Starting /dee2/code/volunteer_pipeline.sh SRR7171105 current disk space = 3085961330688 free memory = 1582631684 SRR7171105 SRAfilesize 06c9ae45ae0f68b6b59e6ee9a60a498f SRR7171105.sra SRR7171105.sra file validated SRR7171105 is paired end SRR7171105 is conventional basespace SRR7171105 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171105_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.79925 32.0 18.0 33.0 18.0 33.0 2 28.15225 29.0 25.0 33.0 18.0 33.0 3 30.45925 31.0 29.0 33.0 27.0 33.0 4 31.91375 33.0 31.0 33.0 29.0 33.0 5 32.60275 33.0 33.0 33.0 32.0 34.0 6 33.6495 37.0 33.0 38.0 16.0 38.0 7 36.3385 38.0 36.0 38.0 31.0 38.0 8 37.1335 38.0 38.0 38.0 36.0 38.0 9 37.401 38.0 38.0 38.0 37.0 38.0 10-14 37.504450000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.525549999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.52525 38.0 38.0 38.0 37.8 38.0 25-29 37.4139 38.0 38.0 38.0 37.4 38.0 30-34 37.36355 38.0 38.0 38.0 37.0 38.0 35-39 36.765 38.0 37.8 38.0 34.2 38.0 40-44 37.23385 38.0 38.0 38.0 36.8 38.0 45-49 37.14425 38.0 38.0 38.0 36.6 38.0 50-54 34.20825000000001 36.2 29.2 38.0 28.2 38.0 55-59 36.101299999999995 37.8 35.6 38.0 32.8 38.0 60-64 36.95195 38.0 38.0 38.0 36.0 38.0 65-69 36.93185 38.0 38.0 38.0 35.8 38.0 70-74 36.793099999999995 38.0 38.0 38.0 35.0 38.0 75-79 36.7384 38.0 38.0 38.0 35.0 38.0 80-84 36.65859999999999 38.0 38.0 38.0 34.6 38.0 85-89 36.496050000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.305049999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.29275 38.0 38.0 38.0 34.0 38.0 100-104 36.1641 38.0 37.2 38.0 33.6 38.0 105-109 36.071799999999996 38.0 37.0 38.0 33.4 38.0 110-114 35.68465 38.0 36.6 38.0 31.4 38.0 115-119 35.49625 38.0 36.4 38.0 30.6 38.0 120-124 35.45815 38.0 36.0 38.0 31.0 38.0 125-129 35.0804 38.0 35.8 38.0 28.0 38.0 130-134 28.712899999999998 31.2 22.6 37.2 16.0 38.0 135-139 33.6079 37.2 33.8 38.0 23.4 38.0 140-144 33.8587 38.0 34.2 38.0 23.0 38.0 145-149 32.64155 38.0 33.0 38.0 16.6 38.0 150-151 28.32875 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 4.0 7 3.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 0.0 14 1.0 15 1.0 16 2.0 17 4.0 18 2.0 19 6.0 20 5.0 21 3.0 22 7.0 23 9.0 24 9.0 25 9.0 26 15.0 27 23.0 28 30.0 29 44.0 30 51.0 31 72.0 32 81.0 33 149.0 34 281.0 35 566.0 36 1542.0 37 1075.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.612029260363045 11.920888648062855 8.317529124898401 28.149552966675696 2 20.4 16.775000000000002 37.05 25.775 3 17.4 23.3 30.375000000000004 28.925 4 22.625 31.8 25.05 20.525 5 21.3 37.2 24.675 16.825000000000003 6 16.975 36.275 26.075 20.674999999999997 7 12.950000000000001 21.85 46.949999999999996 18.25 8 16.45 22.7 33.525 27.325 9 18.925 22.125 34.35 24.6 10-14 20.06 28.675 27.13 24.135 15-19 19.7 28.575 27.93 23.794999999999998 20-24 19.11 28.999999999999996 28.16 23.73 25-29 19.85 29.404999999999998 27.93 22.814999999999998 30-34 20.01 29.13 27.944999999999997 22.915 35-39 19.77 29.725 27.72 22.785 40-44 19.965 29.060000000000002 27.935 23.04 45-49 19.900000000000002 27.805000000000003 28.215 24.08 50-54 19.31 28.634999999999998 29.115000000000002 22.939999999999998 55-59 19.71 28.875 28.365000000000002 