Starting /dee2/code/volunteer_pipeline.sh SRR7171106 current disk space = 3087084965888 free memory = 1469485820 SRR7171106 SRAfilesize f5b498cf0b57311151b1a0632d8143bf SRR7171106.sra SRR7171106.sra file validated SRR7171106 is paired end SRR7171106 is conventional basespace SRR7171106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.4705 30.0 18.0 33.0 18.0 33.0 2 28.267 29.0 25.0 33.0 18.0 33.0 3 30.69775 31.0 29.0 33.0 27.0 33.0 4 32.00125 33.0 31.0 33.0 29.0 33.0 5 32.636 33.0 33.0 33.0 32.0 34.0 6 33.844 37.0 34.0 38.0 16.0 38.0 7 36.4175 38.0 37.0 38.0 31.0 38.0 8 37.18275 38.0 38.0 38.0 36.0 38.0 9 37.52225 38.0 38.0 38.0 37.0 38.0 10-14 37.54425 38.0 38.0 38.0 37.8 38.0 15-19 37.601 38.0 38.0 38.0 38.0 38.0 20-24 37.595299999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.56145 38.0 38.0 38.0 38.0 38.0 30-34 37.510949999999994 38.0 38.0 38.0 38.0 38.0 35-39 36.82305 38.0 38.0 38.0 34.2 38.0 40-44 37.3727 38.0 38.0 38.0 37.0 38.0 45-49 37.289550000000006 38.0 38.0 38.0 37.0 38.0 50-54 34.27395 36.2 29.2 38.0 28.6 38.0 55-59 36.252750000000006 37.8 35.6 38.0 33.2 38.0 60-64 37.1485 38.0 38.0 38.0 36.2 38.0 65-69 37.0947 38.0 38.0 38.0 36.0 38.0 70-74 36.941250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.913650000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.848 38.0 38.0 38.0 35.6 38.0 85-89 36.71065 38.0 38.0 38.0 35.0 38.0 90-94 36.5206 38.0 38.0 38.0 34.0 38.0 95-99 36.55675 38.0 38.0 38.0 34.2 38.0 100-104 36.38505 38.0 38.0 38.0 34.0 38.0 105-109 36.312850000000005 38.0 37.8 38.0 34.0 38.0 110-114 35.937599999999996 38.0 37.2 38.0 32.4 38.0 115-119 35.68115 38.0 36.6 38.0 31.0 38.0 120-124 35.632250000000006 38.0 36.4 38.0 31.0 38.0 125-129 35.44095 38.0 36.0 38.0 31.0 38.0 130-134 28.7172 31.0 22.6 37.0 18.0 38.0 135-139 34.07625 37.2 34.0 38.0 25.4 38.0 140-144 34.1782 38.0 35.0 38.0 24.2 38.0 145-149 33.1546 38.0 33.0 38.0 18.6 38.0 150-151 29.404125 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 2.0 17 0.0 18 5.0 19 4.0 20 3.0 21 6.0 22 9.0 23 6.0 24 3.0 25 11.0 26 13.0 27 24.0 28 33.0 29 35.0 30 42.0 31 51.0 32 94.0 33 133.0 34 238.0 35 487.0 36 1557.0 37 1235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.468039003250276 12.378114842903576 11.1863488624052 34.96749729144095 2 20.655163790947736 17.504376094023506 37.65941485371343 24.18104526131533 3 17.549999999999997 23.35 29.025000000000002 30.075000000000003 4 22.425 30.4 24.0 23.175 5 19.45 36.4 25.45 18.7 6 15.85 35.099999999999994 29.299999999999997 19.75 7 12.85 22.45 45.550000000000004 19.15 8 16.45 22.25 33.85 27.450000000000003 9 17.525 24.325 33.2 24.95 10-14 19.115 28.98 26.995 24.91 15-19 19.195 28.970000000000002 28.815 23.02 20-24 19.235 29.255 28.384999999999998 23.125 25-29 19.655 28.515 28.585 23.244999999999997 30-34 18.965 28.325 28.884999999999998 23.825 35-39 19.564999999999998 28.7 28.115000000000002 23.62 40-44 19.295 28.970000000000002 28.945 22.79 45-49 20.25 28.65 28.305000000000003 22.795 50-54 19.56 28.355000000000004 29.025000000000002 23.06 55-59 19.555 28.705000000000002 28.384999999999998 23.355 60-64 19.950000000000003 28.89 27.82 23.34 65-69 19.665 28.470000000000002 28.610000000000003 