Starting /dee2/code/volunteer_pipeline.sh SRR7171114 current disk space = 3085441347584 free memory = 1582287224 SRR7171114 SRAfilesize 66a961ea09558e59cdd26dfcecb111d8 SRR7171114.sra SRR7171114.sra file validated SRR7171114 is paired end SRR7171114 is conventional basespace SRR7171114 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171114_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.55425 18.0 18.0 30.0 18.0 32.0 2 30.15375 31.0 29.0 33.0 27.0 33.0 3 31.514 33.0 31.0 33.0 29.0 33.0 4 31.65075 33.0 31.0 33.0 29.0 33.0 5 32.497 33.0 33.0 33.0 31.0 34.0 6 35.08875 38.0 35.0 38.0 29.0 38.0 7 36.46375 38.0 37.0 38.0 33.0 38.0 8 37.0745 38.0 38.0 38.0 35.0 38.0 9 37.424 38.0 38.0 38.0 37.0 38.0 10-14 37.38705 38.0 38.0 38.0 37.0 38.0 15-19 37.40895 38.0 38.0 38.0 37.0 38.0 20-24 37.48135 38.0 38.0 38.0 37.4 38.0 25-29 37.48885 38.0 38.0 38.0 37.4 38.0 30-34 37.44345 38.0 38.0 38.0 37.0 38.0 35-39 37.428999999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.34095 38.0 38.0 38.0 37.0 38.0 45-49 37.366 38.0 38.0 38.0 37.0 38.0 50-54 37.2233 38.0 38.0 38.0 36.8 38.0 55-59 37.143100000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.10655 38.0 38.0 38.0 36.0 38.0 65-69 36.0812 38.0 37.0 38.0 31.6 38.0 70-74 36.22275 38.0 37.2 38.0 30.6 38.0 75-79 36.9511 38.0 38.0 38.0 35.8 38.0 80-84 36.85435 38.0 38.0 38.0 35.8 38.0 85-89 36.644349999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.55655 38.0 38.0 38.0 34.4 38.0 95-99 36.5291 38.0 38.0 38.0 34.2 38.0 100-104 36.45435 38.0 38.0 38.0 34.0 38.0 105-109 36.26389999999999 38.0 37.4 38.0 33.8 38.0 110-114 36.12875 38.0 37.2 38.0 33.6 38.0 115-119 35.898849999999996 38.0 37.0 38.0 32.4 38.0 120-124 35.7068 38.0 37.0 38.0 31.4 38.0 125-129 35.086749999999995 38.0 35.8 38.0 29.4 38.0 130-134 34.4705 38.0 34.0 38.0 25.8 38.0 135-139 34.3949 38.0 34.4 38.0 26.2 38.0 140-144 33.57865 38.0 33.0 38.0 21.8 38.0 145-149 32.416799999999995 38.0 33.0 38.0 12.8 38.0 150-151 27.198875 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 7.0 19 6.0 20 3.0 21 5.0 22 5.0 23 4.0 24 10.0 25 7.0 26 18.0 27 23.0 28 27.0 29 48.0 30 44.0 31 78.0 32 92.0 33 106.0 34 195.0 35 388.0 36 915.0 37 2010.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.97601428935953 15.641745343199794 6.812962490431232 51.56927787700945 2 12.7 18.175 52.300000000000004 16.825000000000003 3 12.325 22.15 34.075 31.45 4 17.95 30.775000000000002 28.9 22.375 5 19.125 34.9 27.900000000000002 18.075 6 16.8 36.625 27.1 19.475 7 13.325000000000001 22.5 46.25 17.925 8 14.499999999999998 22.325 35.65 27.525 9 14.924999999999999 21.975 38.550000000000004 24.55 10-14 18.82 27.91 28.444999999999997 24.825 15-19 19.15 28.599999999999998 28.34 23.91 20-24 19.56 29.110000000000003 28.055000000000003 23.275000000000002 25-29 18.955 29.465000000000003 28.115000000000002 23.465 30-34 19.400000000000002 28.794999999999998 27.865000000000002 23.94 35-39 19.695 27.884999999999998 28.68 23.74 40-44 19.634999999999998 28.765 28.199999999999996 23.400000000000002 45-49 19.195 29.26 27.92 23.625 50-54 19.93 28.76 27.61 23.7 55-59 19.775000000000002 29.24 27.29 23.695 60-64 19.919999999999998 28.275 28.12 23.685000000000002 65-69 19.6 29.115000000000002 27.395000000000003 23.89 70-74 19.79 29.07 27.77 23.369999999999997 75-79 20.455000000000002 28.599999999999998 27.834999999999997 23.11 80-84 20.424999999999997 28.694999999999997 27.36 23.52 