Starting /dee2/code/volunteer_pipeline.sh SRR7171111 current disk space = 3085517131776 free memory = 1575386740 SRR7171111 SRAfilesize 58488ffcc4676934b52646e2a5161ed4 SRR7171111.sra SRR7171111.sra file validated SRR7171111 is paired end SRR7171111 is conventional basespace SRR7171111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.80175 30.0 18.0 32.0 18.0 33.0 2 31.31675 33.0 30.0 33.0 28.0 33.0 3 32.3305 33.0 33.0 33.0 31.0 34.0 4 32.73975 33.0 33.0 34.0 31.0 34.0 5 33.2535 34.0 33.0 34.0 33.0 34.0 6 37.14475 38.0 37.0 38.0 36.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.5175 38.0 38.0 38.0 37.0 38.0 9 37.57375 38.0 38.0 38.0 38.0 38.0 10-14 37.50175 38.0 38.0 38.0 37.0 38.0 15-19 37.4989 38.0 38.0 38.0 37.2 38.0 20-24 37.472449999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.437349999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.52445 38.0 38.0 38.0 37.6 38.0 35-39 37.35809999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.4377 38.0 38.0 38.0 37.0 38.0 45-49 37.43814999999999 38.0 38.0 38.0 37.0 38.0 50-54 36.816649999999996 38.0 38.0 38.0 35.0 38.0 55-59 37.1383 38.0 38.0 38.0 36.0 38.0 60-64 37.092699999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.0661 38.0 38.0 38.0 36.0 38.0 70-74 36.89725 38.0 38.0 38.0 35.2 38.0 75-79 36.88075 38.0 38.0 38.0 35.0 38.0 80-84 36.803250000000006 38.0 38.0 38.0 35.0 38.0 85-89 36.55575 38.0 37.6 38.0 34.0 38.0 90-94 36.347950000000004 38.0 37.4 38.0 34.0 38.0 95-99 36.402049999999996 38.0 37.2 38.0 34.0 38.0 100-104 36.3424 38.0 37.2 38.0 34.0 38.0 105-109 36.16915 38.0 37.0 38.0 33.4 38.0 110-114 35.9057 38.0 36.8 38.0 32.6 38.0 115-119 35.4742 38.0 36.0 38.0 30.2 38.0 120-124 35.3938 38.0 36.0 38.0 29.8 38.0 125-129 35.10825 38.0 35.4 38.0 28.6 38.0 130-134 32.2198 36.0 28.6 38.0 21.4 38.0 135-139 34.129450000000006 38.0 33.6 38.0 24.0 38.0 140-144 33.65165 38.0 33.6 38.0 22.2 38.0 145-149 32.87925 38.0 33.0 38.0 17.4 38.0 150-151 28.256625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 3.0 20 7.0 21 2.0 22 6.0 23 7.0 24 8.0 25 12.0 26 9.0 27 17.0 28 21.0 29 30.0 30 40.0 31 57.0 32 85.0 33 127.0 34 230.0 35 454.0 36 1218.0 37 1659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.7991927346115 13.39556004036327 10.696266397578205 37.10898082744703 2 19.904976244061015 20.080020005001252 36.734183545886474 23.280820205051263 3 19.7 24.875 27.700000000000003 27.725 4 22.525000000000002 32.425 23.674999999999997 21.375 5 21.925 35.675000000000004 23.7 18.7 6 16.575 36.725 26.525 20.175 7 13.4 22.525000000000002 45.45 18.625 8 18.099999999999998 22.075 32.6 27.224999999999998 9 17.45 23.7 33.85 25.0 10-14 20.085 29.535 26.91 23.47 15-19 20.055 28.660000000000004 27.665 23.62 20-24 20.419999999999998 28.355000000000004 28.075 23.150000000000002 25-29 19.945 28.205000000000002 28.225 23.625 30-34 19.939999999999998 28.52 27.589999999999996 23.95 35-39 20.215 28.735 27.73 23.32 40-44 20.44 29.18 27.115000000000002 23.265 45-49 20.885 28.555000000000003 27.38 23.18 50-54 20.39 28.93 27.544999999999998 23.135 55-59 20.369999999999997 28.645 27.83 23.155 60-64 20.365 29.110000000000003 27.089999999999996 23.435 65-69 20.06 28.965000000000003 27.634999999999998 23.34 70-74 20.205000000000002 28.015 28.48 23.3 