Starting /dee2/code/volunteer_pipeline.sh SRR7171108 current disk space = 3085743951872 free memory = 1582502240 SRR7171108 SRAfilesize c043b20f0ba1a08620a76d854b404ab8 SRR7171108.sra SRR7171108.sra file validated SRR7171108 is paired end SRR7171108 is conventional basespace SRR7171108 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171108_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.073 18.0 18.0 30.0 18.0 32.0 2 30.19325 31.0 29.0 33.0 27.0 33.0 3 31.3785 33.0 31.0 33.0 28.0 33.0 4 32.09975 33.0 33.0 33.0 31.0 34.0 5 32.79675 33.0 33.0 34.0 31.0 34.0 6 37.0275 38.0 37.0 38.0 36.0 38.0 7 37.318 38.0 38.0 38.0 36.0 38.0 8 37.34925 38.0 38.0 38.0 37.0 38.0 9 37.397 38.0 38.0 38.0 37.0 38.0 10-14 37.433550000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.468650000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.49445000000001 38.0 38.0 38.0 37.2 38.0 25-29 37.011449999999996 38.0 38.0 38.0 35.0 38.0 30-34 37.155150000000006 38.0 38.0 38.0 35.4 38.0 35-39 36.1444 38.0 36.2 38.0 31.0 38.0 40-44 37.20365 38.0 38.0 38.0 36.6 38.0 45-49 36.6372 38.0 37.4 38.0 34.2 38.0 50-54 37.0657 38.0 38.0 38.0 36.0 38.0 55-59 37.0466 38.0 38.0 38.0 36.0 38.0 60-64 36.33155000000001 38.0 37.4 38.0 32.6 38.0 65-69 35.76425 38.0 35.6 38.0 30.2 38.0 70-74 36.25725 38.0 37.4 38.0 32.0 38.0 75-79 36.6241 38.0 37.8 38.0 34.4 38.0 80-84 36.595600000000005 38.0 38.0 38.0 34.4 38.0 85-89 35.3983 37.8 35.4 38.0 30.0 38.0 90-94 35.61625 38.0 36.0 38.0 30.8 38.0 95-99 35.05195 38.0 35.8 38.0 24.4 38.0 100-104 35.90535 38.0 36.8 38.0 31.8 38.0 105-109 35.874100000000006 38.0 37.0 38.0 32.6 38.0 110-114 34.83215 38.0 35.2 38.0 25.6 38.0 115-119 31.848400000000005 34.8 28.4 37.8 22.4 38.0 120-124 35.17915000000001 38.0 36.0 38.0 29.0 38.0 125-129 34.82695 38.0 35.4 38.0 28.0 38.0 130-134 33.7153 38.0 33.0 38.0 21.6 38.0 135-139 33.83434999999999 38.0 33.0 38.0 23.2 38.0 140-144 33.1964 38.0 33.0 38.0 18.6 38.0 145-149 29.1747 35.0 24.4 38.0 5.6 38.0 150-151 24.978875000000002 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 2.0 12 1.0 13 3.0 14 1.0 15 1.0 16 0.0 17 3.0 18 7.0 19 9.0 20 4.0 21 8.0 22 5.0 23 10.0 24 13.0 25 13.0 26 26.0 27 26.0 28 37.0 29 59.0 30 84.0 31 77.0 32 131.0 33 195.0 34 320.0 35 614.0 36 1374.0 37 975.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.858304906848595 13.041196536342166 11.493046444502756 35.60745211230648 2 18.825 19.825 35.0 26.35 3 17.875 26.025 28.349999999999998 27.750000000000004 4 21.575 33.650000000000006 22.475 22.3 5 21.605401350337583 35.98399599899975 24.081020255063766 18.3295823955989 6 16.575 36.5 27.075 19.85 7 13.325000000000001 24.099999999999998 44.275 18.3 8 17.775 22.325 31.6 28.299999999999997 9 17.1 24.575 33.25 25.074999999999996 10-14 20.294999999999998 29.68 26.58 23.445 15-19 19.525000000000002 28.315 28.34 23.82 20-24 19.365 28.655 28.355000000000004 23.625 25-29 18.935 29.195 28.095 23.775 30-34 20.294999999999998 28.799999999999997 27.935 22.97 35-39 19.8 29.015 27.83 23.355 40-44 19.77 29.544999999999998 27.665 23.02 45-49 19.7 29.175 27.87 23.255 50-54 20.14 28.720000000000002 27.805000000000003 23.335 55-59 19.855 28.705000000000002 28.025 23.415 60-64 19.56 28.82 28.01 23.61 65-69 19.8 28.29 28.32 23.59 70-74 19.685 29.049999999999997 27.54 23.724999999999998 75-79 19.975 29.154999999999998 27.55 23.32 80-84 20.511025551277566 28.8064403220161 27.621381069053452 23.061153057652884 85-89 19.56 28.945 27.98 23.515 90-94 20.145 29.049999999999997 