Starting /dee2/code/volunteer_pipeline.sh SRR7171107 current disk space = 3085848592384 free memory = 1579947152 SRR7171107 SRAfilesize c065d7c50b16675a53189e0de657f568 SRR7171107.sra SRR7171107.sra file validated SRR7171107 is paired end SRR7171107 is conventional basespace SRR7171107 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171107_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.04925 18.0 18.0 18.0 18.0 32.0 2 25.9285 27.0 25.0 27.0 18.0 29.0 3 26.22575 27.0 25.0 29.0 18.0 31.0 4 30.00275 31.0 29.0 31.0 27.0 33.0 5 31.51525 32.0 32.0 33.0 30.0 33.0 6 35.66525 37.0 35.0 38.0 31.0 38.0 7 36.844 38.0 37.0 38.0 34.0 38.0 8 36.85925 38.0 37.0 38.0 34.0 38.0 9 37.1245 38.0 38.0 38.0 36.0 38.0 10-14 37.275000000000006 38.0 38.0 38.0 36.2 38.0 15-19 37.37985 38.0 38.0 38.0 36.4 38.0 20-24 37.42555 38.0 38.0 38.0 36.8 38.0 25-29 37.509550000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.513999999999996 38.0 38.0 38.0 37.2 38.0 35-39 37.52205 38.0 38.0 38.0 37.0 38.0 40-44 37.461800000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.446450000000006 38.0 38.0 38.0 37.0 38.0 50-54 36.899 38.0 37.8 38.0 35.4 38.0 55-59 35.718900000000005 38.0 35.6 38.0 29.6 38.0 60-64 37.0486 38.0 38.0 38.0 35.6 38.0 65-69 37.07875 38.0 38.0 38.0 36.0 38.0 70-74 36.92965 38.0 38.0 38.0 35.0 38.0 75-79 36.841100000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.90915 38.0 38.0 38.0 35.0 38.0 85-89 36.613600000000005 38.0 37.8 38.0 34.2 38.0 90-94 36.359049999999996 38.0 37.0 38.0 34.0 38.0 95-99 36.32225 38.0 37.0 38.0 33.8 38.0 100-104 36.371 38.0 37.0 38.0 34.0 38.0 105-109 36.232099999999996 38.0 37.0 38.0 33.4 38.0 110-114 35.964299999999994 38.0 36.8 38.0 32.2 38.0 115-119 35.50115 38.0 36.0 38.0 30.6 38.0 120-124 35.352549999999994 38.0 36.0 38.0 29.4 38.0 125-129 35.1846 38.0 35.4 38.0 28.6 38.0 130-134 32.33025 36.0 29.0 38.0 21.4 38.0 135-139 34.03335 38.0 34.0 38.0 23.4 38.0 140-144 33.53075 38.0 34.0 38.0 21.4 38.0 145-149 32.638850000000005 37.4 33.2 38.0 15.6 38.0 150-151 27.896 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 4.0 19 3.0 20 3.0 21 2.0 22 7.0 23 0.0 24 10.0 25 6.0 26 14.0 27 18.0 28 26.0 29 28.0 30 37.0 31 75.0 32 95.0 33 158.0 34 271.0 35 591.0 36 1562.0 37 1084.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.794946038431167 39.194524874967094 8.765464595946302 31.245064490655434 2 20.525 19.0 37.15 23.325000000000003 3 19.525000000000002 23.7 27.450000000000003 29.325000000000003 4 22.125 31.25 23.400000000000002 23.225 5 22.45 34.975 23.925 18.65 6 16.950000000000003 35.875 27.275 19.900000000000002 7 13.625000000000002 22.5 45.375 18.5 8 17.025000000000002 22.6 33.375 27.0 9 18.2 23.9 33.15 24.75 10-14 20.04 30.175 27.045 22.74 15-19 19.384999999999998 29.544999999999998 27.689999999999998 23.380000000000003 20-24 19.535 29.075 28.205000000000002 23.185 25-29 19.695 28.765 28.205000000000002 23.335 30-34 19.625 28.970000000000002 28.035 23.369999999999997 35-39 19.900000000000002 29.604999999999997 27.029999999999998 23.465 40-44 19.665 29.485 27.665 23.185 45-49 19.675 29.110000000000003 27.805000000000003 23.41 50-54 19.56 28.945 27.834999999999997 23.66 55-59 20.32 29.060000000000002 27.36 