Starting /dee2/code/volunteer_pipeline.sh SRR7171112 current disk space = 3085510778880 free memory = 1582423220 SRR7171112 SRAfilesize 85b01591da3cd37c6d43f30382eab04e SRR7171112.sra SRR7171112.sra file validated SRR7171112 is paired end SRR7171112 is conventional basespace SRR7171112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.695 25.0 18.0 31.0 18.0 32.0 2 30.85525 31.0 30.0 33.0 27.0 33.0 3 31.714 33.0 31.0 33.0 29.0 33.0 4 32.179 33.0 33.0 33.0 31.0 34.0 5 32.824 33.0 33.0 34.0 31.0 34.0 6 36.73975 38.0 37.0 38.0 35.0 38.0 7 37.03275 38.0 38.0 38.0 36.0 38.0 8 37.37125 38.0 38.0 38.0 37.0 38.0 9 35.79525 38.0 38.0 38.0 29.0 38.0 10-14 37.3123 38.0 38.0 38.0 36.2 38.0 15-19 37.46125 38.0 38.0 38.0 37.4 38.0 20-24 37.49025 38.0 38.0 38.0 37.6 38.0 25-29 37.514849999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.441500000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.3741 38.0 38.0 38.0 37.0 38.0 40-44 37.342349999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.190450000000006 38.0 38.0 38.0 36.8 38.0 50-54 35.9139 38.0 35.6 38.0 30.6 38.0 55-59 37.0605 38.0 38.0 38.0 36.0 38.0 60-64 37.10945 38.0 38.0 38.0 36.0 38.0 65-69 37.050850000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.035650000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.7434 38.0 38.0 38.0 35.4 38.0 80-84 36.12275 38.0 37.6 38.0 32.8 38.0 85-89 36.43665 38.0 38.0 38.0 34.0 38.0 90-94 36.34955 38.0 38.0 38.0 34.0 38.0 95-99 36.290949999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.206399999999995 38.0 37.8 38.0 33.8 38.0 105-109 36.1911 38.0 37.8 38.0 34.0 38.0 110-114 35.74195 38.0 37.0 38.0 32.2 38.0 115-119 35.5509 38.0 36.6 38.0 31.0 38.0 120-124 35.3707 38.0 36.0 38.0 30.2 38.0 125-129 35.0239 38.0 35.8 38.0 29.2 38.0 130-134 33.44325 38.0 32.4 38.0 22.0 38.0 135-139 34.02759999999999 38.0 33.2 38.0 24.4 38.0 140-144 33.51795 38.0 33.0 38.0 21.6 38.0 145-149 32.64815 38.0 33.0 38.0 13.8 38.0 150-151 26.87775 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 4.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 4.0 17 1.0 18 12.0 19 16.0 20 4.0 21 2.0 22 1.0 23 8.0 24 10.0 25 17.0 26 16.0 27 22.0 28 27.0 29 41.0 30 45.0 31 57.0 32 74.0 33 125.0 34 201.0 35 374.0 36 1111.0 37 1821.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.31631057842626 14.069828035435123 9.848879624804585 28.76498176133403 2 20.0 19.1 35.775 25.124999999999996 3 17.275 25.374999999999996 30.375000000000004 26.974999999999998 4 22.2 32.9 24.099999999999998 20.8 5 20.980245061265315 35.20880220055014 25.18129532383096 18.629657414353588 6 17.150000000000002 35.075 27.575 20.200000000000003 7 13.65 24.025 43.15 19.175 8 17.075000000000003 23.150000000000002 32.300000000000004 27.474999999999998 9 17.825 24.875 32.875 24.425 10-14 20.21 30.025000000000002 26.665 23.1 15-19 20.355 28.04 28.59 23.015 20-24 20.06 28.449999999999996 28.42 23.07 25-29 20.424999999999997 28.87 28.050000000000004 22.655 30-34 19.439999999999998 28.849999999999998 28.294999999999998 23.415 35-39 19.54 29.18 28.27 23.01 40-44 20.305 28.910000000000004 28.185 22.6 45-49 20.26 28.549999999999997 27.955000000000002 23.235 50-54 19.705000000000002 28.925 28.405 22.965 55-59 20.635 27.6 28.57 23.195 60-64 20.565 28.65 27.98 22.805 65-69 20.31 29.18 27.839999999999996 22.67 70-74 20.145 