27.33 23.474999999999998 95-99 20.3 28.975 27.450000000000003 23.275000000000002 100-104 20.43 28.810000000000002 27.445000000000004 23.315 105-109 20.735 27.985 27.375 23.905 110-114 20.755000000000003 28.64 27.58 23.025000000000002 115-119 20.93 28.9 26.834999999999997 23.335 120-124 20.59 29.104999999999997 26.479999999999997 23.825 125-129 20.94 28.384999999999998 26.640000000000004 24.035 130-134 21.215 28.694999999999997 26.195 23.895 135-139 21.82 28.17 26.035000000000004 23.974999999999998 140-144 21.16 27.985 26.14 24.715 145-149 20.71 28.044999999999998 26.424999999999997 24.82 150-151 21.25265658207276 27.91598949868734 26.60332541567696 24.228028503562946 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 4.5 25 5.0 26 5.5 27 9.0 28 13.5 29 17.0 30 21.5 31 32.0 32 46.0 33 56.5 34 63.5 35 82.0 36 104.5 37 122.5 38 147.0 39 178.0 40 207.0 41 227.5 42 251.0 43 268.0 44 273.5 45 257.5 46 249.5 47 243.5 48 212.0 49 176.0 50 141.0 51 118.0 52 105.5 53 89.0 54 66.0 55 52.0 56 39.5 57 29.0 58 22.0 59 15.0 60 10.0 61 5.5 62 5.0 63 5.0 64 4.0 65 3.5 66 2.5 67 2.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74905897114178 99.375 2 0.20075282308657463 0.4 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02509410288582183 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7875 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.3625 0.0 0.0 0.0 0.0 92-93 1.5499999999999998 0.0 0.0 0.0 0.0 94-95 1.7999999999999998 0.0 0.0 0.0 0.0 96-97 2.0625 0.0 0.0 0.0 0.0 98-99 2.25 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 3.1875 0.0 0.0 0.0 0.0 104-105 3.625 0.0 0.0 0.0 0.0 106-107 3.9375 0.0 0.0 0.0 0.0 108-109 4.3375 0.0 0.0 0.0 0.0 110-111 4.7625 0.0 0.0 0.0 0.0 112-113 5.1125 0.0 0.0 0.0 0.0 114-115 5.6125 0.0 0.0 0.0 0.0 116-117 6.4125 0.0 0.0 0.0 0.0 118-119 7.125 0.0 0.0 0.0 0.0 120-121 7.5625 0.0 0.0 0.0 0.0 122-123 8.375 0.0 0.0 0.0 0.0 124-125 9.1875 0.0 0.0 0.0 0.0 126-127 9.8875 0.0 0.0 0.0 0.0 128-129 10.837499999999999 0.0 0.0 0.0 0.0 130-131 11.825 0.0 0.0 0.0 0.0 132-133 12.4875 0.0 0.0 0.0 0.0 134-135 13.4 0.0 0.0 0.0 0.0 136-137 14.55 0.0 0.0 0.0 0.0 138-139 15.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171108 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171108_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76625 33.0 33.0 34.0 32.0 34.0 2 32.6275 33.0 33.0 34.0 32.0 34.0 3 32.8665 33.0 33.0 34.0 32.0 34.0 4 32.825 34.0 33.0 34.0 32.0 34.0 5 32.8405 34.0 33.0 34.0 32.0 34.0 6 37.01325 38.0 38.0 38.0 37.0 38.0 7 36.99875 38.0 38.0 38.0 37.0 38.0 8 37.0565 38.0 38.0 38.0 37.0 38.0 9 37.0095 38.0 38.0 38.0 37.0 38.0 10-14 36.919349999999994 38.0 38.0 38.0 36.4 38.0 15-19 36.96065 38.0 38.0 38.0 36.6 38.0 20-24 36.6537 38.0 38.0 38.0 35.2 38.0 25-29 36.911950000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.95875 38.0 38.0 38.0 36.8 38.0 35-39 36.903650000000006 38.0 38.0 38.0 36.8 38.0 40-44 36.7629 38.0 38.0 38.0 35.8 38.0 45-49 36.5484 38.0 38.0 38.0 35.2 38.0 50-54 36.70435 38.0 38.0 38.0 35.8 38.0 55-59 36.719800000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.58555 38.0 38.0 38.0 35.2 38.0 65-69 36.589 38.0 38.0 38.0 35.4 38.0 70-74 36.48695 38.0 38.0 38.0 34.8 38.0 75-79 36.34385 38.0 38.0 38.0 34.4 38.0 80-84 36.23844999999999 38.0 38.0 38.0 34.0 38.0 85-89 36.171549999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.1041 38.0 38.0 38.0 33.8 38.0 95-99 35.989 38.0 38.0 38.0 33.8 38.0 100-104 35.70075 38.0 37.4 38.0 32.8 38.0 105-109 35.51675 38.0 37.0 38.0 31.0 38.0 110-114 35.36024999999999 38.0 37.0 38.0 30.6 38.0 115-119 35.14255000000001 38.0 36.6 38.0 29.0 38.0 120-124 34.94395 38.0 36.0 38.0 28.8 38.0 125-129 34.40175000000001 38.0 35.6 38.0 26.0 38.0 130-134 34.0551 38.0 34.8 38.0 24.2 38.0 135-139 33.1846 38.0 33.2 38.0 17.6 38.0 140-144 31.84405 38.0 31.6 38.0 12.6 38.0 145-149 30.633850000000002 38.0 30.2 38.0 3.8 38.0 150-151 24.09075 29.