Starting /dee2/code/volunteer_pipeline.sh SRR7171115 current disk space = 3085440270336 free memory = 1577629840 SRR7171115 SRAfilesize 3e23fd26612bcde059839d84d5f67be6 SRR7171115.sra SRR7171115.sra file validated SRR7171115 is paired end SRR7171115 is conventional basespace SRR7171115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.1035 18.0 18.0 30.0 18.0 32.0 2 30.83575 31.0 30.0 33.0 27.0 33.0 3 31.844 33.0 31.0 33.0 29.0 33.0 4 31.981 33.0 31.0 33.0 30.0 34.0 5 32.63825 33.0 33.0 34.0 31.0 34.0 6 36.61475 38.0 37.0 38.0 34.0 38.0 7 37.201 38.0 38.0 38.0 36.0 38.0 8 37.35525 38.0 38.0 38.0 37.0 38.0 9 36.92175 38.0 38.0 38.0 36.0 38.0 10-14 37.377300000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.41335 38.0 38.0 38.0 37.0 38.0 20-24 37.43605 38.0 38.0 38.0 37.0 38.0 25-29 37.365899999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.3959 38.0 38.0 38.0 37.0 38.0 35-39 36.2974 38.0 37.0 38.0 31.6 38.0 40-44 36.9092 38.0 37.8 38.0 35.0 38.0 45-49 37.0889 38.0 38.0 38.0 35.8 38.0 50-54 37.132149999999996 38.0 38.0 38.0 36.0 38.0 55-59 35.8226 38.0 35.6 38.0 30.0 38.0 60-64 36.9665 38.0 38.0 38.0 35.8 38.0 65-69 36.84815 38.0 38.0 38.0 35.0 38.0 70-74 36.7211 38.0 38.0 38.0 34.6 38.0 75-79 36.678749999999994 38.0 38.0 38.0 34.6 38.0 80-84 36.603100000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.28995 38.0 37.2 38.0 33.8 38.0 90-94 35.9785 38.0 37.0 38.0 33.0 38.0 95-99 36.19465 38.0 37.0 38.0 33.2 38.0 100-104 36.196749999999994 38.0 37.0 38.0 33.4 38.0 105-109 35.9411 38.0 37.0 38.0 32.4 38.0 110-114 35.59204999999999 38.0 36.2 38.0 31.0 38.0 115-119 35.350550000000005 38.0 36.0 38.0 29.2 38.0 120-124 35.37955 38.0 36.0 38.0 30.0 38.0 125-129 35.0573 38.0 35.6 38.0 28.2 38.0 130-134 32.6082 37.0 30.4 38.0 19.0 38.0 135-139 34.080349999999996 37.8 34.2 38.0 23.6 38.0 140-144 33.688 38.0 33.8 38.0 22.2 38.0 145-149 32.7176 38.0 33.0 38.0 16.8 38.0 150-151 28.136125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 2.0 18 2.0 19 5.0 20 5.0 21 6.0 22 5.0 23 8.0 24 7.0 25 5.0 26 16.0 27 28.0 28 28.0 29 51.0 30 46.0 31 88.0 32 100.0 33 169.0 34 235.0 35 485.0 36 1142.0 37 1558.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.04299947561615 15.600419507079183 5.2700576822233876 55.08652333508128 2 11.85592796398199 16.283141570785393 56.428214107053535 15.43271635817909 3 12.4 20.325 34.25 33.025 4 19.3 30.375000000000004 27.1 23.225 5 18.9 35.5 28.499999999999996 17.1 6 14.499999999999998 37.15 28.7 19.650000000000002 7 12.875 21.85 47.575 17.7 8 14.274999999999999 22.75 36.975 26.0 9 15.049999999999999 21.25 39.5 24.2 10-14 19.34 28.165000000000003 28.21 24.285 15-19 19.02 28.765 28.665000000000003 23.549999999999997 20-24 19.06 28.395 29.110000000000003 23.435 25-29 18.925 28.360000000000003 28.549999999999997 24.165 30-34 18.755 28.799999999999997 28.835 23.61 35-39 19.875 28.065 29.095 22.965 40-44 19.54 28.675 28.634999999999998 23.150000000000002 45-49 19.975 28.349999999999998 28.794999999999998 22.88 50-54 20.06 28.63 28.4 22.91 55-59 20.195 28.705000000000002 28.22 22.88 60-64 19.38 28.67 28.405 23.544999999999998 65-69 20.005 28.74 28.125 23.13 70-74 19.785 28.749999999999996 27.82 23.645 75-79 20.21 28.560000000000002 28.325 22.905 80-84 20.4 29.160000000000004 27.925 22.515 85-89 19.685 29.53 27.575 23.21 90-94 20.294999999999998 28.625 28.005000000000003 