Starting /dee2/code/volunteer_pipeline.sh SRR7171109 current disk space = 3085675270144 free memory = 1582300388 SRR7171109 SRAfilesize 7916155ba5b2db15372bc120b079e8ac SRR7171109.sra SRR7171109.sra file validated SRR7171109 is paired end SRR7171109 is conventional basespace SRR7171109 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171109_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.6685 18.0 18.0 30.0 18.0 32.0 2 30.79075 31.0 30.0 33.0 27.0 33.0 3 31.82425 33.0 31.0 33.0 29.0 33.0 4 32.01 33.0 33.0 33.0 29.0 34.0 5 32.60875 33.0 33.0 34.0 31.0 34.0 6 36.691 38.0 37.0 38.0 34.0 38.0 7 37.15475 38.0 38.0 38.0 36.0 38.0 8 37.2735 38.0 38.0 38.0 36.0 38.0 9 36.7805 38.0 38.0 38.0 35.0 38.0 10-14 37.295100000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.41495 38.0 38.0 38.0 37.0 38.0 20-24 37.3856 38.0 38.0 38.0 37.0 38.0 25-29 37.3626 38.0 38.0 38.0 37.0 38.0 30-34 37.3198 38.0 38.0 38.0 37.0 38.0 35-39 36.2963 38.0 37.0 38.0 31.2 38.0 40-44 36.7884 38.0 37.6 38.0 34.2 38.0 45-49 37.00385 38.0 38.0 38.0 35.6 38.0 50-54 37.047999999999995 38.0 38.0 38.0 36.0 38.0 55-59 35.623200000000004 37.8 35.6 38.0 30.0 38.0 60-64 36.90715 38.0 38.0 38.0 35.2 38.0 65-69 36.8057 38.0 38.0 38.0 35.0 38.0 70-74 36.633399999999995 38.0 38.0 38.0 34.6 38.0 75-79 36.6406 38.0 38.0 38.0 34.4 38.0 80-84 36.58565 38.0 38.0 38.0 34.4 38.0 85-89 36.29785 38.0 37.4 38.0 33.8 38.0 90-94 35.9478 38.0 37.0 38.0 32.6 38.0 95-99 36.135949999999994 38.0 37.0 38.0 33.4 38.0 100-104 36.1276 38.0 37.0 38.0 33.2 38.0 105-109 35.98455 38.0 37.0 38.0 33.0 38.0 110-114 35.47645 38.0 36.2 38.0 30.0 38.0 115-119 35.256150000000005 38.0 36.0 38.0 28.8 38.0 120-124 35.25605 38.0 36.0 38.0 28.8 38.0 125-129 35.158550000000005 38.0 35.8 38.0 28.4 38.0 130-134 32.2785 36.8 29.4 38.0 17.8 38.0 135-139 33.8764 37.8 34.2 38.0 23.0 38.0 140-144 33.777249999999995 38.0 34.0 38.0 22.6 38.0 145-149 32.85125 38.0 33.2 38.0 16.8 38.0 150-151 28.214 34.5 17.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 3.0 13 1.0 14 4.0 15 3.0 16 4.0 17 2.0 18 5.0 19 5.0 20 2.0 21 4.0 22 11.0 23 7.0 24 7.0 25 4.0 26 20.0 27 17.0 28 24.0 29 43.0 30 72.0 31 77.0 32 91.0 33 178.0 34 236.0 35 470.0 36 1156.0 37 1549.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.34436564223798 17.073811400052534 7.249802994483845 48.33201996322563 2 14.128532133033259 17.65441360340085 52.66316579144787 15.55388847211803 3 12.3 22.725 30.8 34.175 4 17.599999999999998 31.525 28.349999999999998 22.525000000000002 5 21.175 35.05 26.6 17.175 6 15.174999999999999 36.1 28.075 20.65 7 12.375 22.3 47.349999999999994 17.974999999999998 8 14.45 22.35 36.375 26.825 9 14.625 20.674999999999997 38.95 25.75 10-14 18.96 28.384999999999998 28.744999999999997 23.91 15-19 19.305 28.9 27.985 23.810000000000002 20-24 19.785 28.58 28.78 22.855 25-29 19.575 28.965000000000003 28.785 22.675 30-34 19.335 28.395 28.945 23.325000000000003 35-39 19.845 28.255000000000003 28.544999999999998 23.355 40-44 19.33 28.435 28.375 23.86 45-49 19.99 28.42 27.955000000000002 23.635 50-54 19.56 28.26 28.37 23.810000000000002 55-59 20.055 28.715000000000003 28.244999999999997 22.985 60-64 19.695 28.78 28.425 23.1 65-69 19.71 28.685 28.58 23.025000000000002 70-74 19.900000000000002 28.754999999999995 28.194999999999997 23.150000000000002 75-79 19.895 29.049999999999997 