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 4.0 4 5.0 5 5.0 6 4.0 7 3.0 8 1.0 9 1.0 10 6.0 11 3.0 12 6.0 13 1.0 14 1.0 15 3.0 16 2.0 17 6.0 18 4.0 19 12.0 20 15.0 21 9.0 22 9.0 23 15.0 24 11.0 25 16.0 26 20.0 27 25.0 28 25.0 29 41.0 30 61.0 31 73.0 32 80.0 33 131.0 34 218.0 35 308.0 36 796.0 37 2065.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.825 18.675 13.025 25.474999999999998 2 24.575 25.1 32.574999999999996 17.75 3 21.825 26.1 30.349999999999998 21.725 4 25.224999999999998 34.225 22.0 18.55 5 23.625 36.8 23.45 16.125 6 19.2 37.55 24.474999999999998 18.775 7 18.25 19.075 41.449999999999996 21.224999999999998 8 21.425 23.849999999999998 28.749999999999996 25.974999999999998 9 22.8 23.925 29.45 23.825 10-14 23.075000000000003 28.625 26.86 21.44 15-19 22.66 28.405 28.005000000000003 20.93 20-24 23.225 28.24 28.244999999999997 20.29 25-29 22.82 28.305000000000003 28.444999999999997 20.43 30-34 22.2 28.07 28.815 20.915 35-39 22.325 28.050000000000004 28.955 20.669999999999998 40-44 22.6 28.215 28.249999999999996 20.935000000000002 45-49 23.345 27.37 28.865000000000002 20.419999999999998 50-54 22.650000000000002 28.055000000000003 28.735 20.560000000000002 55-59 22.85 27.800000000000004 28.999999999999996 20.349999999999998 60-64 23.11 27.694999999999997 28.62 20.575 65-69 23.385 27.615000000000002 28.249999999999996 20.75 70-74 22.814999999999998 27.485 29.015 20.685000000000002 75-79 23.044999999999998 28.025 28.615000000000002 20.315 80-84 23.580000000000002 28.21 28.255000000000003 19.955000000000002 85-89 23.22 27.950000000000003 28.694999999999997 20.135 90-94 23.119999999999997 27.62 29.154999999999998 20.105 95-99 23.215 28.194999999999997 28.605000000000004 19.985 100-104 24.285 27.93 27.889999999999997 19.895 105-109 24.19 27.76 27.935 20.115 110-114 24.9 28.035 27.415 19.650000000000002 115-119 25.040000000000003 29.085 26.815 19.06 120-124 24.805 28.244999999999997 27.37 19.580000000000002 125-129 25.21 27.865000000000002 27.474999999999998 19.45 130-134 25.319999999999997 28.22 27.365000000000002 19.095000000000002 135-139 26.145000000000003 28.235 27.02 18.6 140-144 25.965 28.625 26.939999999999998 18.47 145-149 26.505000000000003 28.105000000000004 27.134999999999998 18.255 150-151 26.644161040260066 28.419604901225306 25.881470367591895 19.05476369092273 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.5 19 1.5 20 1.0 21 1.0 22 0.5 23 1.0 24 3.5 25 4.5 26 6.0 27 7.5 28 10.0 29 11.5 30 13.5 31 19.0 32 31.5 33 43.5 34 56.0 35 70.5 36 98.5 37 136.0 38 168.5 39 192.5 40 196.0 41 222.5 42 262.0 43 283.0 44 272.0 45 256.0 46 258.5 47 242.0 48 211.0 49 181.5 50 147.5 51 118.5 52 98.5 53 79.5 54 67.0 55 54.5 56 44.0 57 34.5 58 25.0 59 17.5 60 13.5 61 12.0 62 8.0 63 4.5 64 3.5 65 2.