23.05 60-64 19.74 28.335 28.49 23.435 65-69 19.965 28.73 27.944999999999997 23.36 70-74 20.605 28.21 28.1 23.085 75-79 19.64 28.825 28.325 23.21 80-84 20.555 28.194999999999997 28.265 22.985 85-89 20.215 28.139999999999997 28.325 23.32 90-94 20.380000000000003 28.33 27.944999999999997 23.345 95-99 19.81 29.205 27.625 23.36 100-104 20.79 28.64 27.975 22.595000000000002 105-109 20.575 28.415000000000003 27.815 23.195 110-114 20.135 29.165000000000003 27.665 23.035 115-119 20.855 29.065 27.384999999999998 22.695 120-124 20.745 29.64 26.625 22.99 125-129 20.7 28.785 27.215 23.3 130-134 20.79 28.715000000000003 27.500000000000004 22.994999999999997 135-139 20.630000000000003 28.79 26.795 23.785 140-144 20.525 28.78 27.07 23.625 145-149 20.855 28.87 26.950000000000003 23.325000000000003 150-151 20.3625 29.099999999999998 26.4625 24.075 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 2.0 2 2.5 3 0.5 4 1.5 5 2.0 6 0.5 7 0.5 8 1.5 9 1.0 10 1.0 11 1.5 12 0.5 13 0.0 14 1.0 15 1.5 16 1.0 17 1.5 18 1.0 19 0.5 20 1.5 21 2.5 22 2.0 23 2.0 24 4.5 25 5.0 26 8.0 27 12.5 28 13.0 29 21.5 30 31.5 31 32.0 32 38.0 33 52.5 34 62.5 35 76.0 36 92.5 37 113.0 38 142.0 39 170.0 40 192.5 41 218.5 42 237.0 43 258.0 44 276.5 45 267.5 46 264.0 47 251.0 48 215.0 49 175.5 50 158.5 51 134.5 52 103.0 53 80.5 54 60.5 55 53.0 56 46.0 57 36.5 58 27.5 59 17.0 60 8.5 61 7.0 62 2.5 63 2.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.3875000000000002 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.199999999999999 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 5.575 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.35 0.0 0.0 0.0 0.0 136-137 8.05 0.0 0.0 0.0 0.0 138-139 8.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTTC 10 0.006843168 144.91249 9 >>END_MODULE SRR7171105 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171105_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9755 33.0 33.0 34.0 32.0 34.0 2 32.96975 34.0 33.0 34.0 32.0 34.0 3 32.90725 34.0 33.0 34.0 32.0 34.0 4 32.92875 34.0 33.0 34.0 32.0 34.0 5 32.9695 34.0 33.0 34.0 32.0 34.0 6 37.11625 38.0 38.0 38.0 37.0 38.0 7 36.44425 38.0 38.0 38.0 34.0 38.0 8 37.033 38.0 38.0 38.0 36.0 38.0 9 37.19425 38.0 38.0 38.0 37.0 38.0 10-14 37.113099999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.05195 38.0 38.0 38.0 36.6 38.0 20-24 36.919599999999996 38.0 38.0 38.0 36.2 38.0 25-29 36.69535 38.0 38.0 38.0 35.4 38.0 30-34 36.94789999999999 38.0 38.0 38.0 36.4 38.0 35-39 36.9853 38.0 38.0 38.0 36.6 38.0 40-44 36.98625 38.0 38.0 38.0 36.2 38.0 45-49 35.752950000000006 38.0 36.0 38.0 30.2 38.0 50-54 36.901650000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8333 38.0 38.0 38.0 35.8 38.0 60-64 36.7631 38.0 38.0 38.0 36.0 38.0 65-69 36.76514999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.703950000000006 38.0 38.0 38.0 35.6 38.0 75-79 36.72355 38.0 38.0 38.0 35.4 38.0 80-84 36.56115 38.0 38.0 38.0 35.0 38.0 85-89 36.46795 38.0 38.0 38.0 34.8 38.0 90-94 36.360549999999996 38.0 38.0 38.0 34.2 38.0 95-99 36.2815 38.0 38.0 38.0 34.0 38.0 100-104 36.06079999999999 38.0 37.6 38.0 33.6 38.0 105-109 35.8118 38.0 37.4 38.0 32.4 38.0 110-114 33.52865 37.6 32.6 38.0 22.4 38.0 115-119 