23.075000000000003 95-99 20.355 28.945 27.534999999999997 23.165 100-104 20.68 29.025000000000002 27.57 22.725 105-109 20.65 28.865000000000002 27.889999999999997 22.595000000000002 110-114 20.45 29.085 27.61 22.855 115-119 20.78 29.080000000000002 27.455000000000002 22.685 120-124 20.36 29.125 27.224999999999998 23.29 125-129 20.849999999999998 28.64 27.47 23.04 130-134 20.8 28.815 27.24 23.145 135-139 21.060000000000002 28.765 27.195000000000004 22.98 140-144 21.115000000000002 28.575 27.465 22.845 145-149 20.424999999999997 28.965000000000003 27.175 23.435 150-151 20.474999999999998 29.2375 27.625 22.662499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 1.0 18 3.0 19 3.5 20 2.5 21 5.5 22 8.0 23 6.5 24 8.5 25 10.0 26 12.5 27 18.0 28 21.0 29 23.5 30 30.0 31 46.5 32 57.5 33 60.5 34 68.0 35 95.5 36 112.0 37 123.5 38 145.5 39 168.0 40 195.0 41 214.5 42 238.5 43 248.5 44 263.0 45 277.0 46 243.5 47 219.0 48 203.5 49 182.5 50 159.0 51 118.5 52 85.5 53 62.5 54 59.0 55 48.5 56 38.0 57 29.0 58 18.0 59 19.5 60 15.0 61 8.0 62 5.0 63 3.5 64 3.0 65 2.0 66 0.5 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42050894431847 98.65 2 0.45351473922902497 0.8999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.38749999999999996 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.4124999999999996 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.0999999999999996 0.0 0.0 0.0 0.0 108-109 3.4625000000000004 0.0 0.0 0.0 0.0 110-111 3.7375 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.675 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.325 0.0 0.0 0.0 0.0 122-123 6.875 0.0 0.0 0.0 0.0 124-125 7.324999999999999 0.0 0.0 0.0 0.0 126-127 7.6875 0.0 0.0 0.0 0.0 128-129 8.337499999999999 0.0 0.0 0.0 0.0 130-131 8.774999999999999 0.0 0.0 0.0 0.0 132-133 9.325 0.0 0.0 0.0 0.0 134-135 10.1 0.0 0.0 0.0 0.0 136-137 10.899999999999999 0.0 0.0 0.0 0.0 138-139 11.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGCCA 10 0.0068343505 144.975 4 >>END_MODULE SRR7171115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00275 33.0 33.0 34.0 32.0 34.0 2 33.1635 34.0 33.0 34.0 33.0 34.0 3 33.19325 34.0 33.0 34.0 33.0 34.0 4 33.18325 34.0 33.0 34.0 33.0 34.0 5 33.14125 34.0 33.0 34.0 33.0 34.0 6 37.35975 38.0 38.0 38.0 37.0 38.0 7 37.1005 38.0 38.0 38.0 37.0 38.0 8 37.2165 38.0 38.0 38.0 37.0 38.0 9 37.30875 38.0 38.0 38.0 37.0 38.0 10-14 37.37475 38.0 38.0 38.0 37.2 38.0 15-19 37.36055 38.0 38.0 38.0 37.2 38.0 20-24 36.5467 38.0 37.6 38.0 33.6 38.0 25-29 37.0025 38.0 38.0 38.0 36.0 38.0 30-34 37.13575 38.0 38.0 38.0 36.8 38.0 35-39 37.179500000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.40675 38.0 37.0 38.0 32.8 38.0 45-49 36.878499999999995 38.0 37.8 38.0 34.8 38.0 50-54 37.189049999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.18955 38.0 38.0 38.0 37.0 38.0 60-64 37.06285 38.0 38.0 38.0 36.4 38.0 65-69 36.975649999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.915200000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.88719999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.76885 38.0 38.0 38.0 35.6 38.0 85-89 36.66555 38.0 38.0 38.0 35.2 38.0 90-94 36.7263 38.0 38.0 38.0 35.0 38.0 95-99 36.54885 38.0 38.0 38.0 34.2 38.0 100-104 36.3575 38.0 38.0 38.0 34.0 38.0 105-109 35.97840000000001 38.0 37.4 38.0 32.4 38.0 110-114 35.72555 38.0 36.8 38.0 30.8 38.0 115-119 