23.26 60-64 19.82 28.615000000000002 28.03 23.535 65-69 20.13 28.685 27.715 23.47 70-74 19.935 28.825 27.915 23.325000000000003 75-79 20.630000000000003 28.73 27.51 23.13 80-84 19.97 28.549999999999997 27.43 24.05 85-89 20.405 28.694999999999997 27.529999999999998 23.369999999999997 90-94 20.47 28.444999999999997 27.950000000000003 23.135 95-99 20.02 27.99 28.1 23.89 100-104 20.53 28.294999999999998 27.965 23.21 105-109 20.794999999999998 28.544999999999998 27.744999999999997 22.915 110-114 20.66 28.1 27.875 23.365 115-119 20.805 28.999999999999996 27.24 22.955000000000002 120-124 20.880000000000003 28.92 26.295 23.905 125-129 21.3 28.084999999999997 26.41 24.205 130-134 20.555 28.544999999999998 27.195000000000004 23.705000000000002 135-139 21.21 28.139999999999997 27.16 23.49 140-144 20.715 28.715000000000003 26.919999999999998 23.65 145-149 21.2 28.73 26.22 23.849999999999998 150-151 20.474999999999998 29.475 26.025 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 2.5 24 3.5 25 5.0 26 6.0 27 8.5 28 12.5 29 19.0 30 33.0 31 38.5 32 56.0 33 76.5 34 79.5 35 96.5 36 125.5 37 135.5 38 147.0 39 165.0 40 186.0 41 197.5 42 231.0 43 270.5 44 255.5 45 250.5 46 223.0 47 213.5 48 218.5 49 183.5 50 159.5 51 134.0 52 100.5 53 76.0 54 72.0 55 61.0 56 38.5 57 28.0 58 24.0 59 19.0 60 12.5 61 7.5 62 6.5 63 5.5 64 2.5 65 1.0 66 1.0 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7319535588086825 1.4500000000000002 3 0.0757193336698637 0.22499999999999998 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3499999999999996 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.95 0.0 0.0 0.0 0.0 118-119 4.387499999999999 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.35 0.0 0.0 0.0 0.0 124-125 5.8375 0.0 0.0 0.0 0.0 126-127 6.15 0.0 0.0 0.0 0.0 128-129 6.7125 0.0 0.0 0.0 0.0 130-131 7.262499999999999 0.0 0.0 0.0 0.0 132-133 7.9375 0.0 0.0 0.0 0.0 134-135 8.5625 0.0 0.0 0.0 0.0 136-137 9.3375 0.0 0.0 0.0 0.0 138-139 10.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACAC 10 0.006836113 144.9625 9 ACGTCTG 30 0.0017991947 72.48125 145 >>END_MODULE SRR7171107 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171107_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50375 33.0 33.0 34.0 32.0 34.0 2 32.79625 33.0 33.0 34.0 32.0 34.0 3 30.31175 33.0 30.0 34.0 18.0 34.0 4 32.13925 33.0 32.0 34.0 28.0 34.0 5 32.72525 33.0 33.0 34.0 32.0 34.0 6 37.23525 38.0 38.0 38.0 37.0 38.0 7 37.18575 38.0 38.0 38.0 37.0 38.0 8 37.32575 38.0 38.0 38.0 37.0 38.0 9 37.4315 38.0 38.0 38.0 37.0 38.0 10-14 37.4039 38.0 38.0 38.0 37.4 38.0 15-19 37.37845 38.0 38.0 38.0 37.0 38.0 20-24 37.12075 38.0 38.0 38.0 36.6 38.0 25-29 36.9644 38.0 38.0 38.0 36.0 38.0 30-34 37.147149999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.24435 38.0 38.0 38.0 37.0 38.0 40-44 37.3257 38.0 38.0 38.0 37.0 38.0 45-49 37.28935 38.0 38.0 38.0 37.0 38.0 50-54 37.2444 38.0 38.0 38.0 37.0 38.0 55-59 37.2231 38.0 38.0 38.0 36.8 38.0 60-64 37.1703 38.0 38.0 38.0 36.6 38.0 65-69 37.08895 38.0 38.0 38.0 36.4 38.0 70-74 37.0895 38.0 38.0 38.0 36.0 38.0 75-79 37.0569 38.0 38.0 38.0 36.0 38.0 80-84 36.8024 38.0 38.0 38.0 35.2 38.0 85-89 36.73085 38.0 38.0 38.0 35.2 38.0 90-94 36.80975 38.0 