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54694185753839 98.875 2 0.4027183488547697 0.8 3 0.0 0.0 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025169896803423106 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3125 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0 0.0 0.0 0.0 0.0 88-89 1.175 0.0 0.0 0.0 0.0 90-91 1.475 0.0 0.0 0.0 0.0 92-93 1.6625 0.0 0.0 0.0 0.0 94-95 1.9375 0.0 0.0 0.0 0.0 96-97 2.2125 0.0 0.0 0.0 0.0 98-99 2.375 0.0 0.0 0.0 0.0 100-101 2.7625 0.0 0.0 0.0 0.0 102-103 3.3125 0.0 0.0 0.0 0.0 104-105 3.825 0.0 0.0 0.0 0.0 106-107 4.275 0.0 0.0 0.0 0.0 108-109 4.825 0.0 0.0 0.0 0.0 110-111 5.375 0.0 0.0 0.0 0.0 112-113 5.925000000000001 0.0 0.0 0.0 0.0 114-115 6.525 0.0 0.0 0.0 0.0 116-117 7.3375 0.0 0.0 0.0 0.0 118-119 8.025 0.0 0.0 0.0 0.0 120-121 8.475 0.0 0.0 0.0 0.0 122-123 9.3 0.0 0.0 0.0 0.0 124-125 10.1125 0.0 0.0 0.0 0.0 126-127 10.8625 0.0 0.0 0.0 0.0 128-129 11.825 0.0 0.0 0.0 0.0 130-131 12.8625 0.0 0.0 0.0 0.0 132-133 13.5125 0.0 0.0 0.0 0.0 134-135 14.4 0.0 0.0 0.0 0.0 136-137 15.600000000000001 0.0 0.0 0.0 0.0 138-139 16.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGAT 10 0.006830828 145.0 1 CTCAAAG 10 0.006830828 145.0 145 >>END_MODULE Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962697 spots for SRR7171108.sra Written 962697 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra Read 962682 spots for SRR7171108.sra Written 962682 spots for SRR7171108.sra SRR ids: ['SRR7171108.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rfxh2rd SRR7171108.sra spots: 19253655 blocks: [[1, 962682], [962683, 1925364], [1925365, 2888046], [2888047, 3850728], [3850729, 4813410], [4813411, 5776092], [5776093, 6738774], [6738775, 7701456], [7701457, 8664138], [8664139, 9626820], [9626821, 10589502], [10589503, 11552184], [11552185, 12514866], [12514867, 13477548], [13477549, 14440230], [14440231, 15402912], [15402913, 16365594], [16365595, 17328276], [17328277, 18290958], [18290959, 19253655]] SRR7171108 file size 6502731 SRR7171108 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171108 SRR7171108_1.fastq SRR7171108_2.fastq Input file: SRR7171108_1.fastq Paired file: SRR7171108_2.fastq trimmed: SRR7171108-trimmed-pair1.fastq, SRR7171108-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:45:22 2025 >> started Fri Feb 14 05:45:57 2025 >> done (34.810s) 19253655 read pairs processed; of these: 30005 ( 0.16%) short read pairs filtered out after trimming by size control 65281 ( 0.34%) empty read pairs filtered out after trimming by size control 19158369 (99.51%) read pairs available; of these: 12559493 (65.56%) trimmed read pairs available after processing 6598876 (34.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 18 0.00% 21 15 0.00% 22 14 0.00% 23 18 0.00% 24 14 0.00% 25 31 0.00% 26 31 0.00% 27 23 0.00% 28 28 0.00% 29 24 0.00% 30 35 0.00% 31 40 0.00% 32 47 0.00% 33 42 0.00% 34 48 0.00% 35 66 0.00% 36 69 0.00% 37 73 0.00% 38 96 0.00% 39 110 0.00% 40 130 0.00% 41 140 0.00% 42 149 0.00% 43 180 0.00% 44 181 0.00% 45 227 0.00% 46 265 0.00% 47 323 0.00% 48 346 0.00% 49 398 0.00% 50 425 0.00% 51 528 0.00% 52 590 0.00% 53 633 0.00% 54 672 0.00% 55 724 0.00% 56 789 0.00% 57 869 0.00% 58 1059 0.01% 59 1177 0.01% 60 1376 0.01% 61 1572 0.01% 62 1798 0.01% 63 2071 0.01% 64 2054 0.01% 65 2269 0.01% 66 2465 0.01% 67 2871 0.01% 68 3002 0.02% 69 3548 0.02% 70 4049 0.02% 71 4591 0.02% 72 5203 0.03% 73 5906 0.03% 74 6455 0.03% 75 7128 0.04% 76 8377 0.04% 77 8827 0.05% 78 9033 0.05% 79 10111 0.05% 80 11079 0.06% 81 12366 0.06% 82 13950 0.07% 83 15559 0.08% 84 18151 0.09% 85 19921 0.10% 86 20729 0.11% 87 22165 0.12% 88 23583 0.12% 89 24779 0.13% 90 26359 0.14% 91 28764 0.15% 92 31080 0.16% 93 33736 0.18% 94 35430 0.18% 95 37510 0.20% 96 38638 