23.255 70-74 19.439999999999998 29.189999999999998 28.28 23.09 75-79 19.29 28.625 28.360000000000003 23.724999999999998 80-84 19.895 28.84 28.105000000000004 23.16 85-89 20.064999999999998 28.345 28.435 23.155 90-94 19.685 28.775000000000002 28.49 23.05 95-99 19.825 28.525 28.435 23.215 100-104 20.015 28.625 27.73 23.630000000000003 105-109 19.985 29.294999999999998 27.62 23.1 110-114 20.395 28.810000000000002 28.155 22.64 115-119 20.830000000000002 28.025 28.025 23.119999999999997 120-124 20.195 28.939999999999998 27.82 23.044999999999998 125-129 20.575 28.999999999999996 26.87 23.555 130-134 20.865000000000002 28.645 27.529999999999998 22.96 135-139 20.68 29.520000000000003 27.095000000000002 22.705000000000002 140-144 20.474999999999998 28.82 27.05 23.655 145-149 20.21 28.599999999999998 27.115000000000002 24.075 150-151 21.625 28.9375 26.75 22.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 3.0 2 2.0 3 2.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 2.0 19 3.0 20 2.0 21 2.0 22 2.0 23 2.5 24 6.0 25 7.0 26 8.5 27 15.0 28 16.0 29 18.5 30 29.5 31 41.0 32 50.5 33 59.0 34 72.5 35 82.5 36 101.0 37 125.5 38 150.5 39 173.5 40 197.0 41 234.0 42 258.0 43 259.5 44 256.0 45 254.0 46 240.0 47 219.0 48 199.5 49 183.0 50 163.0 51 127.0 52 94.0 53 76.5 54 64.0 55 51.5 56 40.5 57 29.5 58 24.0 59 16.5 60 6.0 61 7.5 62 7.5 63 4.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.7 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8500000000000001 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9625 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.3875 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.4125 0.0 0.0 0.0 0.0 116-117 3.8625 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.6 0.0 0.0 0.0 0.0 122-123 4.925 0.0 0.0 0.0 0.0 124-125 5.112500000000001 0.0 0.0 0.0 0.0 126-127 5.375 0.0 0.0 0.0 0.0 128-129 5.800000000000001 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.8375 0.0 0.0 0.0 0.0 134-135 7.425 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACTC 10 0.0068396386 144.9375 2 >>END_MODULE SRR7171106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.788 33.0 33.0 34.0 32.0 34.0 2 32.7965 34.0 33.0 34.0 32.0 34.0 3 32.75025 34.0 33.0 34.0 32.0 34.0 4 32.6975 34.0 33.0 34.0 32.0 34.0 5 32.90075 34.0 33.0 34.0 32.0 34.0 6 36.908 38.0 38.0 38.0 36.0 38.0 7 36.24325 38.0 38.0 38.0 33.0 38.0 8 36.829 38.0 38.0 38.0 36.0 38.0 9 36.89925 38.0 38.0 38.0 36.0 38.0 10-14 36.9722 38.0 38.0 38.0 36.4 38.0 15-19 36.9089 38.0 38.0 38.0 36.2 38.0 20-24 36.7043 38.0 38.0 38.0 35.6 38.0 25-29 36.4154 38.0 38.0 38.0 34.4 38.0 30-34 36.76975 38.0 38.0 38.0 36.0 38.0 35-39 36.75404999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.727549999999994 38.0 38.0 38.0 36.0 38.0 45-49 35.556200000000004 38.0 36.0 38.0 29.6 38.0 50-54 36.66425 38.0 38.0 38.0 35.8 38.0 55-59 36.5315 38.0 38.0 38.0 35.0 38.0 60-64 36.5674 38.0 38.0 38.0 35.0 38.0 65-69 36.533 38.0 38.0 38.0 34.6 38.0 70-74 36.42184999999999 38.0 38.0 38.0 34.2 38.0 75-79 36.471050000000005 38.0 38.0 38.0 34.6 38.0 80-84 36.326800000000006 38.0 38.0 38.0 34.2 38.0 85-89 36.31175 38.0 38.0 38.0 34.0 38.0 90-94 36.21169999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.0753 