Starting /dee2/code/volunteer_pipeline.sh SRR7171117 current disk space = 3085164953600 free memory = 1582674100 SRR7171117 SRAfilesize 6fd0ec041aefc7dc9b85a33a08df4bb9 SRR7171117.sra SRR7171117.sra file validated SRR7171117 is paired end SRR7171117 is conventional basespace SRR7171117 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.268 18.0 18.0 25.0 18.0 32.0 2 28.65975 29.0 27.0 31.0 25.0 33.0 3 30.1045 31.0 29.0 33.0 27.0 33.0 4 31.735 33.0 31.0 33.0 29.0 33.0 5 32.6205 33.0 33.0 33.0 32.0 34.0 6 34.024 37.0 34.0 38.0 16.0 38.0 7 36.35025 38.0 37.0 38.0 33.0 38.0 8 36.973 38.0 37.0 38.0 35.0 38.0 9 37.30375 38.0 38.0 38.0 36.0 38.0 10-14 37.333600000000004 38.0 38.0 38.0 36.6 38.0 15-19 37.3894 38.0 38.0 38.0 37.0 38.0 20-24 37.46985 38.0 38.0 38.0 37.0 38.0 25-29 37.44925 38.0 38.0 38.0 37.0 38.0 30-34 37.39399999999999 38.0 38.0 38.0 37.0 38.0 35-39 36.89385 38.0 38.0 38.0 34.8 38.0 40-44 37.28095 38.0 38.0 38.0 37.0 38.0 45-49 37.25055 38.0 38.0 38.0 36.8 38.0 50-54 34.75525 37.6 33.4 38.0 28.0 38.0 55-59 36.114 37.8 35.8 38.0 32.4 38.0 60-64 36.90295 38.0 38.0 38.0 35.8 38.0 65-69 36.836149999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.72064999999999 38.0 38.0 38.0 34.6 38.0 75-79 36.646899999999995 38.0 38.0 38.0 34.2 38.0 80-84 36.6198 38.0 38.0 38.0 34.4 38.0 85-89 36.39829999999999 38.0 37.6 38.0 34.0 38.0 90-94 36.23434999999999 38.0 37.0 38.0 33.8 38.0 95-99 36.2284 38.0 37.0 38.0 33.4 38.0 100-104 36.016949999999994 38.0 37.0 38.0 33.2 38.0 105-109 35.898199999999996 38.0 37.0 38.0 32.6 38.0 110-114 35.56585 38.0 36.6 38.0 30.2 38.0 115-119 35.259 38.0 36.0 38.0 28.8 38.0 120-124 35.21875 38.0 36.0 38.0 29.2 38.0 125-129 34.831849999999996 38.0 35.0 38.0 28.0 38.0 130-134 29.547950000000004 33.2 22.4 37.6 16.0 38.0 135-139 33.4511 37.2 33.4 38.0 21.0 38.0 140-144 33.388549999999995 38.0 34.0 38.0 19.8 38.0 145-149 32.188100000000006 37.8 32.2 38.0 13.4 38.0 150-151 27.714 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 2.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 2.0 17 4.0 18 5.0 19 2.0 20 5.0 21 10.0 22 5.0 23 11.0 24 18.0 25 11.0 26 18.0 27 20.0 28 31.0 29 46.0 30 57.0 31 70.0 32 93.0 33 146.0 34 314.0 35 616.0 36 1507.0 37 999.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.38670936749399 13.103816386442487 15.692554043234589 37.81692020282893 2 18.65 20.9 37.1 23.35 3 17.9 25.1 28.349999999999998 28.65 4 21.425 32.35 25.324999999999996 20.9 5 19.575 37.3 26.200000000000003 16.925 6 15.75 36.95 27.3 20.0 7 13.55 22.3 45.324999999999996 18.825 8 16.075 23.974999999999998 33.2 26.75 9 15.925 23.549999999999997 35.075 25.45 10-14 19.139999999999997 30.115 27.075 23.669999999999998 15-19 19.005 29.68 27.71 23.605 20-24 19.34 29.025000000000002 28.74 22.895 25-29 19.29 28.405 28.73 23.575 30-34 19.38 29.57 28.439999999999998 22.61 35-39 19.439999999999998 29.2 28.255000000000003 23.105 40-44 19.255 29.275000000000002 28.075 23.395 45-49 19.465 29.005 28.365000000000002 23.165 50-54 19.68 28.49 28.775000000000002 23.055 55-59 19.86 28.79 27.85 23.5 60-64 19.175 29.215000000000003 28.485 23.125 65-69 