Starting /dee2/code/volunteer_pipeline.sh SRR7171104 current disk space = 3087695937536 free memory = 1217422180 SRR7171104 SRAfilesize 8097c876074e7a9c575289f0226955f0 SRR7171104.sra SRR7171104.sra file validated SRR7171104 is paired end SRR7171104 is conventional basespace SRR7171104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.473 27.0 18.0 32.0 18.0 33.0 2 23.242 18.0 18.0 29.0 18.0 33.0 3 26.66 28.0 25.0 31.0 18.0 33.0 4 30.17325 31.0 29.0 33.0 27.0 33.0 5 30.93525 33.0 31.0 33.0 29.0 33.0 6 35.93725 37.0 36.0 38.0 33.0 38.0 7 36.94825 38.0 37.0 38.0 35.0 38.0 8 37.249 38.0 38.0 38.0 36.0 38.0 9 37.40375 38.0 38.0 38.0 37.0 38.0 10-14 37.476350000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.510149999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.568799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.06585 38.0 38.0 38.0 35.8 38.0 30-34 37.198699999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.2112 38.0 36.4 38.0 31.2 38.0 40-44 37.28830000000001 38.0 38.0 38.0 37.0 38.0 45-49 36.68964999999999 38.0 37.4 38.0 34.0 38.0 50-54 37.1726 38.0 38.0 38.0 36.6 38.0 55-59 37.249 38.0 38.0 38.0 36.8 38.0 60-64 36.57045 38.0 37.4 38.0 33.6 38.0 65-69 35.991699999999994 38.0 36.0 38.0 30.2 38.0 70-74 36.41875 38.0 37.6 38.0 32.4 38.0 75-79 36.917249999999996 38.0 37.8 38.0 35.4 38.0 80-84 36.873599999999996 38.0 38.0 38.0 35.4 38.0 85-89 35.5986 37.8 35.4 38.0 30.8 38.0 90-94 35.8395 38.0 36.2 38.0 31.4 38.0 95-99 35.197799999999994 38.0 35.8 38.0 25.0 38.0 100-104 36.20935 38.0 37.2 38.0 32.6 38.0 105-109 36.3452 38.0 37.4 38.0 34.0 38.0 110-114 35.1772 38.0 35.6 38.0 26.6 38.0 115-119 32.1704 34.8 29.4 37.8 23.0 38.0 120-124 35.695100000000004 38.0 36.4 38.0 31.0 38.0 125-129 35.38965 38.0 36.0 38.0 30.6 38.0 130-134 34.16095 38.0 33.4 38.0 23.0 38.0 135-139 34.4469 38.0 33.6 38.0 26.6 38.0 140-144 33.89525 38.0 33.0 38.0 23.8 38.0 145-149 30.3822 36.0 27.6 38.0 10.2 38.0 150-151 26.403875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 2.0 19 3.0 20 2.0 21 3.0 22 6.0 23 8.0 24 7.0 25 19.0 26 21.0 27 33.0 28 37.0 29 45.0 30 60.0 31 71.0 32 126.0 33 185.0 34 284.0 35 658.0 36 1501.0 37 924.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.50777202072539 11.735751295336788 9.870466321243523 33.8860103626943 2 21.175 18.3 37.175000000000004 23.35 3 18.35 23.549999999999997 28.449999999999996 29.65 4 22.675 31.374999999999996 24.05 21.9 5 20.630157539384847 34.958739684921234 24.5311327831958 19.879969992498125 6 16.375 35.9 26.400000000000002 21.325 7 14.35 22.900000000000002 45.074999999999996 17.675 8 17.5 22.95 32.975 26.575 9 17.05 24.4 33.375 25.174999999999997 10-14 20.34 29.330000000000002 26.619999999999997 23.71 15-19 20.165 28.994999999999997 27.689999999999998 23.150000000000002 20-24 19.73 28.970000000000002 27.97 23.330000000000002 25-29 19.415 29.160000000000004 27.810000000000002 23.615 30-34 19.72 28.67 28.389999999999997 23.22 35-39 19.830000000000002 28.59 28.345 23.235 40-44 20.035 29.189999999999998 27.925 22.85 45-49 19.655 29.18 27.3 23.865 50-54 19.6 29.145 28.07 23.185 55-59 20.09 28.73 27.955000000000002 