85-89 20.59 28.610000000000003 27.275 23.525 90-94 20.115 28.515 27.87 23.5 95-99 20.8010400520026 28.356417820891046 27.566378318915945 23.276163808190407 100-104 20.150000000000002 28.82 27.205000000000002 23.825 105-109 20.57 28.715000000000003 27.13 23.585 110-114 20.625 28.29 27.334999999999997 23.75 115-119 20.895 28.7 26.889999999999997 23.515 120-124 20.905 28.655 26.805 23.635 125-129 21.05 28.139999999999997 26.97 23.84 130-134 21.445 28.27 26.450000000000003 23.835 135-139 21.46 28.21 26.6 23.73 140-144 21.425 28.225 26.810000000000002 23.54 145-149 21.305 28.585 26.625 23.485 150-151 21.35800925347005 27.58534450418907 27.235213204951858 23.82143303738902 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.0 21 1.5 22 1.0 23 1.5 24 2.5 25 5.0 26 7.0 27 9.0 28 9.5 29 15.0 30 25.5 31 39.5 32 51.0 33 64.5 34 76.0 35 90.5 36 102.5 37 115.5 38 152.5 39 170.0 40 201.5 41 230.5 42 234.5 43 258.0 44 261.0 45 249.5 46 256.0 47 253.0 48 217.5 49 188.0 50 152.5 51 112.5 52 95.0 53 92.5 54 80.0 55 53.0 56 34.5 57 21.5 58 17.5 59 16.0 60 12.5 61 5.5 62 1.5 63 2.0 64 2.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7059122050241 97.25 2 1.1418421720375538 2.25 3 0.10149708195889369 0.3 4 0.050748540979446845 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.36250000000000004 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.6000000000000001 0.0 0.0 0.0 0.0 82-83 0.7124999999999999 0.0 0.0 0.0 0.0 84-85 0.7875000000000001 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.05 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.4125 0.0 0.0 0.0 0.0 94-95 1.675 0.0 0.0 0.0 0.0 96-97 1.975 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.7874999999999996 0.0 0.0 0.0 0.0 102-103 3.1875 0.0 0.0 0.0 0.0 104-105 3.6875 0.0 0.0 0.0 0.0 106-107 4.1375 0.0 0.0 0.0 0.0 108-109 4.525 0.0 0.0 0.0 0.0 110-111 4.8875 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 114-115 5.85 0.0 0.0 0.0 0.0 116-117 6.4375 0.0 0.0 0.0 0.0 118-119 6.9375 0.0 0.0 0.0 0.0 120-121 7.3125 0.0 0.0 0.0 0.0 122-123 7.8125 0.0 0.0 0.0 0.0 124-125 8.45 0.0 0.0 0.0 0.0 126-127 9.162500000000001 0.0 0.0 0.0 0.0 128-129 9.649999999999999 0.0 0.0 0.0 0.0 130-131 10.524999999999999 0.0 0.0 0.0 0.0 132-133 11.100000000000001 0.0 0.0 0.0 0.0 134-135 11.649999999999999 0.0 0.0 0.0 0.0 136-137 12.162500000000001 0.0 0.0 0.0 0.0 138-139 12.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171114 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171114_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.87725 33.0 33.0 34.0 27.0 34.0 2 32.7055 33.0 33.0 34.0 32.0 34.0 3 32.94325 33.0 33.0 34.0 32.0 34.0 4 33.01975 34.0 33.0 34.0 32.0 34.0 5 33.06975 34.0 33.0 34.0 33.0 34.0 6 37.3625 38.0 38.0 38.0 37.0 38.0 7 37.3875 38.0 38.0 38.0 37.0 38.0 8 37.356 38.0 38.0 38.0 37.0 38.0 9 37.353 38.0 38.0 38.0 37.0 38.0 10-14 37.138400000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.2685 38.0 38.0 38.0 36.8 38.0 20-24 35.588049999999996 38.0 35.4 38.0 27.0 38.0 25-29 37.10385 38.0 38.0 38.0 36.4 38.0 30-34 37.3379 38.0 38.0 38.0 37.0 38.0 35-39 37.2684 38.0 38.0 38.0 37.0 38.0 40-44 37.20405000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.0693 38.0 38.0 38.0 36.8 38.0 50-54 36.5707 38.0 37.8 38.0 34.4 38.0 55-59 37.030649999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.0357 38.0 38.0 38.0 36.2 38.0 65-69 36.929700000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.8981 