35.9371 38.0 37.0 38.0 33.0 38.0 120-124 35.422999999999995 38.0 36.2 38.0 30.2 38.0 125-129 34.9976 38.0 36.0 38.0 28.2 38.0 130-134 34.76715 38.0 35.4 38.0 27.8 38.0 135-139 34.173300000000005 38.0 33.6 38.0 24.6 38.0 140-144 33.531600000000005 38.0 33.0 38.0 21.4 38.0 145-149 32.248599999999996 38.0 33.0 38.0 10.6 38.0 150-151 26.444875000000003 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 1.0 16 3.0 17 4.0 18 3.0 19 3.0 20 7.0 21 6.0 22 8.0 23 5.0 24 10.0 25 11.0 26 15.0 27 25.0 28 33.0 29 35.0 30 47.0 31 67.0 32 78.0 33 122.0 34 201.0 35 324.0 36 758.0 37 2218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.375 24.25 6.925000000000001 42.449999999999996 2 18.65 24.0 45.4 11.95 3 13.525 27.325 37.1 22.05 4 19.675 36.3 25.35 18.675 5 22.8 38.800000000000004 22.3 16.1 6 17.05 39.725 25.55 17.675 7 16.5 19.625 44.375 19.5 8 17.424999999999997 23.225 33.300000000000004 26.05 9 18.825 22.5 34.699999999999996 23.974999999999998 10-14 21.975 28.615000000000002 27.16 22.25 15-19 21.985 28.605000000000004 28.33 21.08 20-24 21.67 28.499999999999996 28.775000000000002 21.055 25-29 22.46 28.415000000000003 28.415000000000003 20.71 30-34 21.16 29.065 28.985 20.79 35-39 22.035 28.46 28.599999999999998 20.905 40-44 22.220000000000002 28.73 28.310000000000002 20.74 45-49 22.3 28.854999999999997 28.175 20.669999999999998 50-54 22.215 28.189999999999998 28.7 20.895 55-59 22.655 27.68 29.044999999999998 20.62 60-64 22.54 28.675 28.29 20.495 65-69 22.415 28.470000000000002 28.34 20.775 70-74 22.425 28.025 28.34 21.21 75-79 22.515 27.855 28.634999999999998 20.995 80-84 23.064999999999998 28.375 27.77 20.79 85-89 22.74 27.985 28.449999999999996 20.825 90-94 23.21 28.355000000000004 27.529999999999998 20.905 95-99 22.825 28.96 27.36 20.855 100-104 23.255 28.34 28.155 20.25 105-109 23.31 28.384999999999998 28.22 20.085 110-114 23.74 28.645 27.615000000000002 20.0 115-119 23.849999999999998 28.799999999999997 27.595 19.755 120-124 23.76 28.725 27.834999999999997 19.68 125-129 24.92 28.705000000000002 27.060000000000002 19.314999999999998 130-134 24.779999999999998 29.425 26.905 18.89 135-139 24.755 28.28 27.584999999999997 19.38 140-144 25.324999999999996 28.544999999999998 27.205000000000002 18.925 145-149 25.215 29.375 26.634999999999998 18.775 150-151 26.474999999999998 28.349999999999998 26.987499999999997 18.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 1.0 17 0.5 18 1.5 19 4.0 20 4.0 21 5.0 22 7.5 23 7.0 24 7.5 25 6.5 26 9.5 27 14.5 28 14.0 29 17.5 30 21.5 31 35.0 32 45.0 33 48.0 34 69.0 35 89.0 36 103.5 37 125.0 38 151.5 39 179.5 40 201.0 41 236.5 42 269.0 43 267.0 44 262.5 45 255.5 46 244.0 47 228.5 48 195.5 49 162.0 50 145.5 51 123.5 52 96.0 53 81.0 54 66.5 55 47.5 56 33.0 57 23.5 58 21.5 59 21.5 60 13.5 61 10.0 62 7.5 63 4.5 64 3.5 65 2.0 66 0.5 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2909597366422 98.02499999999999 2 0.5571030640668524 1.0999999999999999 3 0.02532286654849329 0.075 4 0.0 0.0 5 0.07596859964547988 0.375 6 0.02532286654849329 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02532286654849329 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 11 0.27499999999999997 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5249999999999999 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4249999999999998 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9 