23.225 60-64 20.325 28.470000000000002 27.85 23.355 65-69 19.900000000000002 28.51 28.155 23.435 70-74 20.26 28.46 27.925 23.355 75-79 20.205000000000002 29.23 27.305 23.26 80-84 19.919999999999998 28.57 27.55 23.96 85-89 19.735 28.99 28.225 23.05 90-94 20.46 28.525 27.76 23.255 95-99 19.96 28.585 27.98 23.474999999999998 100-104 20.150000000000002 28.955 27.85 23.044999999999998 105-109 20.775 28.74 27.33 23.155 110-114 21.14 29.01 27.055 22.795 115-119 21.065 28.16 27.725 23.05 120-124 20.995 28.34 27.005000000000003 23.66 125-129 21.145 28.494999999999997 27.175 23.185 130-134 21.385 28.560000000000002 26.974999999999998 23.080000000000002 135-139 21.065 28.249999999999996 26.619999999999997 24.065 140-144 20.605 28.605000000000004 26.619999999999997 24.169999999999998 145-149 20.43 28.854999999999997 26.86 23.855 150-151 20.29257314328582 27.969492373093274 27.35683920980245 24.381095273818453 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 3.0 23 4.0 24 3.5 25 3.0 26 7.5 27 8.0 28 7.5 29 17.5 30 25.5 31 33.0 32 41.0 33 54.0 34 64.5 35 78.0 36 99.0 37 133.0 38 156.0 39 177.5 40 207.0 41 218.0 42 241.5 43 251.0 44 250.5 45 260.5 46 261.5 47 238.5 48 210.0 49 194.0 50 163.0 51 132.5 52 108.5 53 84.0 54 65.5 55 51.0 56 40.0 57 29.5 58 18.0 59 13.0 60 13.0 61 7.5 62 5.5 63 5.5 64 3.0 65 1.5 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5000000000000004 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7625 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.9375 0.0 0.0 0.0 0.0 128-129 6.449999999999999 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.4375 0.0 0.0 0.0 0.0 134-135 7.975 0.0 0.0 0.0 0.0 136-137 8.537500000000001 0.0 0.0 0.0 0.0 138-139 9.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68925 33.0 33.0 34.0 32.0 34.0 2 32.59575 33.0 33.0 34.0 32.0 34.0 3 32.7425 34.0 33.0 34.0 32.0 34.0 4 32.76925 34.0 33.0 34.0 32.0 34.0 5 32.80975 34.0 33.0 34.0 32.0 34.0 6 36.95 38.0 38.0 38.0 36.0 38.0 7 37.04825 38.0 38.0 38.0 37.0 38.0 8 37.06425 38.0 38.0 38.0 36.0 38.0 9 37.0495 38.0 38.0 38.0 37.0 38.0 10-14 36.90125 38.0 38.0 38.0 36.0 38.0 15-19 36.88155 38.0 38.0 38.0 36.0 38.0 20-24 36.5533 38.0 38.0 38.0 34.6 38.0 25-29 36.857000000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.874849999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.85210000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.709500000000006 38.0 38.0 38.0 35.6 38.0 45-49 36.52145 38.0 38.0 38.0 34.6 38.0 50-54 36.62815 38.0 38.0 38.0 35.0 38.0 55-59 36.7104 38.0 38.0 38.0 35.2 38.0 60-64 36.5377 38.0 38.0 38.0 34.6 38.0 65-69 36.58 38.0 38.0 38.0 34.8 38.0 70-74 36.48395000000001 38.0 38.0 38.0 34.4 38.0 75-79 36.381550000000004 38.0 38.0 38.0 34.2 38.0 80-84 36.3284 38.0 38.0 38.0 34.0 38.0 85-89 36.3269 38.0 38.0 38.0 34.2 38.0 90-94 36.175 38.0 38.0 38.0 33.6 38.0 95-99 36.11235 38.0 38.0 38.0 33.8 38.0 100-104 35.846999999999994 38.0 37.4 38.0 31.8 38.0 105-109 35.63655 38.0 37.0 38.0 31.0 38.0 110-114 35.551750000000006 38.0 37.0 38.0 31.0 38.0 115-119 35.21005 38.0 36.2 38.0 29.2 38.0 120-124 34.97665 38.0 36.0 38.0 28.8 38.0 125-129 34.377449999999996 38.0 35.2 38.0 25.0 38.0 130-134 34.08975 38.0 34.8 38.0 23.4 38.0 135-139 33.153000000000006 38.0 33.2 38.0 17.0 38.0 140-144 31.995299999999997 38.0 31.8 38.0 12.8 38.0 145-149 30.625400000000003 37.8 30.2 38.0 4.0 38.0 150-151 23.929625 29.5 14.