38.0 38.0 38.0 33.8 38.0 100-104 35.8461 38.0 37.4 38.0 32.6 38.0 105-109 35.49315 38.0 36.8 38.0 30.4 38.0 110-114 33.154250000000005 37.4 31.8 38.0 21.2 38.0 115-119 35.164750000000005 38.0 36.0 38.0 29.4 38.0 120-124 35.04145 38.0 36.0 38.0 28.6 38.0 125-129 34.5667 38.0 35.0 38.0 25.6 38.0 130-134 34.39255 38.0 34.6 38.0 25.0 38.0 135-139 33.6168 38.0 33.0 38.0 21.6 38.0 140-144 32.78795 38.0 33.0 38.0 15.2 38.0 145-149 31.606900000000003 38.0 31.8 38.0 8.2 38.0 150-151 26.21 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 4.0 5 1.0 6 2.0 7 2.0 8 3.0 9 2.0 10 0.0 11 1.0 12 2.0 13 3.0 14 3.0 15 4.0 16 3.0 17 2.0 18 9.0 19 10.0 20 14.0 21 5.0 22 8.0 23 10.0 24 25.0 25 20.0 26 24.0 27 28.0 28 35.0 29 51.0 30 48.0 31 69.0 32 104.0 33 138.0 34 176.0 35 362.0 36 829.0 37 1985.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.275 17.9 12.9 26.924999999999997 2 23.974999999999998 26.325 32.95 16.75 3 20.674999999999997 27.925 31.2 20.200000000000003 4 23.642732049036777 35.851888916687514 21.891418563922944 18.613960470352765 5 23.200000000000003 38.2 22.35 16.25 6 19.650000000000002 38.224999999999994 24.775 17.349999999999998 7 19.55 18.625 41.975 19.85 8 21.9 24.325 28.275 25.5 9 22.325 25.15 28.799999999999997 23.724999999999998 10-14 23.105 28.825 27.33 20.74 15-19 22.765 28.549999999999997 28.355000000000004 20.330000000000002 20-24 22.42 28.215 28.83 20.535 25-29 23.01 28.105000000000004 28.575 20.31 30-34 22.009999999999998 28.875 28.444999999999997 20.669999999999998 35-39 22.93 28.54 28.360000000000003 20.169999999999998 40-44 22.07 28.84 28.355000000000004 20.735 45-49 22.295 28.315 28.825 20.565 50-54 22.375 28.465 28.255000000000003 20.905 55-59 22.13 28.43 28.9 20.54 60-64 22.470000000000002 27.905 28.95 20.674999999999997 65-69 22.495 28.249999999999996 28.37 20.885 70-74 22.905 28.310000000000002 28.134999999999998 20.65 75-79 22.705000000000002 28.415000000000003 28.84 20.04 80-84 23.085 28.000000000000004 28.449999999999996 20.465 85-89 22.615 28.785 28.24 20.36 90-94 23.035 28.345 28.389999999999997 20.23 95-99 23.1 28.139999999999997 28.470000000000002 20.29 100-104 23.29 28.48 28.1 20.13 105-109 23.455000000000002 28.38 28.389999999999997 19.775000000000002 110-114 23.72 28.675 27.755000000000003 19.85 115-119 23.945 28.18 27.985 19.89 120-124 23.599999999999998 28.555000000000003 28.215 19.63 125-129 24.005000000000003 28.815 27.55 19.63 130-134 24.505 28.875 27.405 19.215 135-139 25.025 28.810000000000002 26.82 19.345000000000002 140-144 25.374999999999996 28.405 27.034999999999997 19.185 145-149 25.06 28.544999999999998 26.995 19.400000000000002 150-151 26.0 28.7 26.900000000000002 18.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 2.5 23 2.5 24 2.5 25 3.5 26 7.5 27 11.5 28 12.0 29 17.0 30 21.5 31 28.0 32 41.0 33 53.5 34 57.5 35 67.5 36 105.5 37 135.0 38 150.5 39 176.5 40 200.5 41 234.0 42 273.0 43 276.5 44 267.5 45 272.5 46 269.0 47 241.5 48 199.0 49 170.5 50 150.5 51 117.5 52 99.0 53 87.0 54 62.0 55 46.5 56 33.5 57 22.0 58 16.5 59 12.5 60 9.5 61 9.0 62 10.0 63 6.