75-79 20.150000000000002 29.080000000000002 27.334999999999997 23.435 80-84 20.535 28.16 27.805000000000003 23.5 85-89 20.05 29.25 27.785 22.915 90-94 20.625 28.599999999999998 27.495000000000005 23.28 95-99 20.75 28.389999999999997 27.68 23.18 100-104 20.715 28.915000000000003 27.16 23.21 105-109 20.66 28.21 27.565 23.565 110-114 20.630000000000003 28.825 27.095000000000002 23.45 115-119 21.29 28.065 27.935 22.71 120-124 21.255 28.02 27.205000000000002 23.52 125-129 20.715 28.694999999999997 27.24 23.35 130-134 21.115000000000002 29.015 26.545 23.325000000000003 135-139 20.995 28.494999999999997 27.07 23.44 140-144 21.245 28.535 26.56 23.66 145-149 20.62 28.449999999999996 27.279999999999998 23.65 150-151 20.1625 29.075 26.6625 24.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.5 21 2.5 22 1.0 23 1.5 24 2.5 25 1.5 26 4.5 27 10.0 28 13.0 29 12.5 30 19.5 31 32.5 32 35.5 33 40.0 34 61.5 35 75.0 36 79.5 37 105.0 38 144.5 39 183.5 40 207.0 41 221.0 42 257.0 43 263.5 44 258.0 45 273.0 46 264.5 47 235.5 48 214.0 49 189.0 50 161.0 51 142.5 52 114.5 53 94.0 54 70.5 55 56.0 56 44.5 57 27.0 58 26.5 59 21.0 60 10.5 61 7.0 62 3.5 63 3.0 64 3.5 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.37716872014080965 0.75 3 0.025144581342720643 0.075 4 0.050289162685441285 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0125 0.0 0.0 0.0 76-77 0.16249999999999998 0.025 0.0 0.0 0.0 78-79 0.1875 0.025 0.0 0.0 0.0 80-81 0.2375 0.025 0.0 0.0 0.0 82-83 0.275 0.025 0.0 0.0 0.0 84-85 0.3125 0.025 0.0 0.0 0.0 86-87 0.3625 0.025 0.0 0.0 0.0 88-89 0.475 0.025 0.0 0.0 0.0 90-91 0.6000000000000001 0.025 0.0 0.0 0.0 92-93 0.75 0.025 0.0 0.0 0.0 94-95 0.925 0.025 0.0 0.0 0.0 96-97 1.1375 0.025 0.0 0.0 0.0 98-99 1.2999999999999998 0.025 0.0 0.0 0.0 100-101 1.5625 0.025 0.0 0.0 0.0 102-103 1.775 0.025 0.0 0.0 0.0 104-105 2.05 0.025 0.0 0.0 0.0 106-107 2.3125 0.025 0.0 0.0 0.0 108-109 2.65 0.025 0.0 0.0 0.0 110-111 2.9625 0.025 0.0 0.0 0.0 112-113 3.275 0.025 0.0 0.0 0.0 114-115 3.6125 0.025 0.0 0.0 0.0 116-117 4.075 0.025 0.0 0.0 0.0 118-119 4.512499999999999 0.025 0.0 0.0 0.0 120-121 4.875 0.025 0.0 0.0 0.0 122-123 5.199999999999999 0.025 0.0 0.0 0.0 124-125 5.65 0.025 0.0 0.0 0.0 126-127 6.0875 0.025 0.0 0.0 0.0 128-129 6.4625 0.025 0.0 0.0 0.0 130-131 6.9125 0.025 0.0 0.0 0.0 132-133 7.425000000000001 0.025 0.0 0.0 0.0 134-135 7.925 0.025 0.0 0.0 0.0 136-137 8.725000000000001 0.025 0.0 0.0 0.0 138-139 9.4625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0825 33.0 33.0 34.0 32.0 34.0 2 32.69075 34.0 33.0 34.0 32.0 34.0 3 33.10875 34.0 33.0 34.0 32.0 34.0 4 33.17 34.0 33.0 34.0 33.0 34.0 5 33.2045 34.0 33.0 34.0 33.0 34.0 6 37.4645 38.0 38.0 38.0 38.0 38.0 7 37.47475 38.0 38.0 38.0 38.0 38.0 8 37.4715 38.0 38.0 38.0 38.0 38.0 9 37.51175 38.0 38.0 38.0 38.0 38.0 10-14 37.47580000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.41955 38.0 38.0 38.0 38.0 38.0 20-24 36.24235 38.0 37.2 38.0 30.8 38.0 25-29 36.98480000000001 38.0 38.0 38.0 36.2 38.0 30-34 37.28145 38.0 38.0 38.0 37.4 38.0 35-39 37.373900000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.3556 38.0 38.0 38.0 37.8 38.0 45-49 37.33 38.0 38.0 38.0 37.4 38.0 50-54 37.30615 38.0 38.0 38.0 37.6 38.0 55-59 37.27535 38.0 38.0 38.0 37.0 38.0 