27.315 23.74 80-84 19.56 29.025000000000002 28.475 22.939999999999998 85-89 20.41 28.63 28.050000000000004 22.91 90-94 19.865 29.349999999999998 27.534999999999997 23.25 95-99 20.575 28.53 28.08 22.814999999999998 100-104 20.65 29.09 27.894999999999996 22.365 105-109 20.61 29.2 27.295 22.895 110-114 20.62 28.775000000000002 27.63 22.975 115-119 20.89 29.425 26.875 22.81 120-124 20.880000000000003 28.76 27.485 22.875 125-129 20.885 28.49 27.650000000000002 22.975 130-134 20.615 28.955 27.265 23.165 135-139 21.245 28.854999999999997 26.384999999999998 23.515 140-144 21.154999999999998 28.835 26.58 23.43 145-149 21.22 28.87 26.584999999999997 23.325000000000003 150-151 20.724999999999998 28.775000000000002 26.337500000000002 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.5 20 1.5 21 2.0 22 2.0 23 3.5 24 5.0 25 5.0 26 8.0 27 10.0 28 15.5 29 21.0 30 26.5 31 36.0 32 41.5 33 51.0 34 75.0 35 92.0 36 109.0 37 136.5 38 168.0 39 195.0 40 208.5 41 227.0 42 258.5 43 270.0 44 262.0 45 259.0 46 253.5 47 229.0 48 197.5 49 170.5 50 143.5 51 119.5 52 96.5 53 76.0 54 62.5 55 51.0 56 34.0 57 25.0 58 19.5 59 11.0 60 5.5 61 3.5 62 1.5 63 0.5 64 0.0 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.825 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.3624999999999998 0.0 0.0 0.0 0.0 94-95 1.7125 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.2750000000000004 0.0 0.0 0.0 0.0 100-101 2.6375 0.0 0.0 0.0 0.0 102-103 2.9749999999999996 0.0 0.0 0.0 0.0 104-105 3.2874999999999996 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.05 0.0 0.0 0.0 0.0 110-111 4.550000000000001 0.0 0.0 0.0 0.0 112-113 5.125 0.0 0.0 0.0 0.0 114-115 5.55 0.0 0.0 0.0 0.0 116-117 6.0875 0.0 0.0 0.0 0.0 118-119 6.762499999999999 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 7.8125 0.0 0.0 0.0 0.0 124-125 8.4375 0.0 0.0 0.0 0.0 126-127 9.175 0.0 0.0 0.0 0.0 128-129 9.8125 0.0 0.0 0.0 0.0 130-131 10.712499999999999 0.0 0.0 0.0 0.0 132-133 11.2875 0.0 0.0 0.0 0.0 134-135 11.899999999999999 0.0 0.0 0.0 0.0 136-137 12.6 0.0 0.0 0.0 0.0 138-139 13.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTTGG 10 0.0068378756 144.95 3 ACTTATG 10 0.0068378756 144.95 6 TCCGTTG 10 0.0068378756 144.95 2 >>END_MODULE SRR7171109 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171109_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9785 33.0 33.0 34.0 32.0 34.0 2 33.1175 34.0 33.0 34.0 32.0 34.0 3 33.1045 34.0 33.0 34.0 32.0 34.0 4 33.10325 34.0 33.0 34.0 33.0 34.0 5 33.0785 34.0 33.0 34.0 32.0 34.0 6 37.29625 38.0 38.0 38.0 37.0 38.0 7 37.0595 38.0 38.0 38.0 36.0 38.0 8 37.243 38.0 38.0 38.0 37.0 38.0 9 37.164 38.0 38.0 38.0 37.0 38.0 10-14 37.30165 38.0 38.0 38.0 37.0 38.0 15-19 37.259 38.0 38.0 38.0 37.0 38.0 20-24 36.48745 38.0 37.8 38.0 33.4 38.0 25-29 36.869350000000004 38.0 38.0 38.0 35.8 38.0 30-34 37.10940000000001 38.0 38.0 38.0 36.6 38.0 35-39 37.08135 38.0 38.0 38.0 36.2 38.0 40-44 36.2018 38.0 36.2 38.0 32.2 38.0 45-49 36.740950000000005 38.0 37.4 38.0 34.4 38.0 50-54 37.079150000000006 38.0 38.0 38.0 36.4 38.0 55-59 37.05135 38.0 38.0 38.0 36.2 38.0 60-64 36.902 38.0 38.0 38.0 36.0 38.0 65-69 36.87505 38.0 38.0 38.0 35.8 38.0 70-74 36.87965 38.0 38.0 38.0 35.8 38.0 75-79 36.78415 38.0 38.0 38.0 35.4 38.0 80-84 36.64325 38.0 38.0 38.0 34.8 38.0 85-89 36.5669 38.0 38.0 38.0 34.4 38.0 90-94 