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.6124999999999998 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.65 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.6624999999999996 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.487500000000001 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 6.2 0.0 0.0 0.0 0.0 128-129 6.95 0.0 0.0 0.0 0.0 130-131 7.6 0.0 0.0 0.0 0.0 132-133 8.275 0.0 0.0 0.0 0.0 134-135 8.837499999999999 0.0 0.0 0.0 0.0 136-137 9.2875 0.0 0.0 0.0 0.0 138-139 9.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra Read 1012356 spots for SRR7171106.sra Written 1012356 spots for SRR7171106.sra Read 1012347 spots for SRR7171106.sra Written 1012347 spots for SRR7171106.sra SRR ids: ['SRR7171106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g96u71zn SRR7171106.sra spots: 20246949 blocks: [[1, 1012347], [1012348, 2024694], [2024695, 3037041], [3037042, 4049388], [4049389, 5061735], [5061736, 6074082], [6074083, 7086429], [7086430, 8098776], [8098777, 9111123], [9111124, 10123470], [10123471, 11135817], [11135818, 12148164], [12148165, 13160511], [13160512, 14172858], [14172859, 15185205], [15185206, 16197552], [16197553, 17209899], [17209900, 18222246], [18222247, 19234593], [19234594, 20246949]] SRR7171106 file size 6839326 SRR7171106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171106 SRR7171106_1.fastq SRR7171106_2.fastq Input file: SRR7171106_1.fastq Paired file: SRR7171106_2.fastq trimmed: SRR7171106-trimmed-pair1.fastq, SRR7171106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:52:42 2025 >> started Fri Feb 14 04:53:05 2025 >> done (22.757s) 20246949 read pairs processed; of these: 27695 ( 0.14%) short read pairs filtered out after trimming by size control 32446 ( 0.16%) empty read pairs filtered out after trimming by size control 20186808 (99.70%) read pairs available; of these: 11434330 (56.64%) trimmed read pairs available after processing 8752478 (43.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 11 0.00% 21 13 0.00% 22 16 0.00% 23 23 0.00% 24 35 0.00% 25 36 0.00% 26 31 0.00% 27 26 0.00% 28 28 0.00% 29 29 0.00% 30 31 0.00% 31 23 0.00% 32 32 0.00% 33 23 0.00% 34 46 0.00% 35 33 0.00% 36 32 0.00% 37 38 0.00% 38 53 0.00% 39 59 0.00% 40 53 0.00% 41 77 0.00% 42 88 0.00% 43 98 0.00% 44 110 0.00% 45 92 0.00% 46 121 0.00% 47 165 0.00% 48 155 0.00% 49 193 0.00% 50 242 0.00% 51 276 0.00% 52 269 0.00% 53 308 0.00% 54 341 0.00% 55 331 0.00% 56 440 0.00% 57 462 0.00% 58 524 0.00% 59 614 0.00% 60 702 0.00% 61 736 0.00% 62 884 0.00% 63 1013 0.01% 64 1050 0.01% 65 1168 0.01% 66 1213 0.01% 67 1366 0.01% 68 1437 0.01% 69 1732 0.01% 70 1921 0.01% 71 2218 0.01% 72 2525 0.01% 73 2711 0.01% 74 3197 0.02% 75 3564 0.02% 76 4087 0.02% 77 4555 0.02% 78 4714 0.02% 79 5023 0.02% 80 5645 0.03% 81 6278 0.03% 82 7194 0.04% 83 7863 0.04% 84 10092 0.05% 85 11025 0.05% 86 12112 0.06% 87 13218 0.07% 88 13943 0.07% 89 14410 0.07% 90 15551 0.08% 91 16702 0.08% 92 17504 0.09% 93 19340 0.10% 94 20595 0.10% 95 21860 0.11% 96 22735 0.11% 97 24040 0.12% 98 25241 0.13% 99 25987 0.13% 100 27886 0.14% 101 28887 0.14% 102 30768 0.15% 103 32503 0.16% 104 34371 0.17% 105 36136 0.18% 106 37984 0.19% 107 38667 0.19% 108 39858 0.20% 109 41505 0.21% 110 42944 0.21% 111 44591 0.22% 112 46110 0.23% 113 