38.0 38.0 35.4 38.0 95-99 36.74875 38.0 38.0 38.0 35.0 38.0 100-104 36.46925 38.0 38.0 38.0 34.2 38.0 105-109 36.25545 38.0 38.0 38.0 33.8 38.0 110-114 34.6317 37.8 34.0 38.0 27.4 38.0 115-119 35.66845 38.0 36.2 38.0 31.4 38.0 120-124 35.7957 38.0 36.6 38.0 32.4 38.0 125-129 35.4879 38.0 36.0 38.0 31.0 38.0 130-134 35.183749999999996 38.0 35.8 38.0 29.4 38.0 135-139 34.8183 38.0 35.4 38.0 28.6 38.0 140-144 34.2374 38.0 33.4 38.0 25.8 38.0 145-149 33.39435 38.0 33.0 38.0 21.8 38.0 150-151 28.177124999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 2.0 12 0.0 13 3.0 14 1.0 15 3.0 16 1.0 17 1.0 18 1.0 19 3.0 20 6.0 21 5.0 22 2.0 23 12.0 24 6.0 25 14.0 26 8.0 27 15.0 28 17.0 29 35.0 30 42.0 31 51.0 32 87.0 33 98.0 34 173.0 35 324.0 36 824.0 37 2259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.85 20.325 12.75 28.075 2 26.05 24.125 33.074999999999996 16.75 3 20.599999999999998 28.225 31.324999999999996 19.85 4 25.624999999999996 34.050000000000004 22.2 18.125 5 25.324999999999996 36.925000000000004 21.25 16.5 6 19.625 39.050000000000004 23.525 17.8 7 18.925 19.75 40.5 20.825 8 22.95 23.95 26.875 26.224999999999998 9 21.825 25.275 28.425 24.474999999999998 10-14 23.43 28.535 26.015 22.02 15-19 23.07 28.849999999999998 27.16 20.919999999999998 20-24 23.215 28.17 27.83 20.785 25-29 23.94 27.750000000000004 27.935 20.375 30-34 23.34 27.845 28.360000000000003 20.455000000000002 35-39 22.830000000000002 28.17 28.32 20.68 40-44 23.135 28.189999999999998 27.96 20.715 45-49 23.28 28.425 27.405 20.89 50-54 23.1 28.185 28.15 20.565 55-59 23.57 27.845 27.62 20.965 60-64 23.285 27.415 28.43 20.87 65-69 24.044999999999998 27.92 27.605 20.43 70-74 23.31 28.444999999999997 27.51 20.735 75-79 23.135 27.91 27.865000000000002 21.09 80-84 23.665 27.939999999999998 27.985 20.41 85-89 23.41 28.09 27.644999999999996 20.855 90-94 23.565 27.939999999999998 27.935 20.560000000000002 95-99 23.29 28.095 28.155 20.46 100-104 23.59 27.925 27.855 20.630000000000003 105-109 23.830000000000002 27.650000000000002 28.194999999999997 20.325 110-114 23.835 28.185 27.87 20.11 115-119 24.785 27.92 27.38 19.915 120-124 24.725 28.4 27.084999999999997 19.79 125-129 24.525 28.27 27.245 19.96 130-134 24.77 27.189999999999998 27.725 20.315 135-139 24.95 27.334999999999997 27.83 19.885 140-144 25.185000000000002 28.194999999999997 27.42 19.2 145-149 25.745 27.805000000000003 27.29 19.16 150-151 25.3 27.1625 27.737499999999997 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.0 25 5.0 26 6.5 27 6.5 28 11.0 29 15.5 30 17.0 31 22.0 32 31.5 33 36.5 34 50.5 35 67.5 36 84.0 37 112.0 38 142.5 39 157.0 40 184.0 41 230.5 42 246.5 43 255.5 44 275.0 45 268.0 46 242.0 47 221.5 48 232.5 49 213.0 50 163.5 51 135.0 52 109.0 53 98.5 54 91.5 55 68.5 56 47.5 57 46.5 58 36.0 59 21.5 60 14.0 61 10.5 62 9.0 63 4.5 64 3.0 65 2.