60-64 37.224149999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.21295 38.0 38.0 38.0 37.0 38.0 70-74 37.13095 38.0 38.0 38.0 36.8 38.0 75-79 36.76875 38.0 38.0 38.0 35.2 38.0 80-84 35.47315 37.8 35.6 38.0 29.6 38.0 85-89 36.9777 38.0 38.0 38.0 36.2 38.0 90-94 36.91905 38.0 38.0 38.0 36.0 38.0 95-99 36.791549999999994 38.0 38.0 38.0 35.6 38.0 100-104 36.70795 38.0 38.0 38.0 35.2 38.0 105-109 35.34495 38.0 35.6 38.0 29.2 38.0 110-114 36.2495 38.0 37.6 38.0 33.8 38.0 115-119 35.6368 38.0 36.6 38.0 30.4 38.0 120-124 35.9069 38.0 37.0 38.0 32.8 38.0 125-129 35.70605 38.0 36.4 38.0 32.2 38.0 130-134 35.4967 38.0 36.0 38.0 31.0 38.0 135-139 35.06245 38.0 36.0 38.0 30.6 38.0 140-144 33.2327 37.0 30.6 38.0 25.6 38.0 145-149 32.15075 36.6 30.6 38.0 17.8 38.0 150-151 28.348875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 2.0 6 1.0 7 4.0 8 1.0 9 1.0 10 1.0 11 1.0 12 3.0 13 0.0 14 0.0 15 4.0 16 0.0 17 0.0 18 4.0 19 3.0 20 2.0 21 0.0 22 4.0 23 3.0 24 10.0 25 5.0 26 10.0 27 13.0 28 20.0 29 24.0 30 38.0 31 49.0 32 59.0 33 76.0 34 161.0 35 335.0 36 1008.0 37 2146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.15 19.6 12.7 28.549999999999997 2 23.9 26.875 33.175 16.05 3 20.075000000000003 27.525 32.025 20.375 4 23.10577644411103 35.28382095523881 23.030757689422355 18.579644911227806 5 22.336168084042022 37.26863431715858 23.13656828414207 17.258629314657327 6 17.849999999999998 38.324999999999996 24.675 19.15 7 16.775000000000002 20.625 41.625 20.974999999999998 8 19.950000000000003 24.375 28.625 27.05 9 21.15 25.275 30.2 23.375 10-14 22.759999999999998 29.26 26.450000000000003 21.529999999999998 15-19 23.03 27.96 27.894999999999996 21.115000000000002 20-24 22.67 28.255000000000003 28.189999999999998 20.885 25-29 22.895 28.37 27.865000000000002 20.87 30-34 22.02 27.97 28.655 21.355 35-39 22.775000000000002 28.59 27.91 20.724999999999998 40-44 22.725 28.315 27.794999999999998 21.165 45-49 22.37 27.644999999999996 29.13 20.855 50-54 22.545 28.48 27.76 21.215 55-59 23.1 27.315 28.470000000000002 21.115000000000002 60-64 23.26 27.985 27.825 20.93 65-69 23.525 27.785 27.715 20.974999999999998 70-74 23.200000000000003 27.779999999999998 27.66 21.36 75-79 22.82 28.01 27.82 21.349999999999998 80-84 23.025000000000002 27.860000000000003 28.24 20.875 85-89 23.535 27.93 27.705000000000002 20.830000000000002 90-94 23.355 27.555000000000003 27.955000000000002 21.135 95-99 23.465 28.505000000000003 27.305 20.724999999999998 100-104 23.494999999999997 28.65 27.555000000000003 20.3 105-109 24.115000000000002 27.700000000000003 27.939999999999998 20.244999999999997 110-114 23.715 28.215 27.955000000000002 20.115 115-119 23.715 28.09 27.595 20.599999999999998 120-124 23.86 27.96 27.639999999999997 20.54 125-129 24.585 27.71 27.71 19.994999999999997 130-134 24.21 28.18 27.744999999999997 19.865 135-139 24.765 27.450000000000003 27.925 19.86 140-144 24.935 28.345 27.345000000000002 19.375 145-149 25.22 27.925 27.41 19.445 150-151 25.624999999999996 28.237499999999997 27.175 18.9625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 1.0 24 2.0 25 3.0 26 3.5 27 4.5 28 9.5 29 12.5 30 18.5 31 26.5 32 28.0 33 36.0 34 49.5 35 63.5 36 81.0 37 100.5 38 131.5 39 188.0 40 215.5 41 228.0 42 275.5 43 279.5 44 282.5 45 