35.3995 38.0 36.4 38.0 30.4 38.0 120-124 35.393750000000004 38.0 36.6 38.0 30.6 38.0 125-129 34.94519999999999 38.0 36.0 38.0 27.8 38.0 130-134 34.80725 38.0 35.8 38.0 27.6 38.0 135-139 34.124649999999995 38.0 34.0 38.0 24.6 38.0 140-144 33.43615 38.0 33.0 38.0 21.0 38.0 145-149 32.2034 38.0 33.0 38.0 10.8 38.0 150-151 26.985124999999996 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 6.0 4 2.0 5 3.0 6 1.0 7 0.0 8 3.0 9 4.0 10 2.0 11 3.0 12 3.0 13 4.0 14 0.0 15 3.0 16 5.0 17 3.0 18 4.0 19 8.0 20 9.0 21 7.0 22 8.0 23 10.0 24 8.0 25 23.0 26 20.0 27 20.0 28 29.0 29 38.0 30 56.0 31 73.0 32 88.0 33 125.0 34 176.0 35 329.0 36 773.0 37 2153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.625 19.75 8.75 20.875 2 24.7 25.575 32.625 17.1 3 21.6 26.224999999999998 32.125 20.05 4 24.95 35.75 21.525 17.775 5 23.65 38.5 20.674999999999997 17.175 6 19.325 39.625 22.675 18.375 7 19.15 19.175 41.199999999999996 20.474999999999998 8 19.375 23.825 28.825 27.975 9 22.025 24.224999999999998 30.15 23.599999999999998 10-14 23.27 28.565 27.16 21.005 15-19 23.195 27.88 28.79 20.135 20-24 22.585 28.58 28.335 20.5 25-29 23.064999999999998 28.185 28.455000000000002 20.294999999999998 30-34 22.33 28.325 28.705000000000002 20.64 35-39 22.46 29.01 28.26 20.27 40-44 22.525000000000002 28.345 28.505000000000003 20.625 45-49 22.485 28.315 28.88 20.32 50-54 22.935 28.32 28.285 20.46 55-59 22.825 28.105000000000004 28.565 20.505000000000003 60-64 22.765 28.249999999999996 28.42 20.565 65-69 23.16 28.705000000000002 28.249999999999996 19.885 70-74 23.01 28.165000000000003 28.305000000000003 20.52 75-79 22.095000000000002 27.894999999999996 28.87 21.14 80-84 22.42 28.310000000000002 28.294999999999998 20.974999999999998 85-89 23.11 27.99 28.275 20.625 90-94 22.900000000000002 28.294999999999998 28.46 20.345 95-99 23.549999999999997 28.015 28.18 20.255000000000003 100-104 23.875 28.255000000000003 28.265 19.605 105-109 23.705000000000002 28.360000000000003 27.515 20.419999999999998 110-114 23.505000000000003 28.389999999999997 27.91 20.195 115-119 24.535 27.925 27.52 20.02 120-124 23.599999999999998 28.470000000000002 28.105000000000004 19.825 125-129 24.92 28.244999999999997 26.995 19.84 130-134 24.86 27.87 27.63 19.64 135-139 24.855 27.66 28.055000000000003 19.43 140-144 24.705 28.185 27.21 19.900000000000002 145-149 25.27 28.595 26.529999999999998 19.605 150-151 25.887500000000003 27.462500000000002 27.487499999999997 19.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 2.0 20 2.5 21 2.5 22 1.5 23 2.0 24 4.0 25 4.5 26 6.0 27 8.5 28 9.5 29 11.0 30 16.5 31 23.0 32 33.0 33 43.5 34 57.0 35 77.0 36 100.0 37 114.0 38 137.0 39 177.5 40 208.5 41 232.5 42 267.5 43 281.0 44 278.0 45 289.0 46 277.5 47 241.0 48 212.5 49 192.0 50 153.5 51 117.5 52 99.0 53 78.5 54 61.5 55 45.0 56 35.0 57 32.0 58 21.5 59 12.0 60 7.0 61 7.0 62 6.5 63 3.0 64 1.