48127 0.24% 114 49678 0.25% 115 52342 0.26% 116 53104 0.26% 117 54958 0.27% 118 56482 0.28% 119 57348 0.28% 120 58931 0.29% 121 60984 0.30% 122 62141 0.31% 123 64955 0.32% 124 67550 0.33% 125 69210 0.34% 126 71501 0.35% 127 73073 0.36% 128 75294 0.37% 129 77549 0.38% 130 79899 0.40% 131 82241 0.41% 132 85403 0.42% 133 89709 0.44% 134 93908 0.47% 135 99257 0.49% 136 105285 0.52% 137 110449 0.55% 138 116317 0.58% 139 125377 0.62% 140 133800 0.66% 141 147069 0.73% 142 163509 0.81% 143 184368 0.91% 144 214209 1.06% 145 253607 1.26% 146 313470 1.55% 147 419411 2.08% 148 624549 3.09% 149 1182234 5.86% 150 4912079 24.33% 151 8752478 43.36% 20186808 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=6 prefix-density=0.37 prefix-fanout=3.6 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=14.63 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=1.6 sequence=GTGCAAGTGGACAGGGGAGAGAAGACGATGGTAGCTAAGAGAATGCATGCGATAAGAAAGGCCTTCATCTTGGAAATATATGGGACTAACATGGTTATGCTCTCCTATATCTCCACC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=25 prefix-density=0.65 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=58.64 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7171106 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:53:55 Started mapping on | Feb 14 04:53:55 Finished on | Feb 14 04:56:53 Mapping speed, Million of reads per hour | 408.27 Number of input reads | 20186808 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18762245 Uniquely mapped reads % | 92.94% Average mapped length | 290.14 Number of splices: Total | 18001075 Number of splices: Annotated (sjdb) | 17514450 Number of splices: GT/AG | 17657850 Number of splices: GC/AG | 255270 Number of splices: AT/AC | 11323 Number of splices: Non-canonical | 76632 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 621651 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 79354 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 829775 829775 829775 N_multimapping 621651 621651 621651 N_noFeature 853425 18451440 985321 N_ambiguous 356886 1275 177354 UnstrandedReadsAssigned:17551934 PositiveStrandReadsAssigned:309530 NegativeStrandReadsAssigned:17599570 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171106-trimmed-pair1.fastq SRR7171106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,186,808 reads, 17,530,869 reads pseudoaligned [quant] estimated average fragment length: 225.588 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7171106.ke.tsv 34699 SRR7171106.se.tsv 87100 total ==> SRR7171106.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.41 1447 43.2672 Potri.005G024800.1.v4.1 1035 810.412 446 29.5121 Potri.004G059700.1.v4.1 961 736.417 9 0.655374 Potri.007G009000.2.v4.1 1416 1191.41 0 0 Potri.003G141000.2.v4.1 2943 2718.41 1161 22.9027 Potri.016G087400.1.v4.1 270 87.7542 1514 925.185 Potri.015G069301.1.v4.1 564 343.107 0 0 Potri.010G195200.1.v4.1 1773 1548.41 494 17.1085 Potri.012G127500.1.v4.1 977 752.412 66 4.70391 ==> SRR7171106.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 708 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 190 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7171106 completed mapping pipeline successfully