Starting /dee2/code/volunteer_pipeline.sh SRR7171116 current disk space = 3085713092608 free memory = 1476385768 SRR7171116 SRAfilesize 95617e148ffdc022ad8c7074a0101b94 SRR7171116.sra SRR7171116.sra file validated SRR7171116 is paired end SRR7171116 is conventional basespace SRR7171116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.26075 18.0 18.0 30.0 18.0 32.0 2 30.679 31.0 30.0 33.0 27.0 33.0 3 31.792 33.0 31.0 33.0 29.0 33.0 4 31.99075 33.0 31.0 33.0 30.0 34.0 5 32.631 33.0 33.0 34.0 31.0 34.0 6 36.6565 38.0 37.0 38.0 34.0 38.0 7 37.1395 38.0 38.0 38.0 36.0 38.0 8 37.28575 38.0 38.0 38.0 36.0 38.0 9 36.71425 38.0 38.0 38.0 35.0 38.0 10-14 37.30129999999999 38.0 38.0 38.0 36.6 38.0 15-19 37.373900000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.398849999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.355149999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.351150000000004 38.0 38.0 38.0 37.0 38.0 35-39 36.48524999999999 38.0 37.4 38.0 31.8 38.0 40-44 36.7485 38.0 37.6 38.0 34.6 38.0 45-49 37.00375 38.0 37.8 38.0 35.6 38.0 50-54 37.08905 38.0 38.0 38.0 36.0 38.0 55-59 35.58325 38.0 35.4 38.0 29.8 38.0 60-64 36.89665 38.0 38.0 38.0 35.4 38.0 65-69 36.8191 38.0 38.0 38.0 35.2 38.0 70-74 36.7029 38.0 38.0 38.0 34.8 38.0 75-79 36.67435 38.0 38.0 38.0 34.8 38.0 80-84 36.57355 38.0 38.0 38.0 34.4 38.0 85-89 36.2272 38.0 37.4 38.0 33.4 38.0 90-94 35.9418 38.0 37.0 38.0 32.0 38.0 95-99 36.22255 38.0 37.0 38.0 33.4 38.0 100-104 36.2318 38.0 37.0 38.0 33.8 38.0 105-109 36.0262 38.0 37.0 38.0 32.8 38.0 110-114 35.59765 38.0 36.4 38.0 30.4 38.0 115-119 35.3474 38.0 36.2 38.0 29.0 38.0 120-124 35.312349999999995 38.0 36.0 38.0 29.2 38.0 125-129 35.1468 38.0 36.0 38.0 28.6 38.0 130-134 32.262449999999994 36.8 28.6 38.0 18.2 38.0 135-139 34.063199999999995 37.8 34.6 38.0 23.6 38.0 140-144 33.87755 38.0 34.2 38.0 23.4 38.0 145-149 32.93725 38.0 33.4 38.0 16.6 38.0 150-151 28.8215 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 1.0 7 0.0 8 0.0 9 2.0 10 1.0 11 0.0 12 3.0 13 0.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 5.0 21 5.0 22 8.0 23 11.0 24 10.0 25 17.0 26 15.0 27 23.0 28 27.0 29 44.0 30 59.0 31 75.0 32 113.0 33 136.0 34 224.0 35 445.0 36 1135.0 37 1628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.70227392913802 14.542570068746693 10.920148069804336 31.835007932310948 2 19.06906906906907 18.193193193193196 38.41341341341341 24.324324324324326 3 16.575 23.599999999999998 31.125000000000004 28.7 4 22.975 31.624999999999996 24.525 20.875 5 20.225 34.725 25.724999999999998 19.325 6 15.725 36.3 27.925 20.05 7 13.975000000000001 21.75 45.6 18.675 8 16.375 23.95 32.375 27.3 9 17.525 21.525 34.375 26.575 10-14 20.445 29.25 26.68 23.625 15-19 20.01 28.685 27.675 23.630000000000003 20-24 19.78 28.865000000000002 27.67 23.685000000000002 25-29 19.785 29.37 27.575 23.27 30-34 20.3 28.365000000000002 27.994999999999997 23.34 35-39 20.055 28.38 28.425 23.14 40-44 20.225 28.92 27.644999999999996 23.21 45-49 20.23 29.24 27.71 22.82 50-54 19.845 29.270000000000003 27.52 23.365 55-59 20.22 28.665000000000003 28.000000000000004 23.115 60-64 19.905 28.62 27.91 23.565 65-69 19.72 28.92 