29.07 27.68 23.105 75-79 20.625 28.389999999999997 27.515 23.47 80-84 19.82 29.304999999999996 27.665 23.21 85-89 20.275000000000002 28.945 27.925 22.855 90-94 20.5 29.044999999999998 27.665 22.79 95-99 20.585 28.315 27.79 23.31 100-104 19.950000000000003 29.145 27.785 23.119999999999997 105-109 20.695 28.78 27.6 22.925 110-114 20.72 29.349999999999998 26.97 22.96 115-119 20.84 28.88 27.21 23.07 120-124 20.724999999999998 29.115000000000002 26.905 23.255 125-129 21.095 28.205000000000002 26.96 23.74 130-134 20.505000000000003 28.744999999999997 26.685 24.065 135-139 20.82 28.610000000000003 26.705000000000002 23.865 140-144 20.79 28.315 27.065 23.830000000000002 145-149 20.82 28.215 27.189999999999998 23.775 150-151 20.855213803450862 28.469617404351087 26.86921730432608 23.80595148787197 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 1.5 17 1.0 18 1.5 19 1.0 20 1.0 21 3.5 22 2.5 23 1.5 24 4.5 25 6.0 26 11.0 27 22.0 28 21.0 29 17.5 30 22.5 31 31.0 32 38.5 33 51.0 34 68.0 35 80.5 36 106.5 37 126.0 38 134.0 39 158.0 40 196.0 41 224.5 42 242.0 43 259.0 44 268.5 45 254.5 46 247.5 47 229.5 48 214.5 49 199.0 50 156.0 51 121.0 52 101.5 53 90.0 54 69.5 55 55.5 56 50.0 57 33.5 58 16.5 59 16.5 60 13.0 61 5.5 62 4.5 63 6.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64762144475208 98.97500000000001 2 0.32720865844450037 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025169896803423106 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 15 0.375 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.5875 0.0 0.0 0.0 0.0 104-105 2.9749999999999996 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.2 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.6125 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.475 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.112500000000001 0.0 0.0 0.0 0.0 126-127 7.725 0.0 0.0 0.0 0.0 128-129 8.175 0.0 0.0 0.0 0.0 130-131 8.575 0.0 0.0 0.0 0.0 132-133 9.0625 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.3375 0.0 0.0 0.0 0.0 138-139 11.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTCA 10 0.0063298983 148.6923 1 GTTTTGA 10 0.0063298983 148.6923 1 CTTTCCA 10 0.0068343505 144.975 2 GAAGAGT 10 0.0068343505 144.975 2 TCTCAGC 10 0.0068343505 144.975 3 AAAAAAA 135 0.009594828 8.59111 65-69 >>END_MODULE SRR7171112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31375 33.0 32.0 34.0 28.0 34.0 2 30.049 33.0 28.0 34.0 18.0 34.0 3 31.95 33.0 32.0 34.0 27.0 34.0 4 32.498 33.0 33.0 34.0 32.0 34.0 5 32.704 33.0 33.0 34.0 32.0 34.0 6 36.93025 38.0 38.0 38.0 36.0 38.0 7 37.039 38.0 38.0 38.0 37.0 38.0 8 37.0385 38.0 38.0 38.0 37.0 38.0 9 36.9855 38.0 38.0 38.0 37.0 38.0 10-14 36.9553 38.0 38.0 38.0 37.0 38.0 15-19 36.9377 38.0 38.0 38.0 37.0 38.0 20-24 36.009949999999996 38.0 37.6 38.0 30.6 38.0 25-29 36.70775 38.0 38.0 38.0 35.4 38.0 30-34 36.953149999999994 38.0 38.0 38.0 37.0 38.0 35-39 36.9214 38.0 38.0 38.0 37.0 38.0 40-44 36.82855 38.0 38.0 38.0 37.0 38.0 45-49 36.327000000000005 38.0 37.8 38.0 34.2 38.0 50-54 36.72895 38.0 38.0 38.0 36.4 38.0 55-59 36.6483 38.0 38.0 38.0 36.0 38.0 60-64 35.77315 38.0 37.0 38.0 30.4 38.0 65-69 36.537850000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.49005 38.0 38.0 38.0 35.8 38.0 75-79 36.49855 38.0 38.0 38.0 36.0 38.0 80-84 34.6813 38.0 34.6 38.0 