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95965490992134 97.5 2 0.9134737376300432 1.7999999999999998 3 0.050748540979446845 0.15 4 0.0 0.0 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.025374270489723422 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025374270489723422 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 10 0.25 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.65 0.0 0.0 0.0 0.0 112-113 2.9875 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 4.025 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 4.95 0.0 0.0 0.0 0.0 122-123 5.4375 0.0 0.0 0.0 0.0 124-125 6.0 0.0 0.0 0.0 0.0 126-127 6.4 0.0 0.0 0.0 0.0 128-129 7.0375 0.0 0.0 0.0 0.0 130-131 7.65 0.0 0.0 0.0 0.0 132-133 8.3 0.0 0.0 0.0 0.0 134-135 8.9375 0.0 0.0 0.0 0.0 136-137 9.7875 0.0 0.0 0.0 0.0 138-139 10.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATGA 10 0.006830828 145.0 9 CGTGTAG 30 0.0017973486 72.5 145 >>END_MODULE Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688804 spots for SRR7171107.sra Written 688804 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra Read 688794 spots for SRR7171107.sra Written 688794 spots for SRR7171107.sra SRR ids: ['SRR7171107.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j11tcl_5 SRR7171107.sra spots: 13775890 blocks: [[1, 688794], [688795, 1377588], [1377589, 2066382], [2066383, 2755176], [2755177, 3443970], [3443971, 4132764], [4132765, 4821558], [4821559, 5510352], [5510353, 6199146], [6199147, 6887940], [6887941, 7576734], [7576735, 8265528], [8265529, 8954322], [8954323, 9643116], [9643117, 10331910], [10331911, 11020704], [11020705, 11709498], [11709499, 12398292], [12398293, 13087086], [13087087, 13775890]] SRR7171107 file size 4646496 SRR7171107 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171107 SRR7171107_1.fastq SRR7171107_2.fastq Input file: SRR7171107_1.fastq Paired file: SRR7171107_2.fastq trimmed: SRR7171107-trimmed-pair1.fastq, SRR7171107-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:34:29 2025 >> started Fri Feb 14 05:34:44 2025 >> done (14.492s) 13775890 read pairs processed; of these: 5914 ( 0.04%) short read pairs filtered out after trimming by size control 12278 ( 0.09%) empty read pairs filtered out after trimming by size control 13757698 (99.87%) read pairs available; of these: 8205002 (59.64%) trimmed read pairs available after processing 5552696 (40.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 1 0.00% 22 7 0.00% 23 7 0.00% 24 6 0.00% 25 7 0.00% 26 7 0.00% 27 11 0.00% 28 6 0.00% 29 8 0.00% 30 7 0.00% 31 32 0.00% 32 8 0.00% 33 8 0.00% 34 9 0.00% 35 6 0.00% 36 13 0.00% 37 17 0.00% 38 15 0.00% 39 20 0.00% 40 25 0.00% 41 19 0.00% 42 35 0.00% 43 23 0.00% 44 31 0.00% 45 24 0.00% 46 50 0.00% 47 50 0.00% 48 46 0.00% 49 58 0.00% 50 89 0.00% 51 84 0.00% 52 97 0.00% 53 101 0.00% 54 149 0.00% 55 144 0.00% 56 161 0.00% 57 163 0.00% 58 204 0.00% 59 254 0.00% 60 263 0.00% 61 314 0.00% 62 314 0.00% 63 391 0.00% 64 409 0.00% 65 453 0.00% 66 515 0.00% 67 534 0.00% 68 641 0.00% 69 771 0.01% 70 898 0.01% 71 1032 0.01% 72 1182 0.01% 73 1328 0.01% 74 1502 0.01% 75 1772 0.01% 76 1976 0.01% 77 2226 0.02% 78 2320 0.02% 79 2571 0.02% 80 2992 0.02% 81 3351 0.02% 82 3835 0.03% 83 4401 0.03% 84 5279 0.04% 85 5772 0.04% 86 6385 0.05% 87 6954 0.05% 88 7386 0.05% 89 7912 0.06% 90 8599 0.06% 91 9365 0.07% 92 10086 0.07% 93 11657 0.08% 94 12322 0.09% 95 13286 0.10% 96 13811 0.10% 97 14441 0.10% 98 15314 0.11% 99 16279 0.12% 100 17703 0.13% 101 18101 0.13% 102 19928 0.14% 103 20880 0.15% 104 22216 0.16% 105 23703 0.17% 106 24865 