36.5148 38.0 38.0 38.0 34.2 38.0 95-99 36.356500000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.1924 38.0 38.0 38.0 33.6 38.0 105-109 35.766949999999994 38.0 37.2 38.0 31.8 38.0 110-114 35.464099999999995 38.0 36.8 38.0 30.4 38.0 115-119 35.6351 38.0 37.0 38.0 31.2 38.0 120-124 35.1067 38.0 35.8 38.0 28.8 38.0 125-129 34.7248 38.0 35.2 38.0 26.8 38.0 130-134 34.5439 38.0 34.4 38.0 26.8 38.0 135-139 33.90625 38.0 33.4 38.0 23.0 38.0 140-144 33.01185 38.0 33.0 38.0 18.4 38.0 145-149 31.766399999999997 38.0 32.4 38.0 8.6 38.0 150-151 25.966124999999998 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 0.0 6 0.0 7 0.0 8 3.0 9 3.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 3.0 17 7.0 18 1.0 19 8.0 20 8.0 21 8.0 22 4.0 23 10.0 24 10.0 25 14.0 26 12.0 27 32.0 28 33.0 29 41.0 30 53.0 31 78.0 32 103.0 33 130.0 34 221.0 35 305.0 36 839.0 37 2061.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.3 24.575 8.3 36.825 2 21.25 23.400000000000002 43.6 11.75 3 14.774999999999999 28.125 33.975 23.125 4 19.85 36.0 25.6 18.55 5 23.325000000000003 39.15 22.275 15.25 6 18.475 39.35 24.625 17.549999999999997 7 17.0 19.425 44.125 19.45 8 17.325 23.25 31.75 27.675 9 19.05 23.325000000000003 34.699999999999996 22.925 10-14 22.29 27.97 27.275 22.465 15-19 21.935 28.199999999999996 28.655 21.21 20-24 22.105 28.255000000000003 28.4 21.240000000000002 25-29 22.145 28.235 28.634999999999998 20.985 30-34 21.51 28.345 28.754999999999995 21.39 35-39 21.965 28.375 28.849999999999998 20.810000000000002 40-44 21.95 28.025 28.465 21.560000000000002 45-49 22.495 28.485 27.82 21.2 50-54 22.59 27.894999999999996 28.754999999999995 20.76 55-59 22.185 28.33 28.384999999999998 21.099999999999998 60-64 22.665 28.425 28.299999999999997 20.61 65-69 22.650000000000002 28.105000000000004 28.27 20.974999999999998 70-74 22.615 28.285 28.325 20.775 75-79 22.12 28.194999999999997 28.799999999999997 20.885 80-84 22.89 28.470000000000002 27.889999999999997 20.75 85-89 23.315 28.58 27.825 20.28 90-94 22.99 28.77 27.57 20.669999999999998 95-99 23.265 28.925 27.744999999999997 20.064999999999998 100-104 23.865 28.28 28.139999999999997 19.715 105-109 23.345 28.689999999999998 27.12 20.845 110-114 23.565 29.104999999999997 27.455000000000002 19.875 115-119 24.169999999999998 28.285 27.85 19.695 120-124 24.44 28.82 26.645000000000003 20.095 125-129 24.404999999999998 28.915000000000003 27.41 19.27 130-134 24.595 28.715000000000003 27.994999999999997 18.695 135-139 24.75 29.115000000000002 27.37 18.765 140-144 25.52 27.950000000000003 27.77 18.759999999999998 145-149 25.27 28.910000000000004 27.310000000000002 18.509999999999998 150-151 25.162499999999998 29.5875 27.375 17.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.5 20 1.5 21 2.0 22 3.0 23 2.0 24 4.5 25 5.5 26 6.0 27 8.5 28 11.0 29 19.5 30 28.0 31 26.5 32 31.5 33 46.5 34 62.0 35 77.0 36 93.0 37 115.5 38 161.5 39 187.0 40 218.5 41 256.5 42 260.0 43 266.5 44 282.0 45 275.0 46 254.5 47 252.5 48 225.0 49 171.5 50 132.5 51 117.5 52 101.5 53 72.0 54 55.0 55 48.0 56 36.0 57 27.5 58 16.5 59 14.0 60 13.0 61 5.0 62 1.5 63 1.0 64 0.