0.0 0.0 0.0 0.0 100-101 2.1875 0.0 0.0 0.0 0.0 102-103 2.4875 0.0 0.0 0.0 0.0 104-105 2.8375 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.5374999999999996 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.362500000000001 0.0 0.0 0.0 0.0 114-115 4.7625 0.0 0.0 0.0 0.0 116-117 5.325 0.0 0.0 0.0 0.0 118-119 5.800000000000001 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.1625 0.0 0.0 0.0 0.0 124-125 7.7 0.0 0.0 0.0 0.0 126-127 8.275 0.0 0.0 0.0 0.0 128-129 9.0625 0.0 0.0 0.0 0.0 130-131 9.524999999999999 0.0 0.0 0.0 0.0 132-133 10.075 0.0 0.0 0.0 0.0 134-135 10.85 0.0 0.0 0.0 0.0 136-137 11.649999999999999 0.0 0.0 0.0 0.0 138-139 12.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAAG 10 0.006830828 145.0 1 >>END_MODULE Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692357 spots for SRR7171115.sra Written 692357 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra Read 692356 spots for SRR7171115.sra Written 692356 spots for SRR7171115.sra SRR ids: ['SRR7171115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_nkk2w7 SRR7171115.sra spots: 13847121 blocks: [[1, 692356], [692357, 1384712], [1384713, 2077068], [2077069, 2769424], [2769425, 3461780], [3461781, 4154136], [4154137, 4846492], [4846493, 5538848], [5538849, 6231204], [6231205, 6923560], [6923561, 7615916], [7615917, 8308272], [8308273, 9000628], [9000629, 9692984], [9692985, 10385340], [10385341, 11077696], [11077697, 11770052], [11770053, 12462408], [12462409, 13154764], [13154765, 13847121]] SRR7171115 file size 4670634 SRR7171115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171115 SRR7171115_1.fastq SRR7171115_2.fastq Input file: SRR7171115_1.fastq Paired file: SRR7171115_2.fastq trimmed: SRR7171115-trimmed-pair1.fastq, SRR7171115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:19:20 2025 >> started Fri Feb 14 06:19:36 2025 >> done (15.630s) 13847121 read pairs processed; of these: 6129 ( 0.04%) short read pairs filtered out after trimming by size control 16522 ( 0.12%) empty read pairs filtered out after trimming by size control 13824470 (99.84%) read pairs available; of these: 8313117 (60.13%) trimmed read pairs available after processing 5511353 (39.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 17 0.00% 20 16 0.00% 21 31 0.00% 22 18 0.00% 23 29 0.00% 24 28 0.00% 25 17 0.00% 26 36 0.00% 27 28 0.00% 28 36 0.00% 29 24 0.00% 30 26 0.00% 31 33 0.00% 32 27 0.00% 33 31 0.00% 34 24 0.00% 35 36 0.00% 36 41 0.00% 37 33 0.00% 38 52 0.00% 39 41 0.00% 40 63 0.00% 41 73 0.00% 42 89 0.00% 43 84 0.00% 44 92 0.00% 45 99 0.00% 46 130 0.00% 47 133 0.00% 48 156 0.00% 49 197 0.00% 50 195 0.00% 51 238 0.00% 52 259 0.00% 53 288 0.00% 54 350 0.00% 55 322 0.00% 56 394 0.00% 57 450 0.00% 58 507 0.00% 59 572 0.00% 60 730 0.01% 61 768 0.01% 62 949 0.01% 63 962 0.01% 64 1101 0.01% 65 1245 0.01% 66 1265 0.01% 67 1512 0.01% 68 1614 0.01% 69 1816 0.01% 70 2165 0.02% 71 2322 0.02% 72 2751 0.02% 73 3146 0.02% 74 3432 0.02% 75 3732 0.03% 76 4265 0.03% 77 4650 0.03% 78 4759 0.03% 79 5335 0.04% 80 6017 0.04% 81 6678 0.05% 82 7413 0.05% 83 8232 0.06% 84 9452 0.07% 85 10238 0.07% 86 11206 0.08% 87 11714 0.08% 88 12456 0.09% 89 12990 0.09% 90 14294 0.10% 91 15125 0.11% 92 16455 0.12% 93 17974 0.13% 94 18652 0.13% 95 20217 0.15% 96 21051 0.15% 97 21350 0.15% 98 22453 0.16% 99 23061 0.17% 100 24563 0.18% 