27.735 23.625 70-74 20.080000000000002 28.54 27.925 23.455000000000002 75-79 20.035 28.95 27.529999999999998 23.485 80-84 19.75 28.860000000000003 28.044999999999998 23.345 85-89 20.775 28.24 27.975 23.01 90-94 19.735 28.555000000000003 27.73 23.98 95-99 20.9 28.599999999999998 27.139999999999997 23.36 100-104 21.099999999999998 28.74 27.150000000000002 23.01 105-109 20.64 27.845 28.32 23.195 110-114 21.060000000000002 28.565 27.29 23.085 115-119 21.295 28.660000000000004 27.21 22.835 120-124 20.94 28.685 26.91 23.465 125-129 20.87 28.265 27.169999999999998 23.695 130-134 20.53 28.98 26.93 23.56 135-139 20.935000000000002 28.299999999999997 26.919999999999998 23.845 140-144 20.78 28.345 26.965 23.91 145-149 20.560000000000002 28.515 26.845000000000002 24.08 150-151 21.25 28.525 26.575 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 0.5 22 1.5 23 3.5 24 5.5 25 7.0 26 5.0 27 6.5 28 15.0 29 23.5 30 28.5 31 30.5 32 38.0 33 50.5 34 70.5 35 95.0 36 100.5 37 113.0 38 132.0 39 151.0 40 182.5 41 211.5 42 245.5 43 252.5 44 247.0 45 262.5 46 260.5 47 238.0 48 212.0 49 198.5 50 179.5 51 137.5 52 101.5 53 87.5 54 77.5 55 61.5 56 46.5 57 28.0 58 18.5 59 17.5 60 14.5 61 9.5 62 5.0 63 4.0 64 3.5 65 1.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.45 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6557377049180327 1.3 3 0.07566204287515763 0.22499999999999998 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.074999999999999 0.0 0.0 0.0 0.0 116-117 4.4875 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.575 0.0 0.0 0.0 0.0 124-125 6.0 0.0 0.0 0.0 0.0 126-127 6.2625 0.0 0.0 0.0 0.0 128-129 6.5625 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.8375 0.0 0.0 0.0 0.0 134-135 8.45 0.0 0.0 0.0 0.0 136-137 8.912500000000001 0.0 0.0 0.0 0.0 138-139 9.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7171116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9605 33.0 33.0 34.0 32.0 34.0 2 33.0845 34.0 33.0 34.0 33.0 34.0 3 33.06525 34.0 33.0 34.0 32.0 34.0 4 33.05325 34.0 33.0 34.0 33.0 34.0 5 32.989 34.0 33.0 34.0 33.0 34.0 6 37.1315 38.0 38.0 38.0 37.0 38.0 7 37.001 38.0 38.0 38.0 37.0 38.0 8 37.0705 38.0 38.0 38.0 37.0 38.0 9 37.1295 38.0 38.0 38.0 37.0 38.0 10-14 37.138650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.1059 38.0 38.0 38.0 37.0 38.0 20-24 36.48175 38.0 37.8 38.0 34.0 38.0 25-29 36.763999999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.9655 38.0 38.0 38.0 36.6 38.0 35-39 36.94435 38.0 38.0 38.0 36.4 38.0 40-44 36.084649999999996 38.0 36.2 38.0 32.6 38.0 45-49 36.6023 38.0 37.4 38.0 34.4 38.0 50-54 36.97185 38.0 38.0 38.0 36.8 38.0 55-59 36.90795 38.0 38.0 38.0 36.0 38.0 60-64 36.8005 38.0 38.0 38.0 36.0 38.0 65-69 36.74995 38.0 38.0 38.0 36.0 38.0 70-74 36.704950000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.661500000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.5863 38.0 38.0 38.0 35.2 38.0 85-89 36.52285 38.0 38.0 38.0 35.0 38.0 90-94 36.52375 38.0 38.0 38.0 35.0 38.0 95-99 36.3752 38.0 38.0 38.0 34.2 38.0 100-104 36.2365 38.0 38.0 38.0 34.2 38.0 105-109 35.75325 38.0 37.4 38.0 32.0 38.0 110-114 35.5167 38.0 36.8 38.0 30.8 38.0 115-119 