277.0 46 238.5 47 240.0 48 212.0 49 173.5 50 161.5 51 137.0 52 119.5 53 106.0 54 83.5 55 61.0 56 36.5 57 25.5 58 25.5 59 19.0 60 12.0 61 7.0 62 4.0 63 4.0 64 4.0 65 1.5 66 2.0 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14011127971675 98.0 2 0.6575619625695498 1.3 3 0.12645422357106728 0.375 4 0.05058168942842691 0.2 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.975 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.625 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.6 0.0 0.0 0.0 0.0 130-131 7.075 0.0 0.0 0.0 0.0 132-133 7.574999999999999 0.0 0.0 0.0 0.0 134-135 8.0625 0.0 0.0 0.0 0.0 136-137 8.775 0.0 0.0 0.0 0.0 138-139 9.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAGAA 10 0.006830828 145.0 3 TCAGAGA 10 0.006830828 145.0 2 >>END_MODULE Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698522 spots for SRR7171111.sra Written 698522 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra Read 698506 spots for SRR7171111.sra Written 698506 spots for SRR7171111.sra SRR ids: ['SRR7171111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m7ict_92 SRR7171111.sra spots: 13970136 blocks: [[1, 698506], [698507, 1397012], [1397013, 2095518], [2095519, 2794024], [2794025, 3492530], [3492531, 4191036], [4191037, 4889542], [4889543, 5588048], [5588049, 6286554], [6286555, 6985060], [6985061, 7683566], [7683567, 8382072], [8382073, 9080578], [9080579, 9779084], [9779085, 10477590], [10477591, 11176096], [11176097, 11874602], [11874603, 12573108], [12573109, 13271614], [13271615, 13970136]] SRR7171111 file size 4712320 SRR7171111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171111 SRR7171111_1.fastq SRR7171111_2.fastq Input file: SRR7171111_1.fastq Paired file: SRR7171111_2.fastq trimmed: SRR7171111-trimmed-pair1.fastq, SRR7171111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:06:16 2025 >> started Fri Feb 14 06:06:37 2025 >> done (21.007s) 13970136 read pairs processed; of these: 11747 ( 0.08%) short read pairs filtered out after trimming by size control 13286 ( 0.10%) empty read pairs filtered out after trimming by size control 13945103 (99.82%) read pairs available; of these: 8471140 (60.75%) trimmed read pairs available after processing 5473963 (39.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 6 0.00% 21 9 0.00% 22 4 0.00% 23 9 0.00% 24 8 0.00% 25 5 0.00% 26 5 0.00% 27 9 0.00% 28 6 0.00% 29 8 0.00% 30 11 0.00% 31 13 0.00% 32 12 0.00% 33 5 0.00% 34 13 0.00% 35 8 0.00% 36 17 0.00% 37 20 0.00% 38 15 0.00% 39 20 0.00% 40 27 0.00% 41 29 0.00% 42 47 0.00% 43 42 0.00% 44 36 0.00% 45 27 0.00% 46 53 0.00% 47 56 0.00% 48 59 0.00% 49 71 0.00% 50 97 0.00% 51 119 0.00% 52 132 0.00% 53 133 0.00% 54 157 0.00% 55 168 0.00% 56 183 0.00% 57 222 0.00% 58 202 0.00% 59 265 0.00% 60 275 0.00% 61 393 0.00% 62 400 0.00% 63 507 0.00% 64 522 0.00% 65 603 0.00% 66 631 0.00% 67 723 0.01% 68 814 0.01% 69 944 0.01% 70 1205 0.01% 71 1240 0.01% 72 1434 0.01% 73 1686 0.01% 74 1828 0.01% 75 2235 0.02% 76 2353 0.02% 77 2865 0.02% 78 2806 0.02% 79 3151 0.02% 80 3519 0.03% 81 3959 0.03% 82 4536 0.03% 83 5004 0.04% 84 6181 0.04% 85 6562 0.05% 86 7127 0.05% 87 7700 0.06% 88 8187 0.06% 89 8659 0.06% 90 9299 0.07% 91 10347 0.07% 92 11032 0.08% 93 12030 0.09% 94 13068 0.09% 95 14099 