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67312044254463 99.1 2 0.20115665074176514 0.4 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025144581342720643 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6875 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 2.9749999999999996 0.0 0.0 0.0 0.0 104-105 3.3125 0.0 0.0 0.0 0.0 106-107 3.7125 0.0 0.0 0.0 0.0 108-109 4.075 0.0 0.0 0.0 0.0 110-111 4.612500000000001 0.0 0.0 0.0 0.0 112-113 5.199999999999999 0.0 0.0 0.0 0.0 114-115 5.637499999999999 0.0 0.0 0.0 0.0 116-117 6.1875 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.45 0.0 0.0 0.0 0.0 122-123 8.1375 0.0 0.0 0.0 0.0 124-125 8.825 0.0 0.0 0.0 0.0 126-127 9.6 0.0 0.0 0.0 0.0 128-129 10.412500000000001 0.0 0.0 0.0 0.0 130-131 11.4875 0.0 0.0 0.0 0.0 132-133 12.1375 0.0 0.0 0.0 0.0 134-135 12.7625 0.0 0.0 0.0 0.0 136-137 13.4875 0.0 0.0 0.0 0.0 138-139 14.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCATGGT 10 0.006830828 145.0 8 >>END_MODULE Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839348 spots for SRR7171109.sra Written 839348 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra Read 839333 spots for SRR7171109.sra Written 839333 spots for SRR7171109.sra SRR ids: ['SRR7171109.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6mbh_75p SRR7171109.sra spots: 16786675 blocks: [[1, 839333], [839334, 1678666], [1678667, 2517999], [2518000, 3357332], [3357333, 4196665], [4196666, 5035998], [5035999, 5875331], [5875332, 6714664], [6714665, 7553997], [7553998, 8393330], [8393331, 9232663], [9232664, 10071996], [10071997, 10911329], [10911330, 11750662], [11750663, 12589995], [12589996, 13429328], [13429329, 14268661], [14268662, 15107994], [15107995, 15947327], [15947328, 16786675]] SRR7171109 file size 5666752 SRR7171109 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171109 SRR7171109_1.fastq SRR7171109_2.fastq Input file: SRR7171109_1.fastq Paired file: SRR7171109_2.fastq trimmed: SRR7171109-trimmed-pair1.fastq, SRR7171109-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:58:13 2025 >> started Fri Feb 14 05:58:38 2025 >> done (24.402s) 16786675 read pairs processed; of these: 10142 ( 0.06%) short read pairs filtered out after trimming by size control 17625 ( 0.10%) empty read pairs filtered out after trimming by size control 16758908 (99.83%) read pairs available; of these: 10204645 (60.89%) trimmed read pairs available after processing 6554263 (39.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 49 0.00% 19 51 0.00% 20 67 0.00% 21 64 0.00% 22 63 0.00% 23 58 0.00% 24 53 0.00% 25 67 0.00% 26 76 0.00% 27 71 0.00% 28 67 0.00% 29 82 0.00% 30 87 0.00% 31 79 0.00% 32 64 0.00% 33 82 0.00% 34 63 0.00% 35 70 0.00% 36 63 0.00% 37 60 0.00% 38 94 0.00% 39 95 0.00% 40 109 0.00% 41 121 0.00% 42 134 0.00% 43 130 0.00% 44 139 0.00% 45 160 0.00% 46 168 0.00% 47 175 0.00% 48 235 0.00% 49 284 0.00% 50 305 0.00% 51 327 0.00% 52 413 0.00% 53 437 0.00% 54 441 0.00% 55 470 0.00% 56 556 0.00% 57 634 0.00% 58 724 0.00% 59 848 0.01% 60 912 0.01% 61 1114 0.01% 62 1297 0.01% 63 1467 0.01% 64 1497 0.01% 65 1630 0.01% 66 1850 0.01% 67 1959 0.01% 68 2313 0.01% 69 2544 0.02% 70 3042 0.02% 71 3435 0.02% 72 3827 0.02% 73 4225 0.03% 74 4583 0.03% 75 5036 0.03% 76 5716 0.03% 77 6082 0.04% 78 6650 0.04% 79 7332 0.04% 80 8193 0.05% 81 9147 0.05% 82 10346 0.06% 83 10966 0.07% 84 12510 0.07% 85 13657 0.08% 86 14483 0.09% 87 15121 0.09% 88 16640 0.10% 89 17365 0.10% 90 18979 0.11% 91 20355 0.12% 92 21851 0.13% 93 24017 0.14% 94 25262 0.15% 95 25953 0.15% 96 26309 0.16% 97 27583 