38.0 38.0 38.0 36.0 38.0 75-79 36.9096 38.0 38.0 38.0 36.0 38.0 80-84 35.98765 38.0 37.0 38.0 30.2 38.0 85-89 36.661649999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.584900000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.54265 38.0 38.0 38.0 34.6 38.0 100-104 36.357549999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.619150000000005 38.0 37.0 38.0 30.2 38.0 110-114 35.878949999999996 38.0 37.0 38.0 32.0 38.0 115-119 35.6776 38.0 37.0 38.0 31.0 38.0 120-124 35.54795 38.0 36.8 38.0 31.0 38.0 125-129 35.197500000000005 38.0 36.2 38.0 29.8 38.0 130-134 34.485499999999995 38.0 35.2 38.0 26.2 38.0 135-139 33.8267 38.0 33.6 38.0 23.0 38.0 140-144 32.8084 38.0 33.0 38.0 15.8 38.0 145-149 31.835949999999997 38.0 33.0 38.0 8.6 38.0 150-151 25.655625 32.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 1.0 6 3.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 3.0 16 6.0 17 6.0 18 8.0 19 5.0 20 4.0 21 3.0 22 3.0 23 8.0 24 8.0 25 8.0 26 16.0 27 26.0 28 32.0 29 30.0 30 61.0 31 86.0 32 104.0 33 129.0 34 192.0 35 297.0 36 872.0 37 2076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.575 24.125 6.375 40.925 2 20.225 23.9 44.224999999999994 11.65 3 13.950000000000001 28.449999999999996 36.55 21.05 4 19.125 37.775 24.224999999999998 18.875 5 23.45 38.074999999999996 23.075000000000003 15.4 6 17.575 40.849999999999994 23.474999999999998 18.099999999999998 7 18.625 19.7 41.349999999999994 20.325 8 17.599999999999998 24.025 31.2 27.175 9 19.075 23.400000000000002 32.85 24.675 10-14 22.759999999999998 28.02 26.815 22.405 15-19 23.044999999999998 28.194999999999997 27.644999999999996 21.115000000000002 20-24 22.34 28.634999999999998 27.92 21.105 25-29 22.515 27.965 28.410000000000004 21.11 30-34 22.29 28.405 28.305000000000003 21.0 35-39 22.509999999999998 28.299999999999997 27.935 21.255 40-44 23.11 28.255000000000003 27.655 20.979999999999997 45-49 23.02 27.875 28.299999999999997 20.805 50-54 23.095 27.900000000000002 28.005000000000003 21.0 55-59 23.369999999999997 27.529999999999998 28.285 20.815 60-64 23.175 27.47 27.91 21.445 65-69 23.445 28.01 27.575 20.97 70-74 22.98 27.894999999999996 28.065 21.060000000000002 75-79 22.875 27.47 28.249999999999996 21.404999999999998 80-84 23.45 28.04 27.544999999999998 20.965 85-89 23.380000000000003 28.33 27.495000000000005 20.794999999999998 90-94 23.810000000000002 27.435 28.115000000000002 20.64 95-99 23.04 28.144999999999996 28.125 20.69 100-104 24.4 28.660000000000004 26.75 20.19 105-109 23.78 28.415000000000003 27.47 20.335 110-114 24.51 28.52 27.075 19.895 115-119 24.79 28.315 27.105 19.79 120-124 24.58 28.455000000000002 27.615000000000002 19.35 125-129 24.625 28.355000000000004 27.13 19.89 130-134 24.755 28.65 27.43 19.165 135-139 24.9 28.165000000000003 27.505000000000003 19.43 140-144 25.480000000000004 28.494999999999997 27.295 18.73 145-149 25.955000000000002 29.110000000000003 26.52 18.415 150-151 26.35988495685882 28.998374390396396 26.58496936351132 18.05677128923346 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 4.5 25 8.0 26 7.0 27 7.0 28 13.5 29 16.5 30 14.5 31 26.0 32 35.0 33 44.0 34 56.5 35 64.5 36 84.0 37 109.0 38 140.0 39 161.5 40 188.0 41 229.5 42 255.5 43 271.5 44 271.5 45 261.5 46 261.5 47 253.5 48 221.0 49 195.5 50 167.5 51 138.0 52 111.0 53 91.5 54 84.0 55 64.0 56 40.0 57 28.0 58 24.0 59 15.0 60 9.5 61 7.0 62 6.0 63 4.0 64 1.