13498507, 14248423], [14248424, 14998350]] SRR7171103 file size 5060748 SRR7171103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171103 SRR7171103_1.fastq SRR7171103_2.fastq Input file: SRR7171103_1.fastq Paired file: SRR7171103_2.fastq trimmed: SRR7171103-trimmed-pair1.fastq, SRR7171103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:59:11 2025 >> started Fri Feb 14 04:59:28 2025 >> done (17.203s) 14998350 read pairs processed; of these: 13608 ( 0.09%) short read pairs filtered out after trimming by size control 32727 ( 0.22%) empty read pairs filtered out after trimming by size control 14952015 (99.69%) read pairs available; of these: 9212092 (61.61%) trimmed read pairs available after processing 5739923 (38.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 7 0.00% 21 4 0.00% 22 7 0.00% 23 10 0.00% 24 8 0.00% 25 6 0.00% 26 13 0.00% 27 9 0.00% 28 13 0.00% 29 6 0.00% 30 14 0.00% 31 15 0.00% 32 14 0.00% 33 19 0.00% 34 13 0.00% 35 20 0.00% 36 18 0.00% 37 22 0.00% 38 30 0.00% 39 33 0.00% 40 39 0.00% 41 39 0.00% 42 41 0.00% 43 63 0.00% 44 52 0.00% 45 70 0.00% 46 62 0.00% 47 98 0.00% 48 125 0.00% 49 122 0.00% 50 124 0.00% 51 153 0.00% 52 176 0.00% 53 181 0.00% 54 219 0.00% 55 222 0.00% 56 250 0.00% 57 290 0.00% 58 313 0.00% 59 388 0.00% 60 434 0.00% 61 547 0.00% 62 556 0.00% 63 652 0.00% 64 708 0.00% 65 802 0.01% 66 861 0.01% 67 959 0.01% 68 1095 0.01% 69 1196 0.01% 70 1481 0.01% 71 1618 0.01% 72 1843 0.01% 73 2195 0.01% 74 2433 0.02% 75 2705 0.02% 76 3518 0.02% 77 4108 0.03% 78 3708 0.02% 79 4125 0.03% 80 4356 0.03% 81 5014 0.03% 82 5717 0.04% 83 6596 0.04% 84 8125 0.05% 85 8772 0.06% 86 9337 0.06% 87 10163 0.07% 88 10897 0.07% 89 11354 0.08% 90 12383 0.08% 91 13444 0.09% 92 14195 0.09% 93 16012 0.11% 94 17000 0.11% 95 18407 0.12% 96 19068 0.13% 97 19745 0.13% 98 20657 0.14% 99 21514 0.14% 100 22756 0.15% 101 23406 0.16% 102 25013 0.17% 103 26608 0.18% 104 28306 0.19% 105 30044 0.20% 106 31309 0.21% 107 31892 0.21% 108 32776 0.22% 109 34427 0.23% 110 35047 0.23% 111 36036 0.24% 112 37977 0.25% 113 39612 0.26% 114 40804 0.27% 115 42897 0.29% 116 44200 0.30% 117 45048 0.30% 118 45620 0.31% 119 46687 0.31% 120 47847 0.32% 121 48799 0.33% 122 50595 0.34% 123 52000 0.35% 124 54000 0.36% 125 55397 0.37% 126 57536 0.38% 127 58786 0.39% 128 60657 0.41% 129 62778 0.42% 130 63856 0.43% 131 65547 0.44% 132 67744 0.45% 133 71627 0.48% 134 74880 0.50% 135 79546 0.53% 136 83102 0.56% 137 88054 0.59% 138 93530 0.63% 139 100378 0.67% 140 107449 0.72% 141 117954 0.79% 142 130037 0.87% 143 148072 0.99% 144 172213 1.15% 145 206740 1.38% 146 258569 1.73% 147 348019 2.33% 148 531555 3.56% 149 1019718 6.82% 150 3843026 25.70% 151 5739923 38.39% 14952015 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=20 prefix-density=0.60 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=19.31 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=1.9 sequence=CTACCCATGTTTGGATGCACTGAGGCATCTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=42.66 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7171103 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:00:15 Started mapping on | Feb 14 05:00:15 Finished on | Feb 14 05:02:03 Mapping speed, Million of reads per hour | 498.40 Number of input reads | 14952015 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13984578 Uniquely mapped reads % | 93.53% Average mapped length | 289.58 Number of splices: Total | 12893562 Number of splices: Annotated (sjdb) | 12584156 Number of splices: GT/AG | 12651901 Number of splices: GC/AG | 190322 Number of splices: AT/AC | 9363 Number of splices: Non-canonical | 41976 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373970 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 18322 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 607349 607349 607349 N_multimapping 373970 373970 373970 N_noFeature 523424 13658386 626488 N_ambiguous 327591 1072 103935 UnstrandedReadsAssigned:13133563 PositiveStrandReadsAssigned:325120 NegativeStrandReadsAssigned:13254155 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171103-trimmed-pair1.fastq SRR7171103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,952,015 reads, 13,209,890 reads pseudoaligned [quant] estimated average fragment length: 216.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7171103.ke.tsv 34699 SRR7171103.se.tsv 87100 total ==> SRR7171103.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.22 532 15.5182 Potri.005G024800.1.v4.1 1035 819.225 348 22.3314 Potri.004G059700.1.v4.1 961 745.234 51 3.59763 Potri.007G009000.2.v4.1 1416 1200.22 0 0 Potri.003G141000.2.v4.1 2943 2727.22 557 10.7368 Potri.016G087400.1.v4.1 270 90.1719 965 562.595 Potri.015G069301.1.v4.1 564 350.483 0 0 Potri.010G195200.1.v4.1 1773 1557.22 74 2.49816 Potri.012G127500.1.v4.1 977 761.23 83 5.73195 ==> SRR7171103.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 760 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 486 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171103 completed mapping pipeline successfully