Starting /dee2/code/volunteer_pipeline.sh SRR7171113 current disk space = 3086162550784 free memory = 1472247772 SRR7171113 SRAfilesize bdaac9c1e8440d445bdbc0de0da4cc3e SRR7171113.sra SRR7171113.sra file validated SRR7171113 is paired end SRR7171113 is conventional basespace SRR7171113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.49425 25.0 18.0 33.0 18.0 33.0 2 29.96525 31.0 28.0 33.0 27.0 33.0 3 31.008 33.0 31.0 33.0 27.0 33.0 4 31.162 33.0 31.0 33.0 29.0 33.0 5 32.388 33.0 33.0 33.0 32.0 33.0 6 36.4575 38.0 37.0 38.0 34.0 38.0 7 37.00825 38.0 38.0 38.0 35.0 38.0 8 37.4245 38.0 38.0 38.0 37.0 38.0 9 37.4695 38.0 38.0 38.0 37.0 38.0 10-14 37.43075 38.0 38.0 38.0 37.0 38.0 15-19 37.47825 38.0 38.0 38.0 37.0 38.0 20-24 37.388149999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.38905 38.0 38.0 38.0 37.0 38.0 30-34 37.41605 38.0 38.0 38.0 37.0 38.0 35-39 37.413650000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.300200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.235400000000006 38.0 38.0 38.0 36.8 38.0 50-54 36.937850000000005 38.0 38.0 38.0 35.4 38.0 55-59 35.9695 38.0 36.8 38.0 29.8 38.0 60-64 36.979600000000005 38.0 38.0 38.0 35.6 38.0 65-69 36.90849999999999 38.0 38.0 38.0 35.4 38.0 70-74 36.73875 38.0 38.0 38.0 34.6 38.0 75-79 36.6326 38.0 38.0 38.0 34.4 38.0 80-84 36.6134 38.0 38.0 38.0 34.0 38.0 85-89 36.331599999999995 38.0 37.4 38.0 33.8 38.0 90-94 36.136399999999995 38.0 37.0 38.0 32.8 38.0 95-99 35.99445000000001 38.0 37.0 38.0 32.6 38.0 100-104 36.114799999999995 38.0 37.0 38.0 33.0 38.0 105-109 36.00675 38.0 37.0 38.0 33.0 38.0 110-114 35.74145 38.0 36.6 38.0 31.4 38.0 115-119 35.0093 38.0 35.6 38.0 27.6 38.0 120-124 35.040499999999994 38.0 35.2 38.0 28.0 38.0 125-129 34.9114 38.0 35.0 38.0 27.8 38.0 130-134 31.589949999999998 35.2 27.8 38.0 18.8 38.0 135-139 33.57235 37.8 34.0 38.0 21.8 38.0 140-144 33.10745 38.0 33.4 38.0 16.2 38.0 145-149 32.20145000000001 37.0 32.2 38.0 13.8 38.0 150-151 27.664375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 2.0 17 3.0 18 2.0 19 5.0 20 2.0 21 5.0 22 7.0 23 11.0 24 14.0 25 10.0 26 14.0 27 28.0 28 34.0 29 40.0 30 40.0 31 82.0 32 108.0 33 160.0 34 257.0 35 489.0 36 1264.0 37 1416.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.14865577227201 13.70585134422773 8.434370057986294 33.71112282551397 2 19.874843554443054 17.94743429286608 36.69586983729662 25.481852315394242 3 18.45 24.5 29.599999999999998 27.450000000000003 4 23.0 30.049999999999997 25.124999999999996 21.825 5 20.875 36.65 25.05 17.424999999999997 6 16.925 35.449999999999996 27.125 20.5 7 12.85 23.375 45.25 18.525 8 16.150000000000002 22.875 33.074999999999996 27.900000000000002 9 18.55 24.0 32.15 25.3 10-14 20.080000000000002 29.115000000000002 26.795 24.01 15-19 20.080000000000002 28.21 27.97 23.74 20-24 19.900000000000002 28.285 28.494999999999997 23.32 25-29 20.095 28.625 28.189999999999998 23.09 30-34 19.814999999999998 29.615000000000002 27.185 23.385 35-39 19.775000000000002 28.975 28.310000000000002 22.939999999999998 40-44 19.66 29.349999999999998 27.275 23.715 45-49 19.955000000000002 28.845 27.529999999999998 23.669999999999998 50-54 19.945 28.560000000000002 28.27 23.225 55-59 19.580000000000002 29.095 28.215 23.11 60-64 19.965 28.08 28.110000000000003 23.845 65-69 20.18 28.255000000000003 28.299999999999997 23.265 70-74 19.665 29.34 27.474999999999998 23.52 