28.4 38.0 85-89 35.9599 38.0 37.8 38.0 34.2 38.0 90-94 36.091750000000005 38.0 38.0 38.0 34.0 38.0 95-99 35.991 38.0 38.0 38.0 34.2 38.0 100-104 35.805899999999994 38.0 38.0 38.0 33.8 38.0 105-109 34.9736 38.0 36.8 38.0 28.4 38.0 110-114 34.08925 38.0 34.4 38.0 24.2 38.0 115-119 35.08245 38.0 37.0 38.0 30.6 38.0 120-124 34.871950000000005 38.0 36.4 38.0 29.2 38.0 125-129 34.52065 38.0 36.0 38.0 27.0 38.0 130-134 34.134299999999996 38.0 35.6 38.0 25.0 38.0 135-139 33.4314 38.0 33.4 38.0 20.0 38.0 140-144 32.54815 38.0 33.0 38.0 13.4 38.0 145-149 31.38945 38.0 32.0 38.0 6.2 38.0 150-151 24.8915 32.0 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 11.0 4 6.0 5 3.0 6 4.0 7 2.0 8 1.0 9 6.0 10 3.0 11 4.0 12 3.0 13 6.0 14 10.0 15 7.0 16 6.0 17 8.0 18 9.0 19 9.0 20 5.0 21 2.0 22 12.0 23 5.0 24 12.0 25 10.0 26 21.0 27 11.0 28 16.0 29 32.0 30 43.0 31 74.0 32 78.0 33 103.0 34 194.0 35 381.0 36 987.0 37 1891.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.400000000000006 20.150000000000002 12.8 20.65 2 23.325000000000003 25.724999999999998 32.75 18.2 3 20.974999999999998 27.05 33.050000000000004 18.925 4 23.674999999999997 35.099999999999994 23.275000000000002 17.95 5 22.85 37.724999999999994 21.4 18.025 6 19.375 37.075 25.7 17.849999999999998 7 19.525000000000002 19.650000000000002 39.825 21.0 8 19.675 24.125 30.099999999999998 26.1 9 22.075 25.25 28.725 23.95 10-14 23.39 28.799999999999997 26.355 21.455 15-19 23.09 27.655 28.095 21.16 20-24 23.31 28.449999999999996 28.075 20.165 25-29 22.735 28.93 28.1 20.235 30-34 22.835 28.375 28.235 20.555 35-39 23.005 28.689999999999998 27.96 20.345 40-44 22.685 28.325 27.994999999999997 20.995 45-49 22.585 28.24 28.185 20.990000000000002 50-54 22.88 28.000000000000004 28.515 20.605 55-59 22.78 28.08 28.68 20.46 60-64 22.685 28.694999999999997 27.839999999999996 20.78 65-69 22.745 27.83 27.939999999999998 21.485000000000003 70-74 23.005 28.26 28.294999999999998 20.44 75-79 22.655 28.43 28.015 20.9 80-84 23.16 28.22 28.17 20.45 85-89 23.369999999999997 28.025 27.82 20.785 90-94 23.355 28.075 28.345 20.225 95-99 23.285 28.189999999999998 27.894999999999996 20.630000000000003 100-104 23.905 27.889999999999997 27.675 20.53 105-109 23.995 28.49 27.625 19.89 110-114 24.169999999999998 28.12 27.750000000000004 19.96 115-119 24.025 28.51 27.405 20.06 120-124 24.545 28.04 27.74 19.675 125-129 24.325 28.16 27.615000000000002 19.900000000000002 130-134 24.5 28.16 28.09 19.25 135-139 24.815 28.49 27.455000000000002 19.24 140-144 24.62 29.01 27.345000000000002 19.025 145-149 25.035 28.895 27.27 18.8 150-151 25.70642660665166 28.60715178794699 26.694173543385848 18.992248062015506 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 2.0 19 2.5 20 2.0 21 2.5 22 3.0 23 4.5 24 5.0 25 5.0 26 9.5 27 11.5 28 16.0 29 19.5 30 22.0 31 27.5 32 31.0 33 43.0 34 60.0 35 70.0 36 89.5 37 110.5 38 131.0 39 156.5 40 193.0 41 230.5 42 245.5 43 266.0 44 273.5 45 262.0 46 252.0 47 238.5 48 230.0 49 210.0 50 158.5 51 120.5 52 101.5 53 80.0 54 73.5 55 66.0 56 49.0 57 32.5 58 21.0 59 16.5 60 13.0 61 9.5 62 8.5 63 5.5 64 3.0 65 4.0 66 3.0 67 1.0 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59748427672956 98.97500000000001 2 0.37735849056603776 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.7875 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.7875 