0.16% 98 28751 0.17% 99 30040 0.18% 100 31822 0.19% 101 32903 0.20% 102 35582 0.21% 103 36918 0.22% 104 38449 0.23% 105 39657 0.24% 106 40738 0.24% 107 40841 0.24% 108 41790 0.25% 109 43647 0.26% 110 44537 0.27% 111 46598 0.28% 112 48493 0.29% 113 50364 0.30% 114 51787 0.31% 115 53822 0.32% 116 54648 0.33% 117 53926 0.32% 118 55625 0.33% 119 55857 0.33% 120 57230 0.34% 121 59213 0.35% 122 61279 0.37% 123 62875 0.38% 124 64830 0.39% 125 66737 0.40% 126 68451 0.41% 127 69458 0.41% 128 69803 0.42% 129 71088 0.42% 130 73049 0.44% 131 75352 0.45% 132 79289 0.47% 133 82946 0.49% 134 87084 0.52% 135 90405 0.54% 136 94707 0.57% 137 99458 0.59% 138 105214 0.63% 139 112537 0.67% 140 120660 0.72% 141 133589 0.80% 142 146787 0.88% 143 165650 0.99% 144 195506 1.17% 145 232489 1.39% 146 288935 1.72% 147 391231 2.33% 148 568346 3.39% 149 1045315 6.24% 150 4014754 23.96% 151 6554263 39.11% 16758908 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=11.43 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.1 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=5.95 fanout-score-rank=13 prefix-density=1.16 prefix-fanout=1.7 sequence=CACCTGCGACACCTGCGACTGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=68.25 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.6 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR7171109 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:59:25 Started mapping on | Feb 14 05:59:25 Finished on | Feb 14 06:01:21 Mapping speed, Million of reads per hour | 520.10 Number of input reads | 16758908 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15857467 Uniquely mapped reads % | 94.62% Average mapped length | 287.23 Number of splices: Total | 14821236 Number of splices: Annotated (sjdb) | 14434379 Number of splices: GT/AG | 14524844 Number of splices: GC/AG | 223879 Number of splices: AT/AC | 9014 Number of splices: Non-canonical | 63499 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 534897 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 25106 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 378644 378644 378644 N_multimapping 534897 534897 534897 N_noFeature 759488 15623309 847583 N_ambiguous 267721 824 121321 UnstrandedReadsAssigned:14830258 PositiveStrandReadsAssigned:233334 NegativeStrandReadsAssigned:14888563 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171109 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171109-trimmed-pair1.fastq SRR7171109-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,758,908 reads, 14,888,830 reads pseudoaligned [quant] estimated average fragment length: 225.16 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7171109.ke.tsv 34699 SRR7171109.se.tsv 87100 total ==> SRR7171109.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.84 1191 44.3286 Potri.005G024800.1.v4.1 1035 810.84 339 27.9139 Potri.004G059700.1.v4.1 961 736.862 28 2.53704 Potri.007G009000.2.v4.1 1416 1191.84 0 0 Potri.003G141000.2.v4.1 2943 2718.84 745 18.2948 Potri.016G087400.1.v4.1 270 95.6251 715 499.218 Potri.015G069301.1.v4.1 564 344.714 0 0 Potri.010G195200.1.v4.1 1773 1548.84 390 16.8118 Potri.012G127500.1.v4.1 977 752.857 65 5.76444 ==> SRR7171109.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1033 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7171109 completed mapping pipeline successfully