0.18% 107 25612 0.19% 108 26527 0.19% 109 28087 0.20% 110 28882 0.21% 111 30009 0.22% 112 31231 0.23% 113 32945 0.24% 114 34449 0.25% 115 36345 0.26% 116 37753 0.27% 117 37850 0.28% 118 39306 0.29% 119 40041 0.29% 120 41661 0.30% 121 42060 0.31% 122 43650 0.32% 123 45876 0.33% 124 47626 0.35% 125 48823 0.35% 126 50669 0.37% 127 52044 0.38% 128 53848 0.39% 129 55628 0.40% 130 57322 0.42% 131 58219 0.42% 132 60628 0.44% 133 63600 0.46% 134 66770 0.49% 135 70709 0.51% 136 74362 0.54% 137 78907 0.57% 138 83552 0.61% 139 89755 0.65% 140 95982 0.70% 141 105604 0.77% 142 117782 0.86% 143 133065 0.97% 144 157982 1.15% 145 189547 1.38% 146 236845 1.72% 147 322228 2.34% 148 493973 3.59% 149 948088 6.89% 150 3438908 25.00% 151 5552696 40.36% 13757698 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=9 prefix-density=0.70 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=60.01 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=1.51 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=19 prefix-density=1.50 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=30.55 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.8 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171107 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:35:28 Started mapping on | Feb 14 05:35:28 Finished on | Feb 14 05:37:20 Mapping speed, Million of reads per hour | 442.21 Number of input reads | 13757698 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12789162 Uniquely mapped reads % | 92.96% Average mapped length | 290.60 Number of splices: Total | 12126386 Number of splices: Annotated (sjdb) | 11870590 Number of splices: GT/AG | 11892457 Number of splices: GC/AG | 188807 Number of splices: AT/AC | 8439 Number of splices: Non-canonical | 36683 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305727 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 26876 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 670819 670819 670819 N_multimapping 305727 305727 305727 N_noFeature 445314 12487123 544591 N_ambiguous 283128 747 80008 UnstrandedReadsAssigned:12060720 PositiveStrandReadsAssigned:301292 NegativeStrandReadsAssigned:12164563 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171107 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171107-trimmed-pair1.fastq SRR7171107-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,757,698 reads, 12,102,601 reads pseudoaligned [quant] estimated average fragment length: 220.345 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7171107.ke.tsv 34699 SRR7171107.se.tsv 87100 total ==> SRR7171107.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.66 359 11.7899 Potri.005G024800.1.v4.1 1035 815.655 188 13.6149 Potri.004G059700.1.v4.1 961 741.67 17 1.35395 Potri.007G009000.2.v4.1 1416 1196.66 0 0 Potri.003G141000.2.v4.1 2943 2723.66 649.447 14.085 Potri.016G087400.1.v4.1 270 89.1392 746.604 494.75 Potri.015G069301.1.v4.1 564 347.413 0 0 Potri.010G195200.1.v4.1 1773 1553.66 11 0.418218 Potri.012G127500.1.v4.1 977 757.665 55 4.28795 ==> SRR7171107.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 402 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7171107 completed mapping pipeline successfully