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26823113802675 98.35000000000001 2 0.5551349987383295 1.0999999999999999 3 0.1514004542013626 0.44999999999999996 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.2374999999999998 0.0 0.0 0.0 0.0 92-93 1.3875 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.9500000000000002 0.0 0.0 0.0 0.0 98-99 2.3 0.0 0.0 0.0 0.0 100-101 2.6624999999999996 0.0 0.0 0.0 0.0 102-103 3.0374999999999996 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.300000000000001 0.0 0.0 0.0 0.0 110-111 4.6625 0.0 0.0 0.0 0.0 112-113 5.1625 0.0 0.0 0.0 0.0 114-115 5.625 0.0 0.0 0.0 0.0 116-117 6.225 0.0 0.0 0.0 0.0 118-119 6.7375 0.0 0.0 0.0 0.0 120-121 7.1125 0.0 0.0 0.0 0.0 122-123 7.6125 0.0 0.0 0.0 0.0 124-125 8.225 0.0 0.0 0.0 0.0 126-127 8.912500000000001 0.0 0.0 0.0 0.0 128-129 9.399999999999999 0.0 0.0 0.0 0.0 130-131 10.25 0.0 0.0 0.0 0.0 132-133 10.850000000000001 0.0 0.0 0.0 0.0 134-135 11.4125 0.0 0.0 0.0 0.0 136-137 11.912500000000001 0.0 0.0 0.0 0.0 138-139 12.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775430 spots for SRR7171114.sra Written 775430 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra Read 775424 spots for SRR7171114.sra Written 775424 spots for SRR7171114.sra SRR ids: ['SRR7171114.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rid5kycc SRR7171114.sra spots: 15508486 blocks: [[1, 775424], [775425, 1550848], [1550849, 2326272], [2326273, 3101696], [3101697, 3877120], [3877121, 4652544], [4652545, 5427968], [5427969, 6203392], [6203393, 6978816], [6978817, 7754240], [7754241, 8529664], [8529665, 9305088], [9305089, 10080512], [10080513, 10855936], [10855937, 11631360], [11631361, 12406784], [12406785, 13182208], [13182209, 13957632], [13957633, 14733056], [14733057, 15508486]] SRR7171114 file size 5233616 SRR7171114 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171114 SRR7171114_1.fastq SRR7171114_2.fastq Input file: SRR7171114_1.fastq Paired file: SRR7171114_2.fastq trimmed: SRR7171114-trimmed-pair1.fastq, SRR7171114-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:20:11 2025 >> started Fri Feb 14 06:20:28 2025 >> done (17.153s) 15508486 read pairs processed; of these: 9262 ( 0.06%) short read pairs filtered out after trimming by size control 40272 ( 0.26%) empty read pairs filtered out after trimming by size control 15458952 (99.68%) read pairs available; of these: 10085188 (65.24%) trimmed read pairs available after processing 5373764 (34.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 40 0.00% 19 34 0.00% 20 34 0.00% 21 36 0.00% 22 28 0.00% 23 30 0.00% 24 39 0.00% 25 42 0.00% 26 40 0.00% 27 44 0.00% 28 44 0.00% 29 40 0.00% 30 41 0.00% 31 44 0.00% 32 49 0.00% 33 51 0.00% 34 43 0.00% 35 54 0.00% 36 69 0.00% 37 58 0.00% 38 95 0.00% 39 99 0.00% 40 118 0.00% 41 120 0.00% 42 116 0.00% 43 134 0.00% 44 137 0.00% 45 207 0.00% 46 183 0.00% 47 230 0.00% 48 297 0.00% 49 308 0.00% 50 358 0.00% 51 410 0.00% 52 473 0.00% 53 512 0.00% 54 496 0.00% 55 539 0.00% 56 573 0.00% 57 663 0.00% 58 826 0.01% 59 817 0.01% 60 1036 0.01% 61 1135 0.01% 62 1387 0.01% 63 1554 0.01% 64 1550 0.01% 65 1749 0.01% 66 1908 0.01% 67 2030 0.01% 68 2304 0.01% 69 2478 0.02% 70 3030 0.02% 71 3455 0.02% 72 4231 0.03% 73 4592 0.03% 74 4924 0.03% 75 5388 0.03% 76 6140 0.04% 77 6775 0.04% 78 6564 0.04% 79 7331 0.05% 80 8111 0.05% 81 8941 0.06% 82 10271 0.07% 83 11052 0.07% 84 12568 