19.939999999999998 29.68 27.51 22.869999999999997 70-74 19.49 29.020000000000003 28.395 23.095 75-79 19.25 28.804999999999996 28.33 23.615 80-84 19.085 29.65 27.950000000000003 23.315 85-89 19.475 29.13 27.875 23.52 90-94 20.52 28.999999999999996 27.62 22.86 95-99 20.205000000000002 29.220000000000002 27.315 23.26 100-104 19.89 28.605000000000004 27.92 23.585 105-109 19.88 29.385 27.49 23.244999999999997 110-114 20.24 28.985 27.845 22.93 115-119 20.905 29.12 26.810000000000002 23.165 120-124 19.93 29.23 27.0 23.84 125-129 20.435 29.04 27.105 23.419999999999998 130-134 20.72 29.609999999999996 26.68 22.99 135-139 20.27 29.4 26.58 23.75 140-144 20.47 28.904999999999998 26.740000000000002 23.885 145-149 20.52 29.104999999999997 26.490000000000002 23.885 150-151 20.2375 28.799999999999997 26.85 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 1.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.5 23 6.0 24 7.5 25 8.5 26 11.5 27 15.0 28 17.5 29 20.0 30 26.0 31 38.0 32 50.0 33 63.5 34 85.0 35 106.5 36 114.0 37 131.5 38 152.5 39 161.0 40 200.5 41 239.5 42 260.5 43 267.5 44 254.5 45 253.5 46 240.5 47 216.0 48 192.5 49 167.0 50 153.5 51 136.0 52 101.0 53 64.5 54 54.5 55 48.0 56 36.5 57 28.5 58 18.5 59 13.0 60 7.5 61 6.0 62 5.0 63 1.5 64 0.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 3.7125 0.0 0.0 0.0 0.0 114-115 4.075 0.0 0.0 0.0 0.0 116-117 4.55 0.0125 0.0 0.0 0.0 118-119 5.0625 0.025 0.0 0.0 0.0 120-121 5.512499999999999 0.025 0.0 0.0 0.0 122-123 5.925 0.025 0.0 0.0 0.0 124-125 6.375 0.037500000000000006 0.0 0.0 0.0 126-127 6.65 0.05 0.0 0.0 0.0 128-129 6.9125 0.05 0.0 0.0 0.0 130-131 7.35 0.05 0.0 0.0 0.0 132-133 7.825 0.05 0.0 0.0 0.0 134-135 8.4 0.05 0.0 0.0 0.0 136-137 9.0125 0.05 0.0 0.0 0.0 138-139 9.587499999999999 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAAC 10 0.0068378756 144.95 8 TCCAGAT 10 0.0068378756 144.95 7 >>END_MODULE SRR7171117 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7171117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0995 33.0 33.0 34.0 33.0 34.0 2 33.19225 34.0 33.0 34.0 33.0 34.0 3 33.11375 34.0 33.0 34.0 33.0 34.0 4 33.2035 34.0 33.0 34.0 33.0 34.0 5 33.25125 34.0 33.0 34.0 33.0 34.0 6 37.465 38.0 38.0 38.0 38.0 38.0 7 36.14375 38.0 38.0 38.0 33.0 38.0 8 37.1655 38.0 38.0 38.0 37.0 38.0 9 37.31425 38.0 38.0 38.0 37.0 38.0 10-14 37.391099999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.3732 38.0 38.0 38.0 37.6 38.0 20-24 37.2854 38.0 38.0 38.0 37.6 38.0 25-29 37.12265 38.0 38.0 38.0 36.8 38.0 30-34 37.3348 38.0 38.0 38.0 37.4 38.0 35-39 37.365300000000005 38.0 38.0 38.0 37.6 38.0 40-44 37.327149999999996 38.0 38.0 38.0 37.4 38.0 45-49 36.10025 38.0 36.4 38.0 31.0 38.0 50-54 37.2219 38.0 38.0 38.0 37.0 38.0 55-59 37.1681 38.0 38.0 38.0 37.0 38.0 60-64 37.1258 38.0 38.0 38.0 37.0 38.0 65-69 37.1545 38.0 38.0 38.0 37.0 38.0 70-74 37.12815 38.0 38.0 38.0 36.8 38.0 75-79 37.105 38.0 38.0 38.0 36.4 38.0 80-84 36.995400000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.989850000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.85655 38.0 38.0 38.0 36.0 38.0 95-99 36.80795 38.0 38.0 