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 2.0 5 2.0 6 2.0 7 3.0 8 0.0 9 1.0 10 1.0 11 0.0 12 2.0 13 3.0 14 2.0 15 3.0 16 3.0 17 7.0 18 4.0 19 14.0 20 7.0 21 11.0 22 11.0 23 11.0 24 18.0 25 23.0 26 25.0 27 44.0 28 39.0 29 49.0 30 54.0 31 62.0 32 126.0 33 127.0 34 186.0 35 344.0 36 753.0 37 2046.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.199999999999996 19.025 12.0 27.775 2 26.0 25.85 31.15 17.0 3 21.3 28.975 30.8 18.925 4 24.375 33.525 23.150000000000002 18.95 5 24.075 37.15 22.975 15.8 6 18.575 38.425 24.5 18.5 7 17.65 19.25 42.225 20.875 8 19.725 24.325 29.299999999999997 26.650000000000002 9 20.825 24.0 31.474999999999998 23.7 10-14 23.61 28.12 26.740000000000002 21.529999999999998 15-19 22.775000000000002 28.144999999999996 28.395 20.685000000000002 20-24 23.330000000000002 28.235 27.944999999999997 20.49 25-29 22.61 28.115000000000002 28.655 20.62 30-34 22.220000000000002 28.655 28.475 20.65 35-39 23.01 28.110000000000003 28.43 20.45 40-44 22.869999999999997 28.555000000000003 28.38 20.195 45-49 22.875 28.15 28.310000000000002 20.665 50-54 22.345000000000002 28.084999999999997 28.444999999999997 21.125 55-59 22.775000000000002 28.155 28.349999999999998 20.72 60-64 23.32 27.644999999999996 28.345 20.69 65-69 23.315 28.375 28.03 20.28 70-74 23.335 28.244999999999997 27.700000000000003 20.72 75-79 23.150000000000002 27.315 28.349999999999998 21.185000000000002 80-84 23.285 27.97 27.825 20.919999999999998 85-89 22.745 28.310000000000002 28.28 20.665 90-94 22.895 28.255000000000003 28.375 20.474999999999998 95-99 23.445 27.735 28.395 20.424999999999997 100-104 23.09 28.294999999999998 28.139999999999997 20.474999999999998 105-109 23.195 27.855 28.225 20.724999999999998 110-114 23.330000000000002 28.194999999999997 28.139999999999997 20.335 115-119 23.68 28.025 28.175 20.119999999999997 120-124 24.345 28.48 27.125 20.05 125-129 24.86 27.834999999999997 27.615000000000002 19.689999999999998 130-134 25.319999999999997 27.925 27.334999999999997 19.42 135-139 24.759999999999998 28.134999999999998 27.05 20.055 140-144 25.03 27.96 27.435 19.575 145-149 25.435000000000002 27.779999999999998 27.245 19.54 150-151 25.35950981618107 27.58534450418907 27.32274602976116 19.7323996498687 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.5 21 2.0 22 0.5 23 0.0 24 1.5 25 3.5 26 4.0 27 5.5 28 10.0 29 17.0 30 20.5 31 25.0 32 36.5 33 45.0 34 53.5 35 72.0 36 92.0 37 114.5 38 151.5 39 183.0 40 198.5 41 226.5 42 246.5 43 242.5 44 264.5 45 291.0 46 274.5 47 254.5 48 229.5 49 186.5 50 156.0 51 127.5 52 90.5 53 74.0 54 79.0 55 61.0 56 42.5 57 33.0 58 23.0 59 19.5 60 12.0 61 6.0 62 3.5 63 3.5 64 3.