75-79 20.645 28.785 27.655 22.915 80-84 20.43 28.444999999999997 27.77 23.355 85-89 20.28 28.005000000000003 28.249999999999996 23.465 90-94 19.97 28.389999999999997 28.310000000000002 23.330000000000002 95-99 20.25 28.349999999999998 28.34 23.06 100-104 20.155 29.049999999999997 27.72 23.075000000000003 105-109 20.32 28.794999999999998 27.36 23.525 110-114 20.43 28.395 27.939999999999998 23.235 115-119 21.099999999999998 28.49 27.32 23.09 120-124 20.515 28.725 27.24 23.52 125-129 20.979999999999997 28.560000000000002 26.99 23.47 130-134 20.810000000000002 28.365000000000002 27.66 23.165 135-139 20.965 29.205 26.69 23.14 140-144 20.565 28.685 27.084999999999997 23.665 145-149 20.61 28.804999999999996 27.115000000000002 23.47 150-151 20.45 29.5 26.5875 23.4625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 1.5 22 2.5 23 3.0 24 3.0 25 5.0 26 11.0 27 12.5 28 8.5 29 13.5 30 24.0 31 35.0 32 42.0 33 42.0 34 58.5 35 85.0 36 111.0 37 134.5 38 150.5 39 161.0 40 179.0 41 218.5 42 248.0 43 253.5 44 257.5 45 256.5 46 237.5 47 237.5 48 229.0 49 199.0 50 176.5 51 139.0 52 100.0 53 81.5 54 70.5 55 58.0 56 42.0 57 25.0 58 19.5 59 17.0 60 12.5 61 8.5 62 7.0 63 5.0 64 2.5 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.1499999999999995 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31921331316188 98.475 2 0.529500756429652 1.05 3 0.12607160867372666 0.375 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.3375 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.1125 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.387499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.432 33.0 32.0 34.0 32.0 34.0 2 32.68925 33.0 33.0 34.0 32.0 34.0 3 30.46775 33.0 31.0 34.0 18.0 34.0 4 31.93925 33.0 32.0 34.0 27.0 34.0 5 32.52875 33.0 33.0 34.0 32.0 34.0 6 36.87325 38.0 38.0 38.0 36.0 38.0 7 36.97475 38.0 38.0 38.0 36.0 38.0 8 37.1 38.0 38.0 38.0 37.0 38.0 9 37.13725 38.0 38.0 38.0 37.0 38.0 10-14 37.09185 38.0 38.0 38.0 37.0 38.0 15-19 37.05575 38.0 38.0 38.0 36.6 38.0 20-24 36.65815 38.0 38.0 38.0 34.6 38.0 25-29 36.47925 38.0 38.0 38.0 34.2 38.0 30-34 36.75665 38.0 38.0 38.0 35.6 38.0 35-39 36.848349999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.90315 38.0 38.0 38.0 36.0 38.0 45-49 36.91415000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.8883 38.0 38.0 38.0 36.0 38.0 55-59 36.80865 38.0 38.0 38.0 35.8 38.0 60-64 36.77315 38.0 38.0 38.0 35.4 38.0 65-69 36.71345 38.0 38.0 38.0 35.6 38.0 70-74 36.7014 38.0 38.0 38.0 35.2 38.0 75-79 36.617599999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.27845 38.0 38.0 38.0 33.8 38.0 85-89 36.2482 38.0 38.0 38.0 33.8 38.0 90-94 36.38295 38.0 38.0 38.0 34.0 38.0 95-99 36.306 38.0 38.0 38.0 34.0 38.0 100-104 35.9799 38.0 37.4 38.0 33.2 38.0 105-109 35.627750000000006 38.0 37.0 38.0 31.4 38.0 110-114 33.90305 37.4 32.6 38.0 26.2 38.0 115-119 34.934000000000005 38.0 35.4 38.0 27.8 38.0 120-124 35.201350000000005 38.0 36.0 38.0 28.8 38.0 125-129 34.8737 38.0 35.6 38.0 27.8 38.0 130-134 34.65495 38.0 35.0 38.0 26.4 38.0 135-139 34.14205 38.0 33.6 38.0 24.6 38.0 140-144 33.43605 38.0 33.2 38.0 21.4 38.0 145-149 32.5116 38.0 33.0 38.0 12.4 38.0 150-151 27.29025 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 1.0 5 1.0 6 3.0 7 1.0 8 1.0 9 2.0 10 3.0 11 3.0 12 2.0 13 4.0 14 2.0 15 0.0 16 2.0 17 6.0 18 6.0 19 7.0 20 9.0 21 4.0 22 4.0 23 8.0 24 20.0 25 19.0 26 24.0 27 26.0 