38.0 35.6 38.0 100-104 36.58655 38.0 38.0 38.0 34.6 38.0 105-109 36.293899999999994 38.0 37.8 38.0 33.6 38.0 110-114 34.4035 38.0 34.2 38.0 23.4 38.0 115-119 36.0221 38.0 36.8 38.0 33.2 38.0 120-124 35.9482 38.0 37.0 38.0 33.0 38.0 125-129 35.64575000000001 38.0 36.6 38.0 31.2 38.0 130-134 35.354949999999995 38.0 36.0 38.0 31.0 38.0 135-139 34.68905 38.0 34.6 38.0 28.2 38.0 140-144 34.1309 38.0 33.4 38.0 25.6 38.0 145-149 33.2177 38.0 33.0 38.0 19.6 38.0 150-151 27.746499999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 2.0 6 1.0 7 0.0 8 1.0 9 4.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 4.0 20 4.0 21 5.0 22 3.0 23 4.0 24 7.0 25 3.0 26 10.0 27 18.0 28 27.0 29 37.0 30 34.0 31 45.0 32 67.0 33 100.0 34 170.0 35 312.0 36 740.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.349999999999994 19.975 11.575000000000001 27.1 2 26.25 25.775 32.875 15.1 3 19.875 28.275 31.5 20.349999999999998 4 23.642732049036777 34.32574430823117 23.91793845384038 18.11358518889167 5 23.5 37.7 21.95 16.85 6 19.575 39.275 23.45 17.7 7 18.625 19.35 40.975 21.05 8 20.674999999999997 24.9 28.375 26.05 9 21.275 24.349999999999998 30.225 24.15 10-14 23.95 28.465 26.35 21.235 15-19 23.330000000000002 28.244999999999997 28.310000000000002 20.115 20-24 23.025000000000002 28.144999999999996 28.025 20.805 25-29 23.56 27.939999999999998 28.21 20.29 30-34 22.650000000000002 28.16 28.65 20.54 35-39 23.044999999999998 28.23 28.075 20.65 40-44 23.645 27.744999999999997 28.134999999999998 20.474999999999998 45-49 23.5 27.785 28.299999999999997 20.415 50-54 23.36 27.92 28.405 20.315 55-59 23.585 28.084999999999997 28.105000000000004 20.225 60-64 23.665 28.095 28.249999999999996 19.99 65-69 23.615 27.415 28.67 20.3 70-74 23.835 27.650000000000002 28.185 20.330000000000002 75-79 23.445 28.205000000000002 28.43 19.919999999999998 80-84 23.775 27.87 28.165000000000003 20.19 85-89 23.62 28.13 28.444999999999997 19.805 90-94 23.76 27.355 28.854999999999997 20.03 95-99 23.46 28.005000000000003 28.044999999999998 20.49 100-104 23.835 27.860000000000003 28.18 20.125 105-109 23.51 27.700000000000003 28.665000000000003 20.125 110-114 23.855 28.38 27.675 20.09 115-119 24.990000000000002 28.32 27.815 18.875 120-124 24.67 28.71 27.495000000000005 19.125 125-129 24.42 28.194999999999997 27.87 19.515 130-134 24.8 28.84 27.71 18.65 135-139 25.235000000000003 28.189999999999998 28.060000000000002 18.515 140-144 24.884999999999998 29.38 27.515 18.22 145-149 25.71 28.325 27.384999999999998 18.58 150-151 25.924999999999997 28.1625 28.712500000000002 17.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.0 25 2.0 26 3.5 27 7.0 28 9.5 29 14.5 30 21.5 31 26.0 32 31.0 33 38.0 34 56.0 35 73.0 36 86.0 37 118.5 38 160.5 39 163.0 40 185.5 41 226.5 42 244.0 43 256.5 44 273.0 45 282.0 46 272.0 47 261.0 48 234.0 49 186.5 50 148.0 51 132.5 52 114.0 53 85.0 54 66.0 55 60.0 56 49.0 57 32.0 58 21.5 59 20.5 60 12.5 61 8.0 62 5.0 63 3.0 64 2.0 65 0.5 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72382626161185 99.3 2 0.20085362791865427 0.4 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9000000000000004 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 3.9000000000000004 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.8625 0.0 0.0 0.0 0.0 120-121 5.362500000000001 0.0 0.0 0.0 0.0 122-123 5.9875 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 7.887499999999999 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.075 0.0 0.0 0.0 0.0 134-135 9.662500000000001 0.0 0.0 0.0 0.0 136-137 10.3125 0.0 0.0 0.0 0.0 138-139 10.