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.6125 0.0 0.0 0.0 0.0 110-111 3.9625000000000004 0.0 0.0 0.0 0.0 112-113 4.35 0.0 0.0 0.0 0.0 114-115 4.7875 0.0 0.0 0.0 0.0 116-117 5.2875 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.5 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.4875 0.0 0.0 0.0 0.0 128-129 7.975 0.0 0.0 0.0 0.0 130-131 8.4125 0.0 0.0 0.0 0.0 132-133 8.8875 0.0 0.0 0.0 0.0 134-135 9.4375 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 10.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 205 5.22255E-4 7.780488 70-74 >>END_MODULE Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897077 spots for SRR7171112.sra Written 897077 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra Read 897065 spots for SRR7171112.sra Written 897065 spots for SRR7171112.sra SRR ids: ['SRR7171112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qpeqgtlr SRR7171112.sra spots: 17941312 blocks: [[1, 897065], [897066, 1794130], [1794131, 2691195], [2691196, 3588260], [3588261, 4485325], [4485326, 5382390], [5382391, 6279455], [6279456, 7176520], [7176521, 8073585], [8073586, 8970650], [8970651, 9867715], [9867716, 10764780], [10764781, 11661845], [11661846, 12558910], [12558911, 13455975], [13455976, 14353040], [14353041, 15250105], [15250106, 16147170], [16147171, 17044235], [17044236, 17941312]] SRR7171112 file size 6058021 SRR7171112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171112 SRR7171112_1.fastq SRR7171112_2.fastq Input file: SRR7171112_1.fastq Paired file: SRR7171112_2.fastq trimmed: SRR7171112-trimmed-pair1.fastq, SRR7171112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:09:25 2025 >> started Fri Feb 14 06:09:45 2025 >> done (19.795s) 17941312 read pairs processed; of these: 43288 ( 0.24%) short read pairs filtered out after trimming by size control 144680 ( 0.81%) empty read pairs filtered out after trimming by size control 17753344 (98.95%) read pairs available; of these: 11151978 (62.82%) trimmed read pairs available after processing 6601366 (37.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 26 0.00% 20 27 0.00% 21 37 0.00% 22 34 0.00% 23 45 0.00% 24 40 0.00% 25 40 0.00% 26 54 0.00% 27 65 0.00% 28 65 0.00% 29 63 0.00% 30 79 0.00% 31 69 0.00% 32 76 0.00% 33 77 0.00% 34 77 0.00% 35 88 0.00% 36 113 0.00% 37 110 0.00% 38 157 0.00% 39 218 0.00% 40 243 0.00% 41 214 0.00% 42 198 0.00% 43 263 0.00% 44 275 0.00% 45 307 0.00% 46 403 0.00% 47 447 0.00% 48 485 0.00% 49 556 0.00% 50 554 0.00% 51 704 0.00% 52 786 0.00% 53 800 0.00% 54 845 0.00% 55 864 0.00% 56 973 0.01% 57 1009 0.01% 58 1178 0.01% 59 1284 0.01% 60 1430 0.01% 61 1564 0.01% 62 1778 0.01% 63 1953 0.01% 64 2158 0.01% 65 2173 0.01% 66 2357 0.01% 67 2586 0.01% 68 2893 0.02% 69 3094 0.02% 70 3655 0.02% 71 4200 0.02% 72 5287 0.03% 73 5822 0.03% 74 6290 0.04% 75 8259 0.05% 76 16173 0.09% 77 17980 0.10% 78 10521 0.06% 79 9739 0.05% 80 10102 0.06% 81 10826 0.06% 82 11965 0.07% 83 13245 0.07% 84 15526 0.09% 85 16791 0.09% 86 18002 0.10% 87 18890 0.11% 88 19900 0.11% 89 20720 0.12% 90 21739 0.12% 91 23540 0.13% 92 24418 0.14% 93 26335 0.15% 94 26978 0.15% 95 28331 0.16% 96 29412 0.17% 97 29580 0.17% 98 30632 0.17% 99 31730 0.18% 100 32924 0.19% 101 34315 0.19% 102 36368 0.20% 103 37484 0.21% 104 39246 0.22% 105 40222 0.23% 106 41524 