28 33.0 29 45.0 30 53.0 31 85.0 32 81.0 33 117.0 34 178.0 35 330.0 36 738.0 37 2169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.225 21.8 10.7 22.275 2 25.962981490745374 23.58679339669835 32.86643321660831 17.58379189594797 3 21.61080540270135 27.113556778389196 31.51575787893947 19.759879939969984 4 23.54854854854855 35.310310310310314 22.52252252252252 18.61861861861862 5 23.204005006257823 38.97371714643304 20.95118898623279 16.871088861076345 6 18.98449224612306 39.11955977988995 23.336668334167083 18.55927963981991 7 19.2 18.4 41.3 21.099999999999998 8 19.425 24.25 29.7 26.625 9 21.575 24.425 29.725 24.275 10-14 23.321166058302914 29.146457322866144 25.911295564778236 21.621081054052702 15-19 23.00460092018404 28.285657131426284 27.925585117023406 20.784156831366275 20-24 23.422026607982392 28.543563068920676 27.608282484745423 20.426127838351505 25-29 22.699079631852744 28.651460584233696 28.061224489795915 20.588235294117645 30-34 22.004400880176036 28.29565913182637 28.650730146029208 21.049209841968395 35-39 22.824129651860744 27.81112444977991 28.38635454181673 20.978391356542616 40-44 22.70181054316295 27.778333500050017 28.873662098629588 20.646193858157446 45-49 22.900000000000002 27.74 29.065 20.294999999999998 50-54 23.014602920584117 28.000600120024004 28.035607121424285 20.949189837967594 55-59 22.352235223522353 28.63286328632863 28.26282628262826 20.75207520752075 60-64 23.016905071521457 27.728318495548663 28.43853155946784 20.81624487346204 65-69 22.129425885177035 27.81056211242248 28.62072414482897 21.439287857571514 70-74 22.949179671868748 27.77611044417767 28.271308523409367 21.00340136054422 75-79 22.74409763905562 28.11124449779912 28.34133653461385 20.803321328531414 80-84 23.39435774309724 27.485994397759107 28.00120048019208 21.11844737895158 85-89 23.630000000000003 28.28 27.655 20.435 90-94 23.62326814385035 28.48997149002151 27.73970889811434 20.147051468013803 95-99 23.83214964489347 27.993398019405824 27.30319095728719 20.871261378413525 100-104 23.084616923384676 28.350670134026807 27.940588117623527 20.624124824964994 105-109 23.557956876281956 27.930361698934412 28.22052128670769 20.29116013807594 110-114 23.79213764129239 28.19845953786136 27.663298989696912 20.346103831149346 115-119 24.624924984996998 28.235647129425885 27.670534106821364 19.46889377875575 120-124 23.813334667133496 28.149852448356928 27.859750912819486 20.17706197169009 125-129 24.270921914861688 27.93757190735831 27.832524636086237 19.958981541693763 130-134 24.74742422726818 28.273482044613385 26.622986896068824 20.356106832049615 135-139 24.324729891956785 28.156262505002 27.591036414565828 19.92797118847539 140-144 24.89120104046821 27.53238957530889 27.93757190735831 19.63883747686459 145-149 25.122536761028307 28.163449034710414 27.223166950085027 19.490847254176252 150-151 25.174999999999997 28.3625 27.474999999999998 18.987499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 3.5 25 4.0 26 7.0 27 10.0 28 12.0 29 13.0 30 13.0 31 17.5 32 30.0 33 45.5 34 61.5 35 76.0 36 97.0 37 112.5 38 128.0 39 160.5 40 195.5 41 224.0 42 253.5 43 281.0 44 283.0 45 268.5 46 262.0 47 240.0 48 215.0 49 195.5 50 160.5 51 133.5 52 111.0 53 84.5 54 80.0 55 70.5 56 43.0 57 30.5 58 22.5 59 19.0 60 12.0 61 3.5 62 4.5 63 3.0 64 0.