35.74829999999999 38.0 37.0 38.0 32.6 38.0 120-124 35.31755 38.0 36.2 38.0 30.4 38.0 125-129 34.736450000000005 38.0 35.6 38.0 26.6 38.0 130-134 34.639050000000005 38.0 35.4 38.0 27.0 38.0 135-139 34.1516 38.0 34.0 38.0 24.6 38.0 140-144 33.4053 38.0 33.0 38.0 21.0 38.0 145-149 32.3935 38.0 33.0 38.0 11.0 38.0 150-151 27.04725 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 3.0 5 5.0 6 1.0 7 0.0 8 4.0 9 1.0 10 3.0 11 2.0 12 2.0 13 3.0 14 4.0 15 5.0 16 2.0 17 1.0 18 3.0 19 5.0 20 2.0 21 2.0 22 10.0 23 7.0 24 9.0 25 17.0 26 18.0 27 23.0 28 26.0 29 31.0 30 42.0 31 63.0 32 76.0 33 118.0 34 171.0 35 312.0 36 741.0 37 2268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.6 22.95 9.75 24.7 2 25.6 24.65 32.975 16.775000000000002 3 19.675 28.025 31.874999999999996 20.424999999999997 4 21.75 35.75 24.125 18.375 5 23.911955977988995 38.86943471735868 21.46073036518259 15.757878939469736 6 18.8 39.85 23.0 18.35 7 19.275000000000002 19.325 41.425 19.975 8 20.674999999999997 23.9 27.375 28.050000000000004 9 21.025 24.349999999999998 29.7 24.925 10-14 23.419999999999998 28.925 26.200000000000003 21.455 15-19 22.34 28.58 28.384999999999998 20.695 20-24 22.845 28.675 27.185 21.295 25-29 22.91 27.87 28.389999999999997 20.830000000000002 30-34 22.75 28.225 28.13 20.895 35-39 22.81 28.565 28.01 20.615 40-44 22.855 28.62 28.21 20.315 45-49 22.8 27.894999999999996 28.23 21.075 50-54 21.759999999999998 28.4 28.16 21.68 55-59 23.05 27.495000000000005 28.165000000000003 21.29 60-64 22.675 27.455000000000002 28.255000000000003 21.615000000000002 65-69 22.46 28.165000000000003 27.715 21.66 70-74 22.78 28.325 27.665 21.23 75-79 22.470000000000002 28.025 27.815 21.69 80-84 23.064999999999998 27.74 27.884999999999998 21.310000000000002 85-89 23.080000000000002 28.325 27.884999999999998 20.71 90-94 23.27 27.665 28.08 20.985 95-99 23.935000000000002 27.165 28.15 20.75 100-104 23.494999999999997 27.779999999999998 27.845 20.880000000000003 105-109 23.48 27.41 28.294999999999998 20.815 110-114 23.515 28.225 27.575 20.685000000000002 115-119 24.275 28.02 27.705000000000002 20.0 120-124 24.37 28.125 27.615000000000002 19.89 125-129 24.310000000000002 27.92 27.965 19.805 130-134 25.374999999999996 28.02 27.35 19.255 135-139 24.875 28.455000000000002 27.229999999999997 19.439999999999998 140-144 24.915000000000003 28.355000000000004 27.58 19.15 145-149 25.25 28.675 27.134999999999998 18.94 150-151 25.162499999999998 28.749999999999996 27.3125 18.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 1.5 20 2.0 21 2.5 22 4.0 23 2.5 24 3.0 25 4.5 26 6.5 27 8.5 28 9.0 29 14.0 30 20.0 31 23.0 32 28.0 33 40.5 34 46.5 35 66.0 36 90.0 37 109.0 38 129.0 39 151.5 40 196.5 41 223.5 42 234.0 43 252.0 44 275.5 45 276.5 46 257.5 47 242.5 48 219.0 49 214.5 50 190.5 51 138.5 52 115.5 53 95.5 54 82.5 55 69.5 56 48.5 57 35.5 58 23.0 59 15.5 60 8.5 61 5.0 62 4.0 63 2.0 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.7067137809187279 1.4000000000000001 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.1 0.0 0.0 0.0 0.0 116-117 4.525 0.0 0.0 0.0 0.0 118-119 4.9625 0.0 0.0 0.0 0.0 120-121 5.3125 0.0 0.0 0.0 0.0 122-123 5.675000000000001 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.574999999999999 0.0 0.0 0.0 0.0 128-129 6.9625 0.0 0.0 0.0 0.0 130-131 7.6 0.0 0.0 0.0 0.0 132-133 8.1875 0.0 0.0 0.0 0.0 134-135 8.7875 0.0 0.0 0.0 0.0 136-137 9.25 0.0 0.0 0.0 0.0 138-139 9.