0.20% 97 39721 0.21% 98 40876 0.21% 99 42828 0.22% 100 44719 0.23% 101 46537 0.24% 102 49389 0.26% 103 52192 0.27% 104 54340 0.28% 105 56537 0.30% 106 57631 0.30% 107 58654 0.31% 108 59977 0.31% 109 60644 0.32% 110 62723 0.33% 111 64635 0.34% 112 67407 0.35% 113 69814 0.36% 114 71839 0.37% 115 74219 0.39% 116 75074 0.39% 117 76558 0.40% 118 77337 0.40% 119 77058 0.40% 120 79445 0.41% 121 81497 0.43% 122 83523 0.44% 123 86489 0.45% 124 89120 0.47% 125 91212 0.48% 126 93052 0.49% 127 94775 0.49% 128 96240 0.50% 129 97438 0.51% 130 99594 0.52% 131 102420 0.53% 132 105967 0.55% 133 110604 0.58% 134 115690 0.60% 135 121046 0.63% 136 127109 0.66% 137 133716 0.70% 138 139863 0.73% 139 148522 0.78% 140 157257 0.82% 141 169105 0.88% 142 184423 0.96% 143 203539 1.06% 144 231179 1.21% 145 267659 1.40% 146 323384 1.69% 147 419652 2.19% 148 624211 3.26% 149 1182854 6.17% 150 4801022 25.06% 151 6598876 34.44% 19158369 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=14.35 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.2 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=29 prefix-density=0.47 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=62.15 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.2 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATA SRR7171108 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:46:41 Started mapping on | Feb 14 05:46:42 Finished on | Feb 14 05:49:02 Mapping speed, Million of reads per hour | 492.64 Number of input reads | 19158369 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 17605191 Uniquely mapped reads % | 91.89% Average mapped length | 284.76 Number of splices: Total | 16199308 Number of splices: Annotated (sjdb) | 15720756 Number of splices: GT/AG | 15871661 Number of splices: GC/AG | 246179 Number of splices: AT/AC | 10846 Number of splices: Non-canonical | 70622 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 616402 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 165300 % of reads mapped to too many loci | 0.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.86% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 964910 964910 964910 N_multimapping 616402 616402 616402 N_noFeature 791950 17333647 915789 N_ambiguous 337822 1381 189357 UnstrandedReadsAssigned:16475419 PositiveStrandReadsAssigned:270163 NegativeStrandReadsAssigned:16500045 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7171108 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171108-trimmed-pair1.fastq SRR7171108-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,158,369 reads, 16,521,026 reads pseudoaligned [quant] estimated average fragment length: 215.108 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,268 rounds 52401 SRR7171108.ke.tsv 34699 SRR7171108.se.tsv 87100 total ==> SRR7171108.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.89 1566 54.7582 Potri.005G024800.1.v4.1 1035 820.892 327 25.1264 Potri.004G059700.1.v4.1 961 746.908 6 0.506701 Potri.007G009000.2.v4.1 1416 1201.89 0 0 Potri.003G141000.2.v4.1 2943 2728.89 1267.47 29.2968 Potri.016G087400.1.v4.1 270 100.433 1291 810.809 Potri.015G069301.1.v4.1 564 354.24 0 0 Potri.010G195200.1.v4.1 1773 1558.89 1003 40.5838 Potri.012G127500.1.v4.1 977 762.898 48 3.96865 ==> SRR7171108.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 375 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 49 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7171108 completed mapping pipeline successfully