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.3268795574553684 0.65 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.2375 0.0 0.0 0.0 0.0 114-115 3.5375 0.0 0.0 0.0 0.0 116-117 3.95 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.9875 0.0 0.0 0.0 0.0 122-123 5.4625 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.637499999999999 0.0 0.0 0.0 0.0 128-129 7.175000000000001 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.1625 0.0 0.0 0.0 0.0 134-135 8.7125 0.0 0.0 0.0 0.0 136-137 9.337499999999999 0.0 0.0 0.0 0.0 138-139 9.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra Read 968392 spots for SRR7171104.sra Written 968392 spots for SRR7171104.sra Read 968374 spots for SRR7171104.sra Written 968374 spots for SRR7171104.sra SRR ids: ['SRR7171104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5wfv906j SRR7171104.sra spots: 19367498 blocks: [[1, 968374], [968375, 1936748], [1936749, 2905122], [2905123, 3873496], [3873497, 4841870], [4841871, 5810244], [5810245, 6778618], [6778619, 7746992], [7746993, 8715366], [8715367, 9683740], [9683741, 10652114], [10652115, 11620488], [11620489, 12588862], [12588863, 13557236], [13557237, 14525610], [14525611, 15493984], [15493985, 16462358], [16462359, 17430732], [17430733, 18399106], [18399107, 19367498]] SRR7171104 file size 6541309 SRR7171104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171104 SRR7171104_1.fastq SRR7171104_2.fastq Input file: SRR7171104_1.fastq Paired file: SRR7171104_2.fastq trimmed: SRR7171104-trimmed-pair1.fastq, SRR7171104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:13:22 2025 >> started Fri Feb 14 04:13:43 2025 >> done (20.871s) 19367498 read pairs processed; of these: 17084 ( 0.09%) short read pairs filtered out after trimming by size control 23887 ( 0.12%) empty read pairs filtered out after trimming by size control 19326527 (99.79%) read pairs available; of these: 11847917 (61.30%) trimmed read pairs available after processing 7478610 (38.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 4 0.00% 21 10 0.00% 22 13 0.00% 23 5 0.00% 24 13 0.00% 25 4 0.00% 26 16 0.00% 27 4 0.00% 28 16 0.00% 29 15 0.00% 30 9 0.00% 31 11 0.00% 32 18 0.00% 33 22 0.00% 34 18 0.00% 35 26 0.00% 36 20 0.00% 37 33 0.00% 38 44 0.00% 39 37 0.00% 40 43 0.00% 41 61 0.00% 42 59 0.00% 43 53 0.00% 44 81 0.00% 45 72 0.00% 46 100 0.00% 47 96 0.00% 48 106 0.00% 49 141 0.00% 50 143 0.00% 51 195 0.00% 52 207 0.00% 53 232 0.00% 54 217 0.00% 55 272 0.00% 56 306 0.00% 57 351 0.00% 58 353 0.00% 59 440 0.00% 60 546 0.00% 61 569 0.00% 62 636 0.00% 63 737 0.00% 64 838 0.00% 65 932 0.00% 66 984 0.01% 67 1108 0.01% 68 1163 0.01% 69 1346 0.01% 70 1605 0.01% 71 1759 0.01% 72 2008 0.01% 73 2403 0.01% 74 2661 0.01% 75 2847 0.01% 76 3251 0.02% 77 3715 0.02% 78 3885 0.02% 79 4194 0.02% 80 4787 0.02% 81 5383 0.03% 82 6066 0.03% 83 6802 0.04% 84 8281 0.04% 85 9427 0.05% 86 9849 0.05% 87 10471 0.05% 88 11538 0.06% 89 12087 0.06% 90 13140 0.07% 91 14222 0.07% 92 15286 0.08% 93 16724 0.09% 94 17956 0.09% 95 19226 0.10% 96 19975 0.10% 97 21287 0.11% 98 22000 0.11% 99 22837 0.12% 100 24400 0.13% 101 25468 0.13% 102 27091 0.14% 103 28810 0.15% 104 30497 0.16% 105 32054 0.17% 106 33539 0.17% 107 34252 0.18% 108 35534 0.18% 109 36676 0.19% 110 37627 0.19% 111 39173 0.20% 112 41348 0.21% 113 42601 0.22% 114 44591 