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.40221216691804923 0.8 3 0.07541478129713425 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.7875 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.475 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.4375 0.0 0.0 0.0 0.0 116-117 3.9625000000000004 0.0 0.0 0.0 0.0 118-119 4.225 0.0 0.0 0.0 0.0 120-121 4.762499999999999 0.0 0.0 0.0 0.0 122-123 5.125 0.0 0.0 0.0 0.0 124-125 5.675000000000001 0.0 0.0 0.0 0.0 126-127 6.05 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 6.9125 0.0 0.0 0.0 0.0 132-133 7.5125 0.0 0.0 0.0 0.0 134-135 8.2875 0.0 0.0 0.0 0.0 136-137 8.9375 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAAAG 10 0.006830828 145.0 6 AGACAAG 10 0.006830828 145.0 1 >>END_MODULE Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970744 spots for SRR7171105.sra Written 970744 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra Read 970743 spots for SRR7171105.sra Written 970743 spots for SRR7171105.sra SRR ids: ['SRR7171105.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9byje8zd SRR7171105.sra spots: 19414861 blocks: [[1, 970743], [970744, 1941486], [1941487, 2912229], [2912230, 3882972], [3882973, 4853715], [4853716, 5824458], [5824459, 6795201], [6795202, 7765944], [7765945, 8736687], [8736688, 9707430], [9707431, 10678173], [10678174, 11648916], [11648917, 12619659], [12619660, 13590402], [13590403, 14561145], [14561146, 15531888], [15531889, 16502631], [16502632, 17473374], [17473375, 18444117], [18444118, 19414861]] SRR7171105 file size 6557358 SRR7171105 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171105 SRR7171105_1.fastq SRR7171105_2.fastq Input file: SRR7171105_1.fastq Paired file: SRR7171105_2.fastq trimmed: SRR7171105-trimmed-pair1.fastq, SRR7171105-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:33:09 2025 >> started Fri Feb 14 05:33:31 2025 >> done (21.690s) 19414861 read pairs processed; of these: 24028 ( 0.12%) short read pairs filtered out after trimming by size control 25464 ( 0.13%) empty read pairs filtered out after trimming by size control 19365369 (99.75%) read pairs available; of these: 11305799 (58.38%) trimmed read pairs available after processing 8059570 (41.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 16 0.00% 20 20 0.00% 21 21 0.00% 22 27 0.00% 23 30 0.00% 24 28 0.00% 25 31 0.00% 26 30 0.00% 27 28 0.00% 28 23 0.00% 29 20 0.00% 30 31 0.00% 31 32 0.00% 32 29 0.00% 33 30 0.00% 34 24 0.00% 35 38 0.00% 36 34 0.00% 37 41 0.00% 38 48 0.00% 39 60 0.00% 40 59 0.00% 41 52 0.00% 42 64 0.00% 43 65 0.00% 44 84 0.00% 45 94 0.00% 46 99 0.00% 47 126 0.00% 48 120 0.00% 49 165 0.00% 50 155 0.00% 51 207 0.00% 52 246 0.00% 53 258 0.00% 54 284 0.00% 55 327 0.00% 56 375 0.00% 57 408 0.00% 58 493 0.00% 59 519 0.00% 60 556 0.00% 61 641 0.00% 62 758 0.00% 63 806 0.00% 64 879 0.00% 65 931 0.00% 66 1015 0.01% 67 1146 0.01% 68 1255 0.01% 69 1469 0.01% 70 1719 0.01% 71 1937 0.01% 72 2198 0.01% 73 2451 0.01% 74 2816 0.01% 75 3038 0.02% 76 3396 0.02% 77 3799 0.02% 78 4157 0.02% 79 4400 0.02% 80 5143 0.03% 81 5797 0.03% 82 6649 0.03% 83 7647 0.04% 84 9178 0.05% 85 10586 0.05% 86 11872 0.06% 87 13100 0.07% 88 13981 0.07% 89 14406 0.07% 90 15113 0.08% 91 16170 0.08% 92 17451 0.09% 93 18797 0.10% 94 19710 0.10% 95 20747 0.11% 96 22136 0.11% 97 23007 0.12% 98 24310 0.13% 99 25690 0.13% 100 27716 0.14% 101 28768 0.15% 102 31266 0.16% 103 33286 0.17% 104 34450 0.18% 105 36696 0.19% 106 38073 0.20% 107 39552 0.20% 108 40680 0.21% 109 42600 0.22% 110 43798 0.23% 111 