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.1 5 0.125 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.02 20-24 0.03 25-29 0.04 30-34 0.02 35-39 0.04 40-44 0.03 45-49 0.0 50-54 0.02 55-59 0.01 60-64 0.03 65-69 0.02 70-74 0.04 75-79 0.04 80-84 0.04 85-89 0.0 90-94 0.034999999999999996 95-99 0.03 100-104 0.02 105-109 0.055 110-114 0.03 115-119 0.02 120-124 0.034999999999999996 125-129 0.045 130-134 0.03 135-139 0.04 140-144 0.045 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24184988627748 98.175 2 0.6065200909780136 1.2 3 0.0758150113722517 0.22499999999999998 4 0.025271670457417232 0.1 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.9124999999999996 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.9250000000000003 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.675 0.0 0.0 0.0 0.0 128-129 5.050000000000001 0.0 0.0 0.0 0.0 130-131 5.575 0.0 0.0 0.0 0.0 132-133 6.1125 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATGT 10 0.0070833815 143.25 7 >>END_MODULE Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841358 spots for SRR7171113.sra Written 841358 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra Read 841353 spots for SRR7171113.sra Written 841353 spots for SRR7171113.sra SRR ids: ['SRR7171113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4clmk1ti SRR7171113.sra spots: 16827065 blocks: [[1, 841353], [841354, 1682706], [1682707, 2524059], [2524060, 3365412], [3365413, 4206765], [4206766, 5048118], [5048119, 5889471], [5889472, 6730824], [6730825, 7572177], [7572178, 8413530], [8413531, 9254883], [9254884, 10096236], [10096237, 10937589], [10937590, 11778942], [11778943, 12620295], [12620296, 13461648], [13461649, 14303001], [14303002, 15144354], [15144355, 15985707], [15985708, 16827065]] SRR7171113 file size 5680439 SRR7171113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171113 SRR7171113_1.fastq SRR7171113_2.fastq Input file: SRR7171113_1.fastq Paired file: SRR7171113_2.fastq trimmed: SRR7171113-trimmed-pair1.fastq, SRR7171113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:23:20 2025 >> started Fri Feb 14 05:23:41 2025 >> done (21.265s) 16827065 read pairs processed; of these: 12889 ( 0.08%) short read pairs filtered out after trimming by size control 21277 ( 0.13%) empty read pairs filtered out after trimming by size control 16792899 (99.80%) read pairs available; of these: 9801454 (58.37%) trimmed read pairs available after processing 6991445 (41.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 8 0.00% 21 9 0.00% 22 9 0.00% 23 8 0.00% 24 8 0.00% 25 14 0.00% 26 10 0.00% 27 7 0.00% 28 13 0.00% 29 8 0.00% 30 2 0.00% 31 25 0.00% 32 12 0.00% 33 13 0.00% 34 14 0.00% 35 16 0.00% 36 13 0.00% 37 10 0.00% 38 20 0.00% 39 17 0.00% 40 22 0.00% 41 25 0.00% 42 31 0.00% 43 25 0.00% 44 36 0.00% 45 40 0.00% 46 37 0.00% 47 47 0.00% 48 71 0.00% 49 76 0.00% 50 75 0.00% 51 79 0.00% 52 111 0.00% 53 112 0.00% 54 100 0.00% 55 123 0.00% 56 171 0.00% 57 181 0.00% 58 165 0.00% 59 247 0.00% 60 278 0.00% 61 267 0.00% 62 377 0.00% 63 366 0.00% 64 425 0.00% 65 446 0.00% 66 503 0.00% 67 534 0.00% 68 622 0.00% 69 718 0.00% 70 796 0.00% 71 965 0.01% 72 1075 0.01% 73 1331 0.01% 74 1382 0.01% 75 1577 0.01% 76 1840 0.01% 77 2045 0.01% 78 2165 0.01% 79 2369 0.01% 80 2695 0.02% 81 3054 0.02% 82 3512 0.02% 83 4026 0.02% 84 4996 0.03% 85 5809 0.03% 86 6320 0.04% 87 6735 0.04% 88 7141 0.04% 89 7526 0.04% 90 8186 0.05% 91 8807 0.05% 92 9588 0.06% 93 10583 0.06% 94 11337 0.07% 95 