101 25504 0.18% 102 27069 0.20% 103 28034 0.20% 104 29677 0.21% 105 30534 0.22% 106 31587 0.23% 107 32330 0.23% 108 33026 0.24% 109 33798 0.24% 110 34468 0.25% 111 35982 0.26% 112 37461 0.27% 113 38858 0.28% 114 40515 0.29% 115 41941 0.30% 116 43109 0.31% 117 43416 0.31% 118 44001 0.32% 119 44775 0.32% 120 45841 0.33% 121 46249 0.33% 122 48522 0.35% 123 49478 0.36% 124 50931 0.37% 125 51460 0.37% 126 54297 0.39% 127 55040 0.40% 128 55971 0.40% 129 57109 0.41% 130 58179 0.42% 131 60261 0.44% 132 62598 0.45% 133 64638 0.47% 134 68934 0.50% 135 70796 0.51% 136 74230 0.54% 137 79236 0.57% 138 83194 0.60% 139 88779 0.64% 140 95484 0.69% 141 105351 0.76% 142 115894 0.84% 143 130048 0.94% 144 154530 1.12% 145 182963 1.32% 146 231148 1.67% 147 317137 2.29% 148 462232 3.34% 149 867346 6.27% 150 3383715 24.48% 151 5511353 39.87% 13824470 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.28 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=27.15 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.7 sequence=TCAAGCTCACGGTTCTTGGCAAA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=19 prefix-density=0.28 prefix-fanout=2.7 sequence=TTGCACTGCTCGAGAATTGGCCGAGCGAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=40.08 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7171115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:20:32 Started mapping on | Feb 14 06:20:32 Finished on | Feb 14 06:22:57 Mapping speed, Million of reads per hour | 343.23 Number of input reads | 13824470 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12566687 Uniquely mapped reads % | 90.90% Average mapped length | 288.27 Number of splices: Total | 11628448 Number of splices: Annotated (sjdb) | 11341341 Number of splices: GT/AG | 11406156 Number of splices: GC/AG | 168857 Number of splices: AT/AC | 7819 Number of splices: Non-canonical | 45616 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371265 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 73831 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.73% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 893854 893854 893854 N_multimapping 371265 371265 371265 N_noFeature 615236 12347785 697490 N_ambiguous 221839 807 84834 UnstrandedReadsAssigned:11729612 PositiveStrandReadsAssigned:218095 NegativeStrandReadsAssigned:11784363 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7171115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171115-trimmed-pair1.fastq SRR7171115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,824,470 reads, 11,767,503 reads pseudoaligned [quant] estimated average fragment length: 219.332 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7171115.ke.tsv 34699 SRR7171115.se.tsv 87100 total ==> SRR7171115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.67 791 33.3566 Potri.005G024800.1.v4.1 1035 816.668 161 14.9616 Potri.004G059700.1.v4.1 961 742.673 57 5.82472 Potri.007G009000.2.v4.1 1416 1197.67 0 0 Potri.003G141000.2.v4.1 2943 2724.67 623.738 17.3735 Potri.016G087400.1.v4.1 270 92.8259 764.097 624.708 Potri.015G069301.1.v4.1 564 349.005 0 0 Potri.010G195200.1.v4.1 1773 1554.67 83 4.05171 Potri.012G127500.1.v4.1 977 758.668 67 6.70225 ==> SRR7171115.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 910 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7171115 completed mapping pipeline successfully