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAA 10 0.006830828 145.0 1 GCTCAAA 20 0.00593511 29.0 30-34 AAAAAAA 35 0.0035366106 20.714287 30-34 >>END_MODULE Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886529 spots for SRR7171116.sra Written 886529 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra Read 886511 spots for SRR7171116.sra Written 886511 spots for SRR7171116.sra SRR ids: ['SRR7171116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zlvz55or SRR7171116.sra spots: 17730238 blocks: [[1, 886511], [886512, 1773022], [1773023, 2659533], [2659534, 3546044], [3546045, 4432555], [4432556, 5319066], [5319067, 6205577], [6205578, 7092088], [7092089, 7978599], [7978600, 8865110], [8865111, 9751621], [9751622, 10638132], [10638133, 11524643], [11524644, 12411154], [12411155, 13297665], [13297666, 14184176], [14184177, 15070687], [15070688, 15957198], [15957199, 16843709], [16843710, 17730238]] SRR7171116 file size 5986495 SRR7171116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171116 SRR7171116_1.fastq SRR7171116_2.fastq Input file: SRR7171116_1.fastq Paired file: SRR7171116_2.fastq trimmed: SRR7171116-trimmed-pair1.fastq, SRR7171116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:48:44 2025 >> started Fri Feb 14 05:49:05 2025 >> done (21.295s) 17730238 read pairs processed; of these: 19149 ( 0.11%) short read pairs filtered out after trimming by size control 22697 ( 0.13%) empty read pairs filtered out after trimming by size control 17688392 (99.76%) read pairs available; of these: 10155688 (57.41%) trimmed read pairs available after processing 7532704 (42.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 19 0.00% 21 12 0.00% 22 29 0.00% 23 19 0.00% 24 30 0.00% 25 24 0.00% 26 30 0.00% 27 24 0.00% 28 30 0.00% 29 14 0.00% 30 30 0.00% 31 37 0.00% 32 22 0.00% 33 31 0.00% 34 34 0.00% 35 43 0.00% 36 31 0.00% 37 33 0.00% 38 44 0.00% 39 44 0.00% 40 53 0.00% 41 73 0.00% 42 72 0.00% 43 80 0.00% 44 101 0.00% 45 111 0.00% 46 126 0.00% 47 133 0.00% 48 187 0.00% 49 188 0.00% 50 212 0.00% 51 231 0.00% 52 268 0.00% 53 308 0.00% 54 323 0.00% 55 340 0.00% 56 409 0.00% 57 459 0.00% 58 497 0.00% 59 611 0.00% 60 732 0.00% 61 788 0.00% 62 892 0.01% 63 1034 0.01% 64 1119 0.01% 65 1211 0.01% 66 1301 0.01% 67 1460 0.01% 68 1591 0.01% 69 1781 0.01% 70 2156 0.01% 71 2392 0.01% 72 2775 0.02% 73 3084 0.02% 74 3457 0.02% 75 3796 0.02% 76 4228 0.02% 77 4847 0.03% 78 4795 0.03% 79 5424 0.03% 80 6057 0.03% 81 6958 0.04% 82 7655 0.04% 83 8480 0.05% 84 10034 0.06% 85 11603 0.07% 86 12355 0.07% 87 13529 0.08% 88 14275 0.08% 89 14958 0.08% 90 15848 0.09% 91 16817 0.10% 92 17783 0.10% 93 18943 0.11% 94 19867 0.11% 95 21289 0.12% 96 22379 0.13% 97 23134 0.13% 98 23527 0.13% 99 24324 0.14% 100 25602 0.14% 101 26873 0.15% 102 28505 0.16% 103 29892 0.17% 104 31120 0.18% 105 32979 0.19% 106 33759 0.19% 107 34372 0.19% 108 35526 0.20% 109 36565 0.21% 110 37780 0.21% 111 39126 