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729171 spots for SRR7171117.sra Written 729171 spots for SRR7171117.sra Read 729186 spots for SRR7171117.sra Written 729186 spots for SRR7171117.sra SRR ids: ['SRR7171117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lw6c3f_c SRR7171117.sra spots: 14583435 blocks: [[1, 729171], [729172, 1458342], [1458343, 2187513], [2187514, 2916684], [2916685, 3645855], [3645856, 4375026], [4375027, 5104197], [5104198, 5833368], [5833369, 6562539], [6562540, 7291710], [7291711, 8020881], [8020882, 8750052], [8750053, 9479223], [9479224, 10208394], [10208395, 10937565], [10937566, 11666736], [11666737, 12395907], [12395908, 13125078], [13125079, 13854249], [13854250, 14583435]] SRR7171117 file size 4920147 SRR7171117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7171117 SRR7171117_1.fastq SRR7171117_2.fastq Input file: SRR7171117_1.fastq Paired file: SRR7171117_2.fastq trimmed: SRR7171117-trimmed-pair1.fastq, SRR7171117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:42:37 2025 >> started Fri Feb 14 06:42:54 2025 >> done (16.203s) 14583435 read pairs processed; of these: 10273 ( 0.07%) short read pairs filtered out after trimming by size control 13836 ( 0.09%) empty read pairs filtered out after trimming by size control 14559326 (99.83%) read pairs available; of these: 8448187 (58.03%) trimmed read pairs available after processing 6111139 (41.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 9 0.00% 21 3 0.00% 22 4 0.00% 23 5 0.00% 24 9 0.00% 25 8 0.00% 26 14 0.00% 27 12 0.00% 28 6 0.00% 29 8 0.00% 30 12 0.00% 31 20 0.00% 32 16 0.00% 33 20 0.00% 34 15 0.00% 35 14 0.00% 36 13 0.00% 37 21 0.00% 38 23 0.00% 39 28 0.00% 40 43 0.00% 41 32 0.00% 42 35 0.00% 43 44 0.00% 44 56 0.00% 45 67 0.00% 46 78 0.00% 47 71 0.00% 48 110 0.00% 49 89 0.00% 50 113 0.00% 51 156 0.00% 52 178 0.00% 53 209 0.00% 54 196 0.00% 55 197 0.00% 56 221 0.00% 57 258 0.00% 58 320 0.00% 59 358 0.00% 60 460 0.00% 61 540 0.00% 62 566 0.00% 63 665 0.00% 64 685 0.00% 65 798 0.01% 66 802 0.01% 67 966 0.01% 68 998 0.01% 69 1237 0.01% 70 1389 0.01% 71 1612 0.01% 72 1939 0.01% 73 2193 0.02% 74 2493 0.02% 75 2715 0.02% 76 3108 0.02% 77 3465 0.02% 78 3727 0.03% 79 4117 0.03% 80 4609 0.03% 81 5072 0.03% 82 5742 0.04% 83 6581 0.05% 84 7684 0.05% 85 8753 0.06% 86 9246 0.06% 87 9865 0.07% 88 10857 0.07% 89 11190 0.08% 90 12050 0.08% 91 12947 0.09% 92 13683 0.09% 93 15245 0.10% 94 16256 0.11% 95 17283 0.12% 96 17911 0.12% 97 18832 0.13% 98 19623 0.13% 99 20333 0.14% 100 21351 0.15% 101 22229 0.15% 102 23636 0.16% 103 25303 0.17% 104 26419 0.18% 105 27741 0.19% 106 28984 0.20% 107 30121 0.21% 108 30562 0.21% 109 31824 