0.08% 85 13532 0.09% 86 14334 0.09% 87 15072 0.10% 88 16164 0.10% 89 16848 0.11% 90 18209 0.12% 91 19368 0.13% 92 20806 0.13% 93 22961 0.15% 94 24073 0.16% 95 25565 0.17% 96 25803 0.17% 97 26688 0.17% 98 27668 0.18% 99 27964 0.18% 100 29849 0.19% 101 30442 0.20% 102 32703 0.21% 103 34224 0.22% 104 36275 0.23% 105 37290 0.24% 106 38467 0.25% 107 38075 0.25% 108 39010 0.25% 109 40239 0.26% 110 41074 0.27% 111 42163 0.27% 112 44053 0.28% 113 45270 0.29% 114 46615 0.30% 115 49616 0.32% 116 50548 0.33% 117 50407 0.33% 118 51212 0.33% 119 51644 0.33% 120 53095 0.34% 121 54448 0.35% 122 57200 0.37% 123 58366 0.38% 124 60614 0.39% 125 62867 0.41% 126 64612 0.42% 127 66488 0.43% 128 66910 0.43% 129 68969 0.45% 130 70886 0.46% 131 72694 0.47% 132 76461 0.49% 133 80913 0.52% 134 85958 0.56% 135 90075 0.58% 136 94219 0.61% 137 100061 0.65% 138 105932 0.69% 139 112905 0.73% 140 119305 0.77% 141 129107 0.84% 142 142066 0.92% 143 156479 1.01% 144 182126 1.18% 145 215879 1.40% 146 262722 1.70% 147 352384 2.28% 148 540312 3.50% 149 1063580 6.88% 150 4144249 26.81% 151 5373764 34.76% 15458952 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=120.43 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.4 sequence=AAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.66 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=49.34 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7171114 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:21:08 Started mapping on | Feb 14 06:21:08 Finished on | Feb 14 06:22:41 Mapping speed, Million of reads per hour | 598.41 Number of input reads | 15458952 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14780108 Uniquely mapped reads % | 95.61% Average mapped length | 287.12 Number of splices: Total | 13600053 Number of splices: Annotated (sjdb) | 13313323 Number of splices: GT/AG | 13329882 Number of splices: GC/AG | 221025 Number of splices: AT/AC | 9089 Number of splices: Non-canonical | 40057 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384425 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 44902 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 304823 304823 304823 N_multimapping 384425 384425 384425 N_noFeature 585875 14536437 671494 N_ambiguous 249598 957 91142 UnstrandedReadsAssigned:13944635 PositiveStrandReadsAssigned:242714 NegativeStrandReadsAssigned:14017472 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171114 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171114-trimmed-pair1.fastq SRR7171114-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,458,952 reads, 13,999,278 reads pseudoaligned [quant] estimated average fragment length: 220.741 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7171114.ke.tsv 34699 SRR7171114.se.tsv 87100 total ==> SRR7171114.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.26 434 15.9661 Potri.005G024800.1.v4.1 1035 815.259 239 19.3939 Potri.004G059700.1.v4.1 961 741.286 63 5.62234 Potri.007G009000.2.v4.1 1416 1196.26 2 0.110603 Potri.003G141000.2.v4.1 2943 2723.26 603.365 14.6573 Potri.016G087400.1.v4.1 270 95.2991 912 633.094 Potri.015G069301.1.v4.1 564 349.645 0 0 Potri.010G195200.1.v4.1 1773 1553.26 33 1.40551 Potri.012G127500.1.v4.1 977 757.286 188 16.4233 ==> SRR7171114.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 625 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7171114 completed mapping pipeline successfully