46259 0.24% 112 48149 0.25% 113 51033 0.26% 114 53106 0.27% 115 54677 0.28% 116 56011 0.29% 117 57467 0.30% 118 58305 0.30% 119 60173 0.31% 120 61846 0.32% 121 64065 0.33% 122 65433 0.34% 123 69053 0.36% 124 71131 0.37% 125 73302 0.38% 126 75711 0.39% 127 77184 0.40% 128 78836 0.41% 129 81232 0.42% 130 83895 0.43% 131 85654 0.44% 132 89185 0.46% 133 93424 0.48% 134 97848 0.51% 135 103894 0.54% 136 108463 0.56% 137 114000 0.59% 138 120130 0.62% 139 127529 0.66% 140 135672 0.70% 141 148689 0.77% 142 163455 0.84% 143 185182 0.96% 144 214169 1.11% 145 254029 1.31% 146 313259 1.62% 147 419774 2.17% 148 625876 3.23% 149 1179181 6.09% 150 4696923 24.25% 151 8059570 41.62% 19365369 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=27 prefix-density=0.27 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=27.86 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.5 sequence=CTCATCAAATCTT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=33 prefix-density=0.68 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=45.29 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=14.1 sequence=TGATGTTGTTGCTG SRR7171105 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:34:13 Started mapping on | Feb 14 05:34:13 Finished on | Feb 14 05:36:49 Mapping speed, Million of reads per hour | 446.89 Number of input reads | 19365369 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17950710 Uniquely mapped reads % | 92.69% Average mapped length | 289.38 Number of splices: Total | 16991968 Number of splices: Annotated (sjdb) | 16527874 Number of splices: GT/AG | 16667318 Number of splices: GC/AG | 238453 Number of splices: AT/AC | 10042 Number of splices: Non-canonical | 76155 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 590882 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 51745 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 856164 856164 856164 N_multimapping 590882 590882 590882 N_noFeature 761306 17688923 871746 N_ambiguous 318383 1301 166427 UnstrandedReadsAssigned:16871021 PositiveStrandReadsAssigned:260486 NegativeStrandReadsAssigned:16912537 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171105 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171105-trimmed-pair1.fastq SRR7171105-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,365,369 reads, 16,865,430 reads pseudoaligned [quant] estimated average fragment length: 217.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7171105.ke.tsv 34699 SRR7171105.se.tsv 87100 total ==> SRR7171105.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.82 1761 57.5195 Potri.005G024800.1.v4.1 1035 818.822 300 21.5625 Potri.004G059700.1.v4.1 961 744.833 4 0.316059 Potri.007G009000.2.v4.1 1416 1199.82 0 0 Potri.003G141000.2.v4.1 2943 2726.82 1314.93 28.38 Potri.016G087400.1.v4.1 270 90.6546 1019.12 661.613 Potri.015G069301.1.v4.1 564 351.169 0 0 Potri.010G195200.1.v4.1 1773 1556.82 1669.95 63.1295 Potri.012G127500.1.v4.1 977 760.833 91 7.03914 ==> SRR7171105.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 274 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 361 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR7171105 completed mapping pipeline successfully