0.23% 107 42282 0.24% 108 42783 0.24% 109 43710 0.25% 110 44919 0.25% 111 45976 0.26% 112 47778 0.27% 113 48990 0.28% 114 50859 0.29% 115 52093 0.29% 116 52974 0.30% 117 54636 0.31% 118 55375 0.31% 119 56009 0.32% 120 57189 0.32% 121 58686 0.33% 122 60599 0.34% 123 62955 0.35% 124 64726 0.36% 125 66608 0.38% 126 68714 0.39% 127 70442 0.40% 128 71614 0.40% 129 74284 0.42% 130 75755 0.43% 131 77444 0.44% 132 81063 0.46% 133 85945 0.48% 134 89350 0.50% 135 95428 0.54% 136 99633 0.56% 137 106279 0.60% 138 113033 0.64% 139 120994 0.68% 140 129408 0.73% 141 140722 0.79% 142 153944 0.87% 143 173547 0.98% 144 198961 1.12% 145 234411 1.32% 146 288404 1.62% 147 385094 2.17% 148 570664 3.21% 149 1112018 6.26% 150 4711052 26.54% 151 6601366 37.18% 17753344 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=24 prefix-density=0.31 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=75.81 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.4 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.61 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=22.65 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.6 sequence=CACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7171112 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:10:31 Started mapping on | Feb 14 06:10:31 Finished on | Feb 14 06:13:14 Mapping speed, Million of reads per hour | 392.10 Number of input reads | 17753344 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16022789 Uniquely mapped reads % | 90.25% Average mapped length | 287.41 Number of splices: Total | 14872494 Number of splices: Annotated (sjdb) | 14498279 Number of splices: GT/AG | 14587477 Number of splices: GC/AG | 217387 Number of splices: AT/AC | 10084 Number of splices: Non-canonical | 57546 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485548 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 54085 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.62% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1285957 1285957 1285957 N_multimapping 485548 485548 485548 N_noFeature 688896 15748504 794758 N_ambiguous 288374 1119 119393 UnstrandedReadsAssigned:15045519 PositiveStrandReadsAssigned:273166 NegativeStrandReadsAssigned:15108638 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7171112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171112-trimmed-pair1.fastq SRR7171112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,753,344 reads, 15,112,038 reads pseudoaligned [quant] estimated average fragment length: 221.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7171112.ke.tsv 34699 SRR7171112.se.tsv 87100 total ==> SRR7171112.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.66 1139 39.733 Potri.005G024800.1.v4.1 1035 814.664 318 24.4785 Potri.004G059700.1.v4.1 961 740.684 1 0.0846649 Potri.007G009000.2.v4.1 1416 1195.66 0 0 Potri.003G141000.2.v4.1 2943 2722.66 789.339 18.1805 Potri.016G087400.1.v4.1 270 93.402 1158.72 777.96 Potri.015G069301.1.v4.1 564 347.621 0 0 Potri.010G195200.1.v4.1 1773 1552.66 361.931 14.6179 Potri.012G127500.1.v4.1 977 756.674 84 6.96157 ==> SRR7171112.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 945 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 248 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7171112 completed mapping pipeline successfully