0.10% 96 14484 0.10% 97 15150 0.11% 98 15799 0.11% 99 16285 0.12% 100 17719 0.13% 101 18203 0.13% 102 19680 0.14% 103 20478 0.15% 104 21365 0.15% 105 22775 0.16% 106 23931 0.17% 107 24602 0.18% 108 25003 0.18% 109 25892 0.19% 110 26528 0.19% 111 27572 0.20% 112 29065 0.21% 113 30094 0.22% 114 31488 0.23% 115 32897 0.24% 116 34065 0.24% 117 34355 0.25% 118 35810 0.26% 119 35805 0.26% 120 36743 0.26% 121 37846 0.27% 122 39369 0.28% 123 40817 0.29% 124 42444 0.30% 125 43770 0.31% 126 45484 0.33% 127 46814 0.34% 128 48048 0.34% 129 49978 0.36% 130 51316 0.37% 131 53032 0.38% 132 55636 0.40% 133 58730 0.42% 134 61249 0.44% 135 65452 0.47% 136 69692 0.50% 137 73680 0.53% 138 78871 0.57% 139 85817 0.62% 140 93217 0.67% 141 102540 0.74% 142 116426 0.83% 143 133944 0.96% 144 158684 1.14% 145 193977 1.39% 146 246655 1.77% 147 337578 2.42% 148 518552 3.72% 149 1001847 7.18% 150 3723625 26.70% 151 5473963 39.25% 13945103 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=14 prefix-density=0.53 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=281.22 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=17 prefix-density=0.49 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.0 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7171111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:07:23 Started mapping on | Feb 14 06:07:24 Finished on | Feb 14 06:09:03 Mapping speed, Million of reads per hour | 507.09 Number of input reads | 13945103 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13088092 Uniquely mapped reads % | 93.85% Average mapped length | 290.81 Number of splices: Total | 12336174 Number of splices: Annotated (sjdb) | 12069306 Number of splices: GT/AG | 12101450 Number of splices: GC/AG | 186199 Number of splices: AT/AC | 6874 Number of splices: Non-canonical | 41651 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431136 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 21021 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 436666 436666 436666 N_multimapping 431136 431136 431136 N_noFeature 441116 12888684 514333 N_ambiguous 224269 765 97611 UnstrandedReadsAssigned:12422707 PositiveStrandReadsAssigned:198643 NegativeStrandReadsAssigned:12476148 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171111-trimmed-pair1.fastq SRR7171111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,945,103 reads, 12,398,540 reads pseudoaligned [quant] estimated average fragment length: 228.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR7171111.ke.tsv 34699 SRR7171111.se.tsv 87100 total ==> SRR7171111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.97 975 40.9197 Potri.005G024800.1.v4.1 1035 807.971 256 23.8156 Potri.004G059700.1.v4.1 961 733.982 12 1.22889 Potri.007G009000.2.v4.1 1416 1188.97 0 0 Potri.003G141000.2.v4.1 2943 2715.97 546.654 15.1288 Potri.016G087400.1.v4.1 270 87.2334 535.927 461.785 Potri.015G069301.1.v4.1 564 340.418 0 0 Potri.010G195200.1.v4.1 1773 1545.97 214 10.4047 Potri.012G127500.1.v4.1 977 749.976 352 35.2786 ==> SRR7171111.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 392 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 159 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7171111 completed mapping pipeline successfully