0.22% 112 40167 0.23% 113 41998 0.24% 114 43394 0.25% 115 44949 0.25% 116 46149 0.26% 117 47117 0.27% 118 47525 0.27% 119 48258 0.27% 120 49778 0.28% 121 51156 0.29% 122 51967 0.29% 123 54337 0.31% 124 56382 0.32% 125 57498 0.33% 126 59452 0.34% 127 60466 0.34% 128 61392 0.35% 129 63885 0.36% 130 65546 0.37% 131 67088 0.38% 132 70135 0.40% 133 73735 0.42% 134 76959 0.44% 135 81058 0.46% 136 85154 0.48% 137 90167 0.51% 138 96196 0.54% 139 103299 0.58% 140 110628 0.63% 141 122542 0.69% 142 135340 0.77% 143 153732 0.87% 144 180645 1.02% 145 217281 1.23% 146 274724 1.55% 147 384263 2.17% 148 567990 3.21% 149 1085677 6.14% 150 4431498 25.05% 151 7532704 42.59% 17688392 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.73 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=152.36 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=22 prefix-density=0.84 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=64.29 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.1 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTTCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAATCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:49:54 Started mapping on | Feb 14 05:49:54 Finished on | Feb 14 05:51:51 Mapping speed, Million of reads per hour | 544.26 Number of input reads | 17688392 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16698673 Uniquely mapped reads % | 94.40% Average mapped length | 290.08 Number of splices: Total | 16003207 Number of splices: Annotated (sjdb) | 15684606 Number of splices: GT/AG | 15687776 Number of splices: GC/AG | 264026 Number of splices: AT/AC | 8572 Number of splices: Non-canonical | 42833 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 483109 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 54110 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.45% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530289 530289 530289 N_multimapping 483109 483109 483109 N_noFeature 584013 16431954 679973 N_ambiguous 276183 895 105028 UnstrandedReadsAssigned:15838477 PositiveStrandReadsAssigned:265824 NegativeStrandReadsAssigned:15913672 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7171116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171116-trimmed-pair1.fastq SRR7171116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,688,392 reads, 15,851,720 reads pseudoaligned [quant] estimated average fragment length: 229.175 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR7171116.ke.tsv 34699 SRR7171116.se.tsv 87100 total ==> SRR7171116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.82 500 16.3671 Potri.005G024800.1.v4.1 1035 806.825 262 19.0254 Potri.004G059700.1.v4.1 961 732.836 10 0.799477 Potri.007G009000.2.v4.1 1416 1187.82 0 0 Potri.003G141000.2.v4.1 2943 2714.82 614.36 13.2585 Potri.016G087400.1.v4.1 270 89.2846 1143 750.036 Potri.015G069301.1.v4.1 564 340.029 0 0 Potri.010G195200.1.v4.1 1773 1544.82 32 1.21362 Potri.012G127500.1.v4.1 977 748.836 108 8.44986 ==> SRR7171116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 363 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 6 SRR7171116 completed mapping pipeline successfully