0.23% 115 46685 0.24% 116 48522 0.25% 117 49763 0.26% 118 51372 0.27% 119 51908 0.27% 120 53782 0.28% 121 55391 0.29% 122 57465 0.30% 123 60382 0.31% 124 62389 0.32% 125 65348 0.34% 126 67522 0.35% 127 69348 0.36% 128 72271 0.37% 129 74846 0.39% 130 77760 0.40% 131 81039 0.42% 132 85143 0.44% 133 90512 0.47% 134 95513 0.49% 135 102819 0.53% 136 109685 0.57% 137 117446 0.61% 138 125401 0.65% 139 135902 0.70% 140 146572 0.76% 141 159737 0.83% 142 175984 0.91% 143 195940 1.01% 144 224466 1.16% 145 265320 1.37% 146 325640 1.68% 147 431143 2.23% 148 648572 3.36% 149 1259965 6.52% 150 5284289 27.34% 151 7478610 38.70% 19326527 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=16 prefix-density=0.33 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=32.48 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.6 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.69 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=49.84 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.7 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171104 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:14:26 Started mapping on | Feb 14 04:14:27 Finished on | Feb 14 04:16:45 Mapping speed, Million of reads per hour | 504.17 Number of input reads | 19326527 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18087179 Uniquely mapped reads % | 93.59% Average mapped length | 290.37 Number of splices: Total | 17089268 Number of splices: Annotated (sjdb) | 16665354 Number of splices: GT/AG | 16767181 Number of splices: GC/AG | 245276 Number of splices: AT/AC | 10838 Number of splices: Non-canonical | 65973 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 538727 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 53048 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.28% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718867 718867 718867 N_multimapping 538727 538727 538727 N_noFeature 721380 17816508 822140 N_ambiguous 317098 1041 146711 UnstrandedReadsAssigned:17048701 PositiveStrandReadsAssigned:269630 NegativeStrandReadsAssigned:17118328 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171104-trimmed-pair1.fastq SRR7171104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,326,527 reads, 17,046,969 reads pseudoaligned [quant] estimated average fragment length: 230.917 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7171104.ke.tsv 34699 SRR7171104.se.tsv 87100 total ==> SRR7171104.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.08 1549 48.6656 Potri.005G024800.1.v4.1 1035 805.083 400 27.9111 Potri.004G059700.1.v4.1 961 731.103 16 1.22942 Potri.007G009000.2.v4.1 1416 1186.08 0 0 Potri.003G141000.2.v4.1 2943 2713.08 1145.42 23.7171 Potri.016G087400.1.v4.1 270 86.7247 1092 707.356 Potri.015G069301.1.v4.1 564 338.28 0 0 Potri.010G195200.1.v4.1 1773 1543.08 190 6.91707 Potri.012G127500.1.v4.1 977 747.083 249 18.7236 ==> SRR7171104.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 967 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 128 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 12 SRR7171104 completed mapping pipeline successfully