12298 0.07% 96 12853 0.08% 97 13890 0.08% 98 14171 0.08% 99 15261 0.09% 100 16243 0.10% 101 17119 0.10% 102 18345 0.11% 103 19600 0.12% 104 20851 0.12% 105 22244 0.13% 106 22997 0.14% 107 24094 0.14% 108 25322 0.15% 109 26144 0.16% 110 27025 0.16% 111 28324 0.17% 112 29857 0.18% 113 31318 0.19% 114 32730 0.19% 115 34350 0.20% 116 36105 0.22% 117 36973 0.22% 118 38079 0.23% 119 39259 0.23% 120 40592 0.24% 121 42444 0.25% 122 43549 0.26% 123 45549 0.27% 124 47765 0.28% 125 49407 0.29% 126 51611 0.31% 127 53919 0.32% 128 55614 0.33% 129 57850 0.34% 130 59769 0.36% 131 62321 0.37% 132 65473 0.39% 133 69607 0.41% 134 73212 0.44% 135 78380 0.47% 136 82348 0.49% 137 88743 0.53% 138 95489 0.57% 139 104144 0.62% 140 111828 0.67% 141 125118 0.75% 142 142148 0.85% 143 162997 0.97% 144 195651 1.17% 145 236458 1.41% 146 295748 1.76% 147 404840 2.41% 148 620969 3.70% 149 1186630 7.07% 150 4313408 25.69% 151 6991445 41.63% 16792899 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=19 prefix-density=0.52 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=270.40 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=22 prefix-density=0.65 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=56.18 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.8 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7171113 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:24:26 Started mapping on | Feb 14 05:24:27 Finished on | Feb 14 05:26:39 Mapping speed, Million of reads per hour | 457.99 Number of input reads | 16792899 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15763449 Uniquely mapped reads % | 93.87% Average mapped length | 291.95 Number of splices: Total | 15210069 Number of splices: Annotated (sjdb) | 14840626 Number of splices: GT/AG | 14913896 Number of splices: GC/AG | 234610 Number of splices: AT/AC | 8889 Number of splices: Non-canonical | 52674 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419749 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 28507 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624564 624564 624564 N_multimapping 419749 419749 419749 N_noFeature 641684 15509618 740904 N_ambiguous 271277 1254 115908 UnstrandedReadsAssigned:14850488 PositiveStrandReadsAssigned:252577 NegativeStrandReadsAssigned:14906637 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7171113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171113-trimmed-pair1.fastq SRR7171113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,792,899 reads, 14,797,839 reads pseudoaligned [quant] estimated average fragment length: 237.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR7171113.ke.tsv 34699 SRR7171113.se.tsv 87100 total ==> SRR7171113.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.83 624 21.4186 Potri.005G024800.1.v4.1 1035 798.834 318 24.3469 Potri.004G059700.1.v4.1 961 724.852 4 0.337508 Potri.007G009000.2.v4.1 1416 1179.83 0 0 Potri.003G141000.2.v4.1 2943 2706.83 860.467 19.4422 Potri.016G087400.1.v4.1 270 84.7025 953 688.129 Potri.015G069301.1.v4.1 564 332.707 0 0 Potri.010G195200.1.v4.1 1773 1536.83 161 6.40726 Potri.012G127500.1.v4.1 977 740.834 172 14.1997 ==> SRR7171113.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 397 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 280 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 9 SRR7171113 completed mapping pipeline successfully