0.22% 110 32460 0.22% 111 33385 0.23% 112 34697 0.24% 113 36453 0.25% 114 37639 0.26% 115 39253 0.27% 116 40473 0.28% 117 41502 0.29% 118 42417 0.29% 119 42734 0.29% 120 44006 0.30% 121 44661 0.31% 122 46350 0.32% 123 47708 0.33% 124 49613 0.34% 125 50998 0.35% 126 52603 0.36% 127 53738 0.37% 128 54993 0.38% 129 56974 0.39% 130 57966 0.40% 131 59525 0.41% 132 61582 0.42% 133 64588 0.44% 134 66263 0.46% 135 70273 0.48% 136 73946 0.51% 137 77054 0.53% 138 81162 0.56% 139 86864 0.60% 140 92485 0.64% 141 101390 0.70% 142 112302 0.77% 143 126537 0.87% 144 149312 1.03% 145 177042 1.22% 146 223434 1.53% 147 305658 2.10% 148 471262 3.24% 149 906926 6.23% 150 3650453 25.07% 151 6111139 41.97% 14559326 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=2.3 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=80.45 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=3.0 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=139.14 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.8 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7171117 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:43:37 Started mapping on | Feb 14 06:43:37 Finished on | Feb 14 06:45:39 Mapping speed, Million of reads per hour | 429.62 Number of input reads | 14559326 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13582718 Uniquely mapped reads % | 93.29% Average mapped length | 289.85 Number of splices: Total | 12051167 Number of splices: Annotated (sjdb) | 11751889 Number of splices: GT/AG | 11825729 Number of splices: GC/AG | 168837 Number of splices: AT/AC | 7930 Number of splices: Non-canonical | 48671 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418772 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 25409 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 569170 569170 569170 N_multimapping 418772 418772 418772 N_noFeature 509444 13331466 597727 N_ambiguous 269249 1072 105866 UnstrandedReadsAssigned:12804025 PositiveStrandReadsAssigned:250180 NegativeStrandReadsAssigned:12879125 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7171117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7171117-trimmed-pair1.fastq SRR7171117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,559,326 reads, 12,838,681 reads pseudoaligned [quant] estimated average fragment length: 219.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7171117.ke.tsv 34699 SRR7171117.se.tsv 87100 total ==> SRR7171117.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.18 1504 59.5161 Potri.005G024800.1.v4.1 1035 816.177 414 36.1141 Potri.004G059700.1.v4.1 961 742.191 8 0.767423 Potri.007G009000.2.v4.1 1416 1197.18 0 0 Potri.003G141000.2.v4.1 2943 2724.18 843 22.0319 Potri.016G087400.1.v4.1 270 90.3852 1385 1090.97 Potri.015G069301.1.v4.1 564 347.681 0 0 Potri.010G195200.1.v4.1 1773 1554.18 386 17.6827 Potri.012G127500.1.v